Previous Article | Next Article 
Journal of Virology, July 2008, p. 6747-6752, Vol. 82, No. 13
0022-538X/08/$08.00+0 doi:10.1128/JVI.00247-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
Construction and Characterization of a Human T-Cell Lymphotropic Virus Type 3 Infectious Molecular Clone
Sébastien Alain Chevalier,1,4
Nga Ling Ko,1
Sara Calattini,1
Adeline Mallet,2
Marie-Christine Prévost,2
Kylene Kehn,3
John N. Brady,4
Fatah Kashanchi,3
Antoine Gessain,1 and
Renaud Mahieux1,3*
Unité d'Epidémiologie et Physiopathologie des Virus Oncogènes, CNRS URA 3015, Département de Virologie, Institut Pasteur, 28 rue du Dr. Roux, 75015 Paris, France,1
Plateforme de Microscopie Electronique, Institut Pasteur, 25 rue du Dr. Roux, 75015 Paris, France,2
Department of Microbiology, Immunology and Tropical Medicine and Department of Biochemistry, The George Washington University Medical Center, Washington, DC 20037,3
NIH/NCI/LCO/VTB, Bethesda, Maryland 208924
Received 4 February 2008/
Accepted 8 April 2008

ABSTRACT
We and others have uncovered the existence of human T-cell lymphotropic
virus type 3 (HTLV-3). We have now generated an HTLV-3 proviral
clone. We established that
gag, env, pol, pro, and
tax/rex as
well as minus-strand mRNAs are present in cells transfected
with the HTLV-3 clone. HTLV-3 p24
gag protein is detected in
the cell culture supernatant. Transfection of 293T-long terminal
repeat (LTR)-green fluorescent protein (GFP) cells with the
HTLV-3 clone promotes formation of syncytia, a hallmark of Env
expression, together with the appearance of fluorescent cells,
demonstrating that Tax is expressed. Viral particles are visible
by electron microscopy. These particles are infectious, as demonstrated
by infection experiments with purified virions.

TEXT
Phylogenetic analyses have provided supporting evidence that
multiple episodes of interspecies virus transmission have occurred
between nonhuman primates and humans (
9,
16). Examples are human
T-lymphotropic viruses (HTLVs) and their related simian counterparts
(STLVs) that all belong to the primate T-cell lymphotropic viruses
(
8,
10,
23). STLV type 3 (STLV-3) was isolated in 1994 from
a captive baboon (
Papio hamadryas) (
7). It is now well established
that STLV-3 strains are widespread in a number of simian species
living in West, East, and Central Africa (
5,
7,
12-
15,
18-
22).
HTLV type 3 (HTLV-3), the human counterpart of STLV-3, was discovered
in 2005 by our laboratory and another (
3,
17,
24), and a third
strain has been described more recently (
1). We sequenced the
8,553-bp genome of an HTLV-3 strain (HTLV-3
Pyl43) (
2) and showed
that it is very similar to that of STLV-3
CTO604, a simian strain
from Cameroon (
14). However, sequence comparisons also revealed
that the HTLV-3
Pyl43 genome is shorter than the STLV-3 sequences,
due to a 366-bp deletion in the pX proximal region. Of note,
this deletion does not affect
tax, rex, or
env sequences (
2).
Using a PCR-based strategy, we recently developed the first infectious STLV-3 molecular clone (4). Here, we have employed the same strategy to construct an HTLV-3 molecular clone, with HTLV-3Pyl43 DNA as a source of proviral material. In a first series of experiments, we generated the full-length 8,853-bp HTLV-3Pyl43 provirus by PCR amplification of 20 overlapping fragments as previously described (4). The proviral sequence was ligated into the SV2neo plasmid between the EcoRI and HpaI restriction sites (Fig. 1A, top panel). Clones were then screened by digesting the plasmids with EcoRI plus BamHI plus ScaI or with PstI or XbaI (Fig. 1A, top, middle, and bottom panels). Two clones (SV2Pyl43 cl9 and SV2Pyl43 cl26) displayed the expected restriction digestion pattern (Fig. 1B, lanes 2 to 3, 5 to 6, and 8 and 9), indicating that these plasmids contained the full-length HTLV-3Pyl43 provirus. Full sequence analysis was also performed on both clones and demonstrated that neither mutations nor deletions that would alter the different viral protein sequences had been introduced in the HTLV-3Pyl43 provirus during the cloning process (data not shown).
We then determined whether our molecular clone was capable of
directing mRNA synthesis in cell culture. To this end, SV2
Pyl43 cl9 and SV2
Pyl43 cl26 plasmids were transfected into 293T cells
as described previously (
4). After 2 days, total RNA was extracted
and treated twice with DNase I. Reverse transcription-PCR experiments
were then performed to detect different mRNA viral species—
gag, pro, and
pol (nonspliced);
env (singly spliced); and
tax/rex (doubly spliced)—as well as a putative mRNA transcribed
from the minus strand of the genome. This mRNA could be translated
into a protein that we tentatively named AEP (antisense-encoded
protein).
Total RNA (0.5 µg) was used as a matrix for reverse transcriptase PCR (RT-PCR) with the OneStep RT-PCR kit (Qiagen). PCR was performed using the following primer pairs: for Gag, LTR681s (GGAGAAAGCAAACAGGTGGGGG) and GAG1119as (GTGGGGGTGAAGGACAGGGAGG) (459-bp RT-PCR product); for Pro, Pro2016se (5'-AGGACTAACCTCCCCCCGGACC-3') and Pro2412as (5'-GAGAACACTTGAGGGTTGGTCAGC-3') (397-bp RT-PCR product); for Pol, Pol4029s (5'-CCATCCACCCAGTGTGACCTACAC-3') and Pol4633as (5'-GGGTTGTAGGGAACATGGGTTGAAT-3') (605-bp RT-PCR product);for Env, LTR111s (CCAAGGCTCTGACGTCTCTCCCTAC) and Env5117as (TGGGATTGCCAAAAGAGGAAGGG) (516-bp RT-PCR product); for Tax, 602LTR and 602MVB Rex (14) (424-bp RT-PCR product); and for AEP, Pyl43-AEPs (5'-GGAGGCTCCAACCTCAGG-3') and Pyl43-AEPas (5'-ACTCCGCCACTTCCTGTAG-3') (274-bp RT-PCR product).
As seen in Fig. 2A (lanes 4 and 5, top, middle, and bottom panels), an HTLV-3-specific band corresponding to different part of the gag pro pol transcript was present only in extracts obtained from SV2Pyl43-transfected cells. The absence of a PCR product when RT was omitted demonstrates the lack of DNA carryover in the RNA preparation (Fig. 2A, lanes 6 and 7, top, middle, and bottom panels). env and tax/rex transcripts were also present in these cell extracts (Fig. 2B, top and middle panels). Finally, we also demonstrated that, as in HTLV-1, the HTLV-3 minus strand is transcribed (Fig. 2B, bottom panel). Whether the protein that is translated from this mRNA is functionally related to HBZ remains to be determined. Next, 293T-long terminal repeat (LTR)-green fluorescent protein (GFP) indicator cells (6) were transfected with either the SV2Pyl43 cl9 or SV2Pyl43 cl26 plasmid.
The appearance of syncytia is linked to the interaction of the
viral envelope on the surface of the infected cells with the
viral receptors that are present on the surface of adjacent
cells. Forty-eight hours posttransfection, cell culture medium
was removed. Cells were washed with phosphate-buffered saline
and fixed, and pictures were taken with a Zeiss Axioplan-Axiocam-apotome
system (Fig.
3A). As expected, syncytium formation was observed
after transfection of SV2
Pyl43 cl9 or SV2
Pyl43 cl26 plasmid
in the 293T-LTR-GFP cells demonstrating HTLV-3 envelope expression
(Fig.
3A, panels a and d). These syncytia were GFP positive
(Fig.
3A, panels b and c and e and f), therefore establishing
that the Tax protein was expressed and able to transactivate
the viral promoter in these cells. GFP signal and syncytia were
not visible in cells transfected with the empty backbone vector
(Fig.
3A, panel g).
To determine whether SV2
Pyl43-transfected cells produce infectious
particles, cell culture supernatant was collected from SV2
Pyl43 cl9- orSV2
Pyl43 cl26-transfected cells, purified, and added
to 293T-LTR-GFP indicator cells as previously described (
4)
(Fig.
3B). After several days of culture, a number of GFP-positive
syncytia were reproducibly observed (Fig.
3B, panels a and d).
These syncytia were GFP positive (panels b and c and e and f).
As a control, we did not observe any syncytia when 293T-LTR-GFP
cells were put in contact with supernatant from cells transfected
with the backbone vector (Fig.
3B, panel g). We also performed
RT-PCR on the RNA extracted from cells infected with cell-free
virus. RNA was extracted and reverse transcribed as described
above. PCR was then performed with primers located within the
gag open reading frame: LTR681s (5'-GGAGAAAGCAAACAGGTGGGGG-3')
and Gag1293as (5'-TCATGGAGATCTTTAGCTGTGGGG-3' (PCR product of
612 bp).
This allowed us to demonstrate that gag pro pol mRNA was present in these cells (Fig. 3C). Altogether, these results demonstrate that the purified HTLV-3Pyl43 particles are infectious.
We also wanted to observe viral particles. Forty-eight hours posttransfection of 293T with the molecular clone, cell culture medium was removed and the cells were washed with phosphate-buffered saline and fixed for ultrastructural analyses as previously described (4). Viral particles were then detected in SV2Pyl43 cl9-transfected cells by electron microscopy (Fig. 4A) but not in the cells transfected with the backbone vector (data not shown). The size of these particles is roughly similar to that of STLV-3 particles (4).
Finally, the supernatant of 293T cells transfected with SV2
Pyl43 cl9 was analyzed (Fig.
4B). Growth medium was collected, clarified
by low-speed centrifugation, and filtrated. Virus was then layered
on a 20% glycerol gradient and centrifuged. The pellet was resuspended
in lysis buffer. Each sample was resolved by electrophoresis
on a 10%
N,
N-methylenebisacrylamide-Tris gel. As controls, the
supernatant from HTLV-1-infected (Hut102) and/or HTLV-2-infected
(C19, MO) cell cultures was also tested. The membrane was incubated
using STLV-3 plasma (Fig.
4B, left panel) or HTLV-1 plasma (right
panel). With both sera, a band corresponding to the HTLV-3 p24
gag protein was observed in the supernatant obtained from SV2
Pyl43 cl9-transfected cells, but not in the protein extracts from
SV2
neo-transfected cells. Interestingly, the STLV-3 plasma also
allowed the detection of the HTLV-1 and HTLV-2 p24
gag protein
(Fig.
4B, left panel).
Altogether, our data demonstrate that the SV2Pyl43 cl9 molecular clone is functional and produces infectious viral particles. Comparison of the viral life cycles of both STLV-3 and HTLV-3 in a rabbit model (11) will now allow us to ascertain whether the 366-bp deletion impacts either viral infectivity or replication in vivo. Finally, given the fact that an HTLV-3-infected cell line is not yet available, this clone will be a unique and powerful tool that will allow us to investigate HTLV-3 protein expression and viral pathogenesis in vivo.

ACKNOWLEDGMENTS
This work was supported by fellowships from le Ministère
de la Recherche and from La Fondation pour la Recherche Médicale
to S.A.C., from la Ligue Contre le Cancer to S.C., and from
the Croucher Foundation to N.L.K. R.M. is supported by INSERM.
This work was supported by grants from the Virus Cancer Prevention
Association, from the Programme Interdisciplinaire CNRS Maladies
Infectieuses Émergentes to R.M., and from an NIH grant
(AI072495-01) to R.M. and F.K.
We thank B. Barbeau for help in designing the AEP primers.

FOOTNOTES
* Corresponding author. Mailing address: INSERM, Unité d'Epidémiologie et Physiopathologie des Virus Oncogènes, CNRS URA 3015, Institut Pasteur, 28 rue du Docteur Roux, 75724 Paris cedex 15, France. Phone: (33) 1-45-68-89-06. Fax: (33) 1-40-61-34-65. E-mail:
rmahieux{at}pasteur.fr 
Published ahead of print on 16 April 2008. 

REFERENCES
1 - Calattini, S., E. Betsem, A. Froment, S. Bassot, S. A. Chevalier, R. Mahieux, and A. Gessain. 2007. Identification and complete sequence analysis of a new HTLV-3 strain from South Cameroon. AIDS Res. Hum. Retrovir. 23:596.
2 - Calattini, S., S. A. Chevalier, R. Duprez, P. Afonso, A. Froment, A. Gessain, and R. Mahieux. 2006. Human T-cell lymphotropic virus type 3: complete nucleotide sequence and characterization of the human Tax3 protein. J. Virol. 80:9876-9888.[Abstract/Free Full Text]
3 - Calattini, S., S. A. Chevalier, R. Duprez, S. Bassot, A. Froment, R. Mahieux, and A. Gessain. 2005. Discovery of a new human T-cell lymphotropic virus (HTLV-3) in Central Africa. Retrovirology 2:30.[CrossRef][Medline]
4 - Chevalier, S. A., M. Walic, S. Calattini, A. Mallet, M.-C. Prevost, A. Gessain, and R. Mahieux. 2007. Construction and characterization of a full-length infectious simian T-cell lymphotropic virus type 3 molecular clone. J. Virol. 81:6276-6285.[Abstract/Free Full Text]
5 - Courgnaud, V., S. Van Dooren, F. Liegeois, X. Pourrut, B. Abela, S. Loul, E. Mpoudi-Ngole, A. Vandamme, E. Delaporte, and M. Peeters. 2004. Simian T-cell leukemia virus (STLV) infection in wild primate populations in Cameroon: evidence for dual STLV type 1 and type 3 infection in agile mangabeys (Cercocebus agilis). J. Virol. 78:4700-4709.[Abstract/Free Full Text]
6 - Delebecque, F., K. Pramberger, M.-C. Prévost, M. Brahic, and F. Tangy. 2002. A chimeric human T-cell lymphotropic virus type 1 with the envelope glycoprotein of Moloney murine leukemia virus is infectious for murine cells. J. Virol. 76:7883-7889.[Abstract/Free Full Text]
7 - Goubau, P., M. Van Brussel, A. M. Vandamme, H. F. Liu, and J. Desmyter. 1994. A primate T-lymphotropic virus, PTLV-L, different from human T-lymphotropic viruses types I and II, in a wild-caught baboon (Papio hamadryas). Proc. Natl. Acad. Sci. USA 91:2848-2852.[Abstract/Free Full Text]
8 - Guo, H. G., F. Wong-Stall, and R. C. Gallo. 1984. Novel viral sequences related to human T-cell leukemia virus in T cells of a seropositive baboon. Science 223:1195-1197.[Abstract/Free Full Text]
9 - Hahn, B. H., G. M. Shaw, K. M. De Cock, and P. M. Sharp. 2000. AIDS as a zoonosis: scientific and public health implications. Science 287:607-614.[Abstract/Free Full Text]
10 - Hunsmann, G., J. Schneider, H. Bayer, E. Jurkiewicz, and N. Yamamoto. 1984. Structural and epidemiological features of primate lymphotropic retroviruses. Princess Takamatsu Symp. 15:109-118.[Medline]
11 - Lairmore, M. D., L. Silverman, and L. Ratner. 2005. Animal models for human T-lymphotropic virus type 1 (HTLV-1) infection and transformation. Oncogene 24:6005-6015.[CrossRef][Medline]
12 - Liegeois, F., B. Lafay, W. M. Switzer, S. Locatelli, E. Mpoudi-Ngole, S. Loul, W. Heneine, E. Delaporte, and M. Peeters. 2008. Identification and molecular characterization of new STLV-1 and STLV-3 strains in wild-caught nonhuman primates in Cameroon. Virology 371:405-417.[CrossRef][Medline]
13 - Meertens, L., and A. Gessain. 2003. Divergent simian T-cell lymphotropic virus type 3 (STLV-3) in wild-caught Papio hamadryas papio from Senegal: widespread distribution of STLV-3 in Africa. J. Virol. 77:782-789.[CrossRef][Medline]
14 - Meertens, L., R. Mahieux, P. Mauclére, J. Lewis, and A. Gessain. 2002. Complete sequence of a novel highly divergent simian T-cell lymphotropic virus from wild-caught red-capped mangabeys (Cercocebus torquatus) from Cameroon: a new primate T-lymphotropic virus type 3 subtype. J. Virol. 76:259-268.[Abstract/Free Full Text]
15 - Meertens, L., V. Shanmugam, A. Gessain, B. E. Beer, Z. Tooze, W. Heneine, and W. M. Switzer. 2003. A novel, divergent simian T-cell lymphotropic virus type 3 in a wild-caught red-capped mangabey (Cercocebus torquatus torquatus) from Nigeria. J. Gen. Virol. 84:2723-2727.[Abstract/Free Full Text]
16 - Slattery, J. P., G. Franchini, and A. Gessain. 1999. Genomic evolution, patterns of global dissemination, and interspecies transmission of human and simian T-cell leukemia/lymphotropic viruses. Genome Res. 9:525-540.[Abstract/Free Full Text]
17 - Switzer, W. M., S. H. Qari, N. D. Wolfe, D. S. Burke, T. M. Folks, and W. Heneine. 2006. Ancient origin and molecular features of the novel human T-lymphotropic virus type 3 revealed by complete genome analysis. J. Virol. 80:7427-7438.[Abstract/Free Full Text]
18 - Takemura, T., M. Yamashita, M. K. Shimada, S. Ohkura, T. Shotake, M. Ikeda, T. Miura, and M. Hayami. 2002. High prevalence of simian T-lymphotropic virus type L in wild Ethiopian baboons. J. Virol. 76:1642-1648.[Abstract/Free Full Text]
19 - Van Brussel, M., P. Goubau, R. Rousseau, J. Desmyter, and A.-M. Vandamme. 1997. Complete nucleotide sequence of the new simian T-lymphotropic virus, STLV-PH969 from a Hamadryas baboon, and unusual features of its long terminal repeat. J. Virol. 71:5464-5472.[Abstract]
20 - Van Brussel, M., P. Goubau, R. Rousseau, J. Desmyter, and A. M. Vandamme. 1996. The genomic structure of a new simian T-lymphotropic virus, STLV-PH969, differs from that of human T-lymphotropic virus types I and II. J. Gen. Virol. 77:347-358.[Abstract/Free Full Text]
21 - Van Dooren, S., M. Salemi, X. Pourrut, M. Peeters, E. Delaporte, M. Van Ranst, and A.-M. Vandamme. 2001. Evidence for a second simian T-cell lymphotropic virus type 3 in Cercopithecus nictitans from Cameroon. J. Virol. 75:11939-11941.[Free Full Text]
22 - Van Dooren, S., V. Shanmugam, V. Bhullar, B. Parekh, A. M. Vandamme, W. Heneine, and W. M. Switzer. 2004. Identification in gelada baboons (Theropithecus gelada) of a distinct simian T-cell lymphotropic virus type 3 with a broad range of Western blot reactivity. J. Gen. Virol. 85:507-519.[Abstract/Free Full Text]
23 - Verdonck, K., E. Gonzalez, S. Van Dooren, A. M. Vandamme, G. Vanham, and E. Gotuzzo. 2007. Human T-lymphotropic virus 1: recent knowledge about an ancient infection. Lancet Infect. Dis. 7:266-281.[CrossRef][Medline]
24 - Wolfe, N. D., W. Heneine, J. K. Carr, A. D. Garcia, V. Shanmugam, U. Tamoufe, J. N. Torimiro, A. T. Prosser, M. Lebreton, E. Mpoudi-Ngole, F. E. McCutchan, D. L. Birx, T. M. Folks, D. S. Burke, and W. M. Switzer. 2005. Emergence of unique primate T-lymphotropic viruses among central African bushmeat hunters. Proc. Natl. Acad. Sci. USA 102:7994-7999.[Abstract/Free Full Text]
Journal of Virology, July 2008, p. 6747-6752, Vol. 82, No. 13
0022-538X/08/$08.00+0 doi:10.1128/JVI.00247-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Halin, M., Douceron, E., Clerc, I., Journo, C., Ko, N. L., Landry, S., Murphy, E. L., Gessain, A., Lemasson, I., Mesnard, J.-M., Barbeau, B., Mahieux, R.
(2009). Human T-cell leukemia virus type 2 produces a spliced antisense transcript encoding a protein that lacks a classic bZIP domain but still inhibits Tax2-mediated transcription. Blood
114: 2427-2438
[Abstract]
[Full Text]
-
Jones, K. S., Huang, Y. K., Chevalier, S. A., Afonso, P. V., Petrow-Sadowski, C., Bertolette, D. C., Gessain, A., Ruscetti, F. W., Mahieux, R.
(2009). The Receptor Complex Associated with Human T-Cell Lymphotropic Virus Type 3 (HTLV-3) Env-Mediated Binding and Entry Is Distinct from, but Overlaps with, the Receptor Complexes of HTLV-1 and HTLV-2. J. Virol.
83: 5244-5255
[Abstract]
[Full Text]
-
Besson, G., Kazanji, M.
(2009). One-Step, Multiplex, Real-Time PCR Assay with Molecular Beacon Probes for Simultaneous Detection, Differentiation, and Quantification of Human T-Cell Leukemia Virus Types 1, 2, and 3. J. Clin. Microbiol.
47: 1129-1135
[Abstract]
[Full Text]