JVI Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Other Versions of this Article:
JVI.00254-08v1
82/12/5887    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Google Scholar
Right arrow Articles by Grimm, D.
Right arrow Articles by Kay, M. A.
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grimm, D.
Right arrow Articles by Kay, M. A.

 Previous Article  |  Next Article 

Journal of Virology, June 2008, p. 5887-5911, Vol. 82, No. 12
0022-538X/08/$08.00+0     doi:10.1128/JVI.00254-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

In Vitro and In Vivo Gene Therapy Vector Evolution via Multispecies Interbreeding and Retargeting of Adeno-Associated Viruses {triangledown} ,{dagger}

Dirk Grimm,1,{ddagger} Joyce S. Lee,1 Lora Wang,1 Tushar Desai,2 Bassel Akache,1 Theresa A. Storm,1 and Mark A. Kay1*

Departments of Pediatrics and Genetics, 300 Pasteur Drive,1 Department of Biochemistry, 279 Campus Drive, School of Medicine, Stanford University, Stanford, California 943052

Received 4 February 2008/ Accepted 2 April 2008


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Adeno-associated virus (AAV) serotypes differ broadly in transduction efficacies and tissue tropisms and thus hold enormous potential as vectors for human gene therapy. In reality, however, their use in patients is restricted by prevalent anti-AAV immunity or by their inadequate performance in specific targets, exemplified by the AAV type 2 (AAV-2) prototype in the liver. Here, we attempted to merge desirable qualities of multiple natural AAV isolates by an adapted DNA family shuffling technology to create a complex library of hybrid capsids from eight different wild-type viruses. Selection on primary or transformed human hepatocytes yielded pools of hybrids from five of the starting serotypes: 2, 4, 5, 8, and 9. More stringent selection with pooled human antisera (intravenous immunoglobulin [IVIG]) then led to the selection of a single type 2/type 8/type 9 chimera, AAV-DJ, distinguished from its closest natural relative (AAV-2) by 60 capsid amino acids. Recombinant AAV-DJ vectors outperformed eight standard AAV serotypes in culture and greatly surpassed AAV-2 in livers of naïve and IVIG-immunized mice. A heparin binding domain in AAV-DJ was found to limit biodistribution to the liver (and a few other tissues) and to affect vector dose response and antibody neutralization. Moreover, we report the first successful in vivo biopanning of AAV capsids by using a new AAV-DJ-derived viral peptide display library. Two peptides enriched after serial passaging in mouse lungs mediated the retargeting of AAV-DJ vectors to distinct alveolar cells. Our study validates DNA family shuffling and viral peptide display as two powerful and compatible approaches to the molecular evolution of novel AAV vectors for human gene therapy applications.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A large number of inherited or acquired diseases remain promising targets for human gene therapy. One vector that has shown outstanding potential thus far in numerous preclinical and clinical evaluations is based on nonpathogenic adeno-associated virus (AAV). A unique asset among various properties that make AAV especially attractive over its competitors, such as adenoviral or lentiviral vectors, is the availability of a vast number of natural isolates which differ significantly in their properties (24). We and others have shown previously that the function of an AAV vector particle is determined mainly by the capsid protein and that viral Rep proteins and genomic packaging elements are largely interchangeable (24, 27, 85). Paradoxically, the ever-increasing repertoire of naturally occurring and synthetically generated AAV capsid sequences (>300 to date) is currently creating a dilemma for the rational selection of the optimal serotype for a given application. The importance of finding the ideal capsid for efficient and safe gene transfer has been exemplified in many preclinical studies, as well as in a clinical trial using the AAV type 2 (AAV-2) prototype in human liver tissue (36, 47). In one previous study, the treatment of patients with severe hemophilia B with recombinant AAV-2 expressing human factor IX (hFIX) resulted in mildly elevated, yet therapeutic, levels of this blood coagulation factor. However, expression was short lived, and the hFIX decline was accompanied by a transient asymptomatic increase of liver transaminases, due to a T-cell immune response against the AAV-2 capsid (47). Also, preexisting neutralizing anti-AAV-2 antibodies (frequent in humans) in these individuals likely inhibited the linear vector dose response previously observed in animals.

We and others have suggested previously that the use of novel AAV serotypes, in particular, nonhuman isolates, will help to overcome some of these problems (19, 24, 63). Important examples are AAV-8 and AAV-9, which can transduce mouse liver far better than AAV-2, albeit the difference in dogs or primates is less clear (17, 52, 54, 75). The potential for the complete transduction of liver tissue and perhaps other tissues makes these two non-AAV-2 serotypes also particularly interesting for therapeutic RNA interference (RNAi) (28). We recently demonstrated the feasibility of efficiently and persistently suppressing hepatitis B virus with RNAi from a double-stranded AAV-8 vector (28). On the other hand, a potential drawback of AAV-8 and AAV-9 is their lack of specific tissue tropism (34, 52). The resulting frequent vector dissemination into all organs, including the brain, even from low peripheral doses in mice or monkeys (52, 54) is a particular concern for RNAi therapies in which control over vector biodistribution and the limitation of off-target effects will be imperative for the success of the approach (28).

In order to overcome the constraints of wild-type AAV serotypes, numerous groups have recently begun to develop novel strategies to engineer "designer" AAVs tailored for the therapeutic transduction of clinically relevant organs (reviewed in detail in references 9, 12, 35, 41, 51, and 85). Briefly, the variety of strategies can be grouped into indirect or chemical approaches and direct physical modification strategies. In the indirect approaches, specific molecules (e.g., bispecific antibodies [6] or avidin-coupled ligands [4]) are allowed to react with the viral surface (biotinylated in the case of avidin [4]), as well as a cellular receptor, forming a conjugate ideally able to retarget the capsid to a refractory cell type. Yet, numerous pharmacological problems, such as concerns about in vivo complex stability and difficulties in upscaling complex manufacturing, continue to prevent the broad adaptation of these approaches. Alternative, more powerful strategies rely on the direct physical modification of the AAV capsid protein and gene. Early examples include the generation of mosaic AAV capsids via the mixing of helper plasmids carrying capsid genes from distinct serotypes, such as AAV-1 and AAV-2 (30) and pairwise combinations of AAV-1 through AAV-5 (62). Similar mosaics were generated previously via a marker rescue approach, yielding AAV-2/AAV-3 recombinants with unique properties (8). A related strategy is the rational creation of chimeric virions via domain swapping among multiple parental serotypes, involving either entire capsid loops or parts thereof or individual residues. Notable examples include AAV-1/AAV-2 chimeras with improved tropism in muscle tissue (31), with one of these chimeras presently being studied in a phase I clinical trial for the treatment of Duchenne muscular dystrophy (85). Most recently, our own group described a battery of unique chimeras comprising elements from serotypes 2 and 8, which were exploited to identify capsid subdomains responsible for efficient AAV transduction in murine liver tissue in vivo (64).

A special type of chimeric capsids are those containing foreign proteins or peptides inserted into various positions of the virion shell. The methods and strategies used are widely diverse, and again, we refer to comprehensive reviews (12, 35, 41). Noteworthy here are approaches to fuse targeting ligands to the N termini of AAV capsid proteins (ideally, VP2 [45, 83]), or more powerful, to insert short peptides (up to 14 amino acids [21], typically 7) into exposed regions of the assembled virion. This strategy is referred to as viral display, in analogy to phage display, and has already been used extensively to retarget AAV-2 virions to a multitude of refractory or hard-to-infect cell types, such as vascular endothelial, smooth muscle, and pancreatic islet cells (43, 55, 77, 81, 82) and various tumor lines (22, 58, 65, 66). It has particularly benefited from comprehensive mutational analyses by various groups (e.g., references 21, 33, 56, and 83) that have resulted in the identification of prominent locations within the AAV-2 capsid tolerating peptide insertion. Most notable is the heparin binding domain (HBD), consisting of a total of four arginine (R) residues and one lysine residue, with R585 and R588 representing the most crucial components (37, 56). Numerous groups have now consistently shown that the insertion of 7-mer peptides into this region not only is frequently well tolerated and efficiently mediates virus retargeting, but also provides the extra benefit that the endogenous AAV-2 tropism can be abolished, thus enhancing target specificity (e.g., reference 21).

In addition to identifying sites for vector engineering, some of the mutational AAV studies directly yielded novel capsid variants with potential benefits for clinical use. A remarkable case was a recent study by Lochrie et al. (42) in which a set of 127 AAV-2 variants with point or insertion mutations were generated and screened for multiple properties. Several capsids were isolated which differed from the wild-type AAV-2 capsid in having better in vitro transduction efficiencies (albeit being equally efficient in vivo) or, clinically most relevant, higher-level resistance to individual or pooled human antisera. Nonetheless, the limitations of the approach also became clear, most notably, the extreme effort required to generate and manually screen a large number of mutants, which in fact prevented the interesting analyses of all possible combinations of beneficial point mutations in further capsids.

Indeed, the factors of time and labor are the main reasons why an increasing number of groups have recently begun to develop novel means for AAV vector evolution that no longer rely on the rational modification of the AAV-2 capsid. Instead, the new combinatorial methodologies allow for the far more efficient creation and selection of interesting candidates in a library-based high-throughput format. Thus far, two different strategies have been reported, both principally expanding on previously developed techniques. One is the use of viral display libraries, in which random 7-mer peptides are inserted into the AAV-2 HBD (at amino acid 587 or 588), yielding between 4 x 106 and 1.7 x 108 capsids potentially exposing new ligands on their surfaces (50, 58, 76). Subsequent iterative selection on diverse cell types refractory to the wild type, e.g., coronary artery endothelial cells, cardiomyoblasts, and carcinoma, leukemia, and megakaryocytic cell lines, led to enrichment with peptide mutants with increased target specificities and efficacies (48, 50, 58, 76). The second library type, independently described by two groups in 2006, relies on error-prone PCR amplification of the AAV-2 capsid gene (46, 59). Similar to the methods in earlier mutational studies, this approach resulted in the identification of AAV-2 point mutations (usually up to two per capsid) which yielded mutants that differed from the wild type in having mildly enhanced efficacies in vitro and/or improved transduction efficiencies in the presence of neutralizing anti-AAV-2 antibodies either generated in rabbits or preexisting in individual human sera.

Here, for the first time, we introduce the technology of DNA family shuffling into the realm of AAV vector evolution. The basic concept of this technology is the in vitro recombination of related parental genes with >50% homology, which are first fragmented and then reassembled based on partial homology, resulting in libraries of chimeric genes. Iterative amplification under pressure can then yield hybrids not only combining parental assets, but also ideally exhibiting novel and synergistic properties (70, 71). DNA family shuffling has been used extensively in recent years to evolve and improve all types of proteins, from markers and enzymes to vaccines (e.g., references 10, 13-15, and 39). Importantly, a set of reports also suggested its power to enhance viral gene therapy vectors by creating retro- or lentiviruses with improved stability or efficacy compared to that of the parental wild types (57, 61, 69). Here, we describe the novel use of DNA family shuffling for the highly efficient molecular interbreeding of eight multispecies AAVs to create chimeric capsids and, moreover, document its compatibility and synergism with existing AAV vector evolution technology.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Plasmids for generation of shuffled AAV capsid library. Plasmids containing full-length capsid genes (cap) of seven different AAV serotypes were present in the lab (for AAV-2, AAV-4, and AAV-5) or kindly provided by James Wilson (for AAV-8 and AAV-9) or Jay Chiorini and Rob Kotin (for avian and bovine AAV). Goat AAV was not available as a molecular clone early in our study and was therefore partly synthesized (GeneArt, Regensburg, Germany) as an 888-nucleotide (nt) fragment (nt 1023 to 1910). This subclone corresponds to the entire right half of the goat AAV capsid protein, which comprises all 42 reported (3) differences between goat AAV and AAV-5. The other seven cap genes were initially amplified via PCR and subcloned into pBluescript II SK (Stratagene). The purpose was to flank all cap genes with sites for the unique restriction enzyme PacI (5') or AscI (3') to facilitate the later cloning of shuffled cap genes into a wild-type AAV plasmid (see below). All primers also contained either a HindIII (5') or a SpeI (3') site to allow directed cloning into pBluescript (none of the four restriction enzymes cut in any parental cap gene). A 20-nt signature region was inserted between the two restriction sites in each primer to provide conserved primer binding sites for the later PCR amplification of shuffled genes. The resulting sequence of the forward primer was 5' GGACTC AAGCTT GTCTGAGTGACTAGCATTCG TTAATTAA CAGGT ATG N22 3' (the HindIII site is in bold, the PacI site is in bold italics, the signature region is underlined, and N22 denotes the first 22 nt of each cap gene following the ATG start codon). Likewise, the reverse primer was 5' CGTGAG ACTAGT GCTTACTGAAGCTCACTGAG GGCGCGCC TTA N22 3' (the SpeI site is in bold, the AcsI site is in bold italics, the signature region is underlined, and N22 denotes the last 22 nt of each cap gene up to the TAA stop codon).

In parallel, a wild-type cap recipient plasmid was engineered to contain the AAV-2 packaging elements (inverted terminal repeats [ITRs]) flanking the AAV-2 rep gene (encoding AAV replication proteins), together with PacI and AscI sites for cap cloning and the AAV-2 polyadenylation site. Therefore, AAV-2 rep (nt 191 to 2189) was PCR amplified using primers containing BglII sites and then subcloned into pTRUF3 (carrying AAV-2 ITRs with adjacent BglII sites) (88). The forward primer used was 5' CGAACC AGATCT GTCCTGTATTAGAGGTCACGTGAG 3' (the BglII site is in bold, and AAV-2 nt 191 is underlined), and the reverse primer was 5' GGTAGC AGATCT GTTCGACCGCAGCCTTTCGAATGTCCGG TTTATT GATTA GGCGCGCC CTGGACTC TTAATTAA CATTTATTGTTCAAAGATGC 3' (the BglII site is in bold, the polyadenylation signal is underlined, the AscI site is in bold italics, the PacI site is underlined and shown in bold italics, and the AAV-2 rep stop codon is underlined and shown in italics). Note that this procedure changed the AAV-2 SwaI site (downstream of the rep stop codon) into a PacI site.

DNA family shuffling of AAV capsid genes. For DNA family shuffling, we basically utilized a two-step protocol in which the parental genes were first fragmented using DNase I enzyme and then reassembled into a full-length gene via primerless PCR (69, 71). This PCR was followed by a second PCR including primers binding outside of the cap genes, allowing the subcloning of the products into the wild-type recipient ITR-rep plasmid (see above and Fig. 1B). Initially, we isolated all cap genes from our subclones via HindIII/SpeI digestion (EcoRI digestion for goat AAV) and then optimized the reaction conditions as follows. We tested various DNase I concentrations and incubation times, aiming to obtain a pool of fragments between 0.2 and 1.0 kb in size (which gave the best results in later steps). The optimal conditions were found to be 1 µg of each cap gene, 1 µl of 1:200-prediluted DNase I (10 U/µl; Roche), 50 mM Tris-Cl (pH 7.4), and 1 mM MgCl2 in a total volume of 50 µl. The reaction mixture was incubated for 2 min at room temperature, and then the reaction was stopped by heat inactivation at 75°C for 10 min. Fragments of the desired sizes were isolated by running the entire reaction mixture on a 1% agarose gel (total final mixture volume, ~60 µl). We next optimized the reassembly PCR by testing various DNA polymerases (Platinum Pfx [Invitrogen], DeepVent [NEB], and Taq [Amersham]) and respective conditions. Best results were obtained using PuReTaq ready-to-go PCR beads (Amersham) and the following conditions: 25 µl of purified cap fragments and a program of 4 min at 95°C; 40 cycles of 1 min at 95°C, 1 min at 50°C, and 3 min at 72°C; 10 min at 72°C; and 10 min at 4°C. Agarose gel (1%) analysis of 1 µl from this reaction mixture typically showed a smear in the area up to the 5-kb marker and no distinct bands. The same three polymerases listed above were then evaluated for the primer-containing second PCR mixture, and the following conditions were found to be optimal: 1 µl of Platinum Pfx, 2 µl of the product from the first PCR, 1 mM MgSO4, 1 µg of each primer (see below), and 0.3 mM (each) deoxynucleoside triphosphates in a total volume of 50 µl and a program of 5 min at 94°C; 40 cycles of 30 s at 94°C, 1 min at 55°C, and 3 min at 68°C; 10 min at 68°C; and 10 min at 4°C. The primers used bound to the 20-nt signature regions described above. This reaction gave a distinct ~2.2-kb full-length cap band (on 1% agarose gel), which was purified (60 µl total) and cloned (4 µl) by using the Zero Blunt TOPO PCR cloning kit (with electrocompetent Escherichia coli TOP10 cells; Invitrogen, Carlsbad, CA). This intermediate cloning step significantly enhanced the yield of shuffled cap genes compared to that of efforts to clone the PCR product directly via conventional means (data not shown). The shuffled cap genes were then released from the TOPO plasmid via PacI and AscI double digestion and cloned into the appropriately digested ITR-rep recipient plasmid.


Figure 1
View larger version (18K):
[in this window]
[in a new window]

 
FIG. 1. Generation of an AAV capsid library via DNA family shuffling. (A) Phylogram tree (created using PhyloDraw [http://pearl.cs.pusan.ac.kr/phylodraw/#test]) showing the eight AAV serotypes used as parents for DNA family shuffling (numbers denote lengths of capsid genes, in nucleotides). Branch lengths are proportional to the amounts of evolutionary change, calculated in ClustalW (http://www.ebi.ac.uk/clustalw/#). CAAV, AAAV, and BAAV, caprine, avian, and bovine AAVs, respectively. (B) Individual steps for generation of the library (scheme). Full-length cap genes were PCR amplified and subcloned for further amplification (1) and then isolated (2) and DNase I digested (3). Two consecutive PCRs without (4) or with (5) conserved primers were performed to reassemble shuffled full-length cap genes. These genes were inserted (6) into a plasmid carrying AAV-2 ITRs and a rep gene. The transfection of 293 cells with the resulting plasmid library (7) together with an adenoviral helper resulted in a viral library. One possible selection scheme used in this study was the coinfection of cultured liver cells (8) with the library and helper adenovirus under stringent conditions, resulting in the amplification of specific AAV capsids. Viral DNA can then be isolated (9) and cloned into an AAV helper plasmid carrying the AAV-2 rep gene without ITRs (10) for subsequent vector production. Ad5, helper adenovirus type 5. (C) Examples of shuffled cap genes in an initial small-scale library. DNA was extracted from 24 randomly chosen clones, and 5' and 3' ends of the individual cap genes were sequenced (using T3/T7 primers binding in the plasmid backbone). Shown, per end, are six representative alignments with the eight parents.

 
Performing all these reactions under minimal conditions (with respect to volumes and amounts), we obtained a library of approximately 3 x 104 bacterial colonies. The upscaling of each step (including final plating onto 100 15-cm plates) resulted in a final library of ~7 x 105 plasmid clones. The integrity, genetic diversity, and functionality of the library were confirmed by DNA sequencing and small-scale expression studies (see Fig. 1C and Fig. S1 and S2 in the supplemental material).

Selective in vitro amplification of the shuffled capsid library. We prepared a viral library by transfecting 293 cells in 50 T225 flasks (~109 cells) with 50 µg of plasmid from the bacterial library per flask, together with 25 µg of an adenoviral helper plasmid (23). The resulting hybrid viruses were concentrated, purified, and titrated as described previously for recombinant AAV (23, 53). The final library used in this study had a particle titer (viral genome concentration) of 8.2 x 1011/ml (total volume, 3 ml). Various amounts of purified shuffled AAV were then incubated with the different cell lines (in 6-cm dishes), together with various amounts of helper adenovirus type 5. Ideally, the adenovirus would lyse the cells within 3 days, giving the AAV sufficient time to replicate. The AAV amounts were adjusted empirically so that we obtained minimal signals in Western blot analyses of cell extracts. This strategy helped to optimize the stringency of our library in each amplification round by ensuring that (ideally) a single viral genome was delivered to each cell and subsequently packaged into the capsid expressed from this particular viral genome. In one set of experiments, the library was additionally subjected to intravenous immunoglobulin (IVIG) pressure during amplification. Therefore, various volumes of the library and IVIG (GamimuneN [10%]; Bayer, Elkhart, IN) were mixed (see Fig. S3 in the supplemental material for examples), and the mixtures were incubated for 1 h at 37°C and then added to the cells. After overnight incubation, the cells were washed and superinfected with adenovirus. The wash step was included to avoid helper virus inactivation by the IVIG. As before, AAV amplification was controlled by Western blotting after each round, and only supernatants giving minimal expression were used for subsequent infections. The increasing IVIG resistance of the library during consecutive passages allowed us to continuously escalate the IVIG doses (see Fig. S3 in the supplemental material). All amplification experiments comprised five infection cycles (adenovirus was heat inactivated between each and then added fresh, to avoid uncontrolled amplification). Finally, viral DNA was purified from the supernatant by using a DNA extractor kit (Wako, Japan), and AAV cap genes were PCR amplified by using DeepVent polymerase and primers 5' GATCTGGTCAATGTGGATTTGGATG 3' (binding in AAV-2 rep upstream of the PacI site used for cap cloning) and 5' GACCGCAGCCTTTCGAATGTCCG 3' (binding downstream of the AscI site and the polyadenylation signal). The resulting blunt-ended cap genes were subcloned using the Zero Blunt TOPO PCR cloning kit for sequencing (Invitrogen), and DNA from individual clones (96 per cell line per amplification round) was prepared. To assemble full-length cap sequences, we first used T3 and T7 primers to obtain the 5' and 3' ends of each clone and then designed individual primers (data not shown) to acquire the remaining sequence. Alignments (DNA and protein) with the sequences of the eight parental viruses were performed using BLAST and VectorNTI 10/AlignX software (Invitrogen).

Helper plasmid cloning and vector particle production. Helper plasmids expressing wild-type AAV-2, AAV-8, or AAV-9 cap together with AAV-2 rep genes, as well as AAV-2-based vector plasmids expressing the hFIX gene from a liver-specific promoter or the elongation factor 1{alpha} promoter, lacZ from a cytomegalovirus (CMV) promoter, or the luciferase gene from a simian virus 40 promoter, have all been described previously (18, 19, 28, 52). The generation of two self-complementary vector plasmids expressing either the gfp gene from a CMV promoter or the human alpha-1 antitrypsin (hAAT) gene from a Rous sarcoma virus promoter will be described in detail elsewhere (D. Grimm, L. Wang, J. S. Lee, T. A. Storm, and M. A. Kay, unpublished data). For the cloning of helper plasmids expressing shuffled cap genes, the entire AAV-8 cap gene was removed from the AAV-8 helper construct by cutting with SwaI and PmeI (both create blunt ends; SwaI cuts 9 nt upstream of the VP1 gene start codon, and PmeI cuts 53 nt downstream of the polyadenylation signal). The novel cap genes were amplified from the respective TOPO constructs (see above) via PCR using the forward primer 5' AAAT CAGGT N25 3' (the underlined nucleotide sequence restored the SwaI site to maintain correct reading frames, and N25 denotes the first 25 nt of each cap gene, ATGGCTGCCGATGGTTATCTTCCAG for AAV-DJ, AAV-2, AAV-8, and AAV-9). The reverse primer was 5' AAAC GAATTCGCCCTTCGCAGAGACCAAAGTTCAACTGAAACGAATCAACCGG TTTATT GATTAACAGGCAA N23 3' (the nucleotides restoring the PmeI site are underlined, the polyadenylation signal is shown in bold, and N23 denotes the last [3'] 23 nt of the shuffled capsid genes, TTACAGATTACGGGTGAGGTAAC for AAV-DJ [3'-to-5' orientation]). PCRs were performed using DeepVent DNA polymerase (NEB), creating blunt ends allowing straightforward insertion into the linearized AAV-8 helper plasmid. Insert junctions and correct orientation were confirmed via DNA sequencing (Biotech Core). Vector production and particle titration (by dot blotting) were performed as described previously (53); yields for all vectors including AAV-DJ and the HBD mutants typically exceeded 6 x 1013 total physical particles per 50 T225 flasks (2 x 109 cells). HBD mutant plasmids (see Fig. 6A) were generated by A585X and B588Y site-directed mutagenesis using a QuikChange II kit (Stratagene), with A and B representing the native residues and X and Y representing the new residues. The gain or loss of heparin binding ability was confirmed via a standard heparin binding assay using type I heparin agarose (Sigma) (data not shown). Due to an unknown deficiency, the AAV-9/AAV-2 chimeric mutant (AAV-9/2) could not be produced in sufficient amounts for in vivo evaluation.


Figure 6
View larger version (54K):
[in this window]
[in a new window]

 
FIG. 6. In vitro analyses of AAV-DJ and HBD mutants. (A) Two arginine residues (numbers refer to positions in AAV-2) in AAV-2, AAV-8, AAV-9, or AAV-DJ were mutagenized to eliminate or introduce an HBD (37). (B) Western blots (using B1 antibody) confirming correct VP protein expression from all HBD mutants. AAV-8 and AAV-DJ (wild types and mutants) expressed proteins more strongly than AAV-2 or AAV-9, for reasons unknown. +, with; –, without. (C) Titration of infectious particles on 293 cells confirmed the role of the HBD in infection in culture. The mutation of the HBD in AAV-2 or AAV-DJ reduced infectivity, measured the ratio of total to infectious AAV particles, by 2 to 3 logs. However, including an HBD in AAV-8 and AAV-9 did not further increase the infectivity of these vectors. (D) Results from cell binding assays confirming the role of the HBD in attachment to cultured cells (HeLa or Huh-7). The drop in binding with the AAV-2 and AAV-DJ mutants correlated well with the transduction data presented in panel C. Surprisingly, the HBD-positive AAV-8 and AAV-9 mutants bound severalfold more efficiently than AAV-2 on HeLa cells and, in all cases, far better than wild types 8 and 9 but transduced much less efficiently. Cell attachment and transduction thus do not necessarily correlate, suggesting that additional intracellular factors and steps contributed to the superior transduction efficiency of AAV-DJ. (E) AAV particle digestion with the endosomal proteinase cathepsin B (cath. B) (2) yielded distinct patterns for the individual serotypes in a Western blot analysis using polyclonal anti-AAV-2 VP serum. AAV-DJ showed a hybrid pattern with bands from AAV-2 and AAV-8 (white and black arrows, respectively), further supporting the idea that its properties resulted from synergistic or additive effects from its parents (cell binding from AAV-2 and rapid uncoating from AAV-8).

 
Helper plasmids for peptide display. Prior to the generation of AAV peptide display libraries, we mutated the AAV-DJ helper plasmid to permit the insertion of oligonucleotides encoding seven amino acids after residue R588. In parallel, we created (using the cloning strategy for cap described above) and also mutated an AAV-2 helper. We basically adapted a multistep mutagenesis strategy first described for AAV-2 by Müller and colleagues (50), with the exception that we additionally mutated R585 into a glutamine (as in AAV-8). Accordingly, our mutagenesis primers were identical to those described above, except for the final (third) primer pair, which was 5' CAACCTCCAGCAAGGCCAGAGAGGCCAAGGCCCAGGCGGCCACCGCAG 3' (nucleotides changing R585 to Q585 are underlined and shown in bold) and 5' CTGCGGTGGCCGCCTGGGCCTTGGCCTCTCTGGCCTTGCTGGAGGTTG 3'. The resulting AAV-2/AAV-DJ helper plasmids carried two unique SfiI sites permitting the straightforward insertion of 21-mer oligonucleotides encoding specific peptides. Notably, another SfiI site normally present in the AAV-2 rep gene was absent in the helper plasmid backbone used here (it had to be mutated in the original cloning strategy [50]; see also below). The oligonucleotides corresponding to the two lead peptides in this study were as follows: for the peptide NSSRDLG, 5' AGGCAACTCAAGCCGAGACCTAGGAGCCCAGG 3' and 5' GGGCTCCTAGGTCTCGGCTTGAGTTGCCTCTC 3', and for MVNNFEW, 5' AGGCATGGTCAACAATTTTGAGTGGGCCCAGG 3' and 5' GGGCCCACTCAAAATTGTTGACCATGCCTCTC 3' (nucleotides encoding the respective seven amino acids are underlined and shown in bold). Each oligonucleotide pair was annealed and then ligated into the SfiI-cut AAV-DJ helper plasmid. The presence of the correct inserts was confirmed upon sequencing with the HBD primer 5' GTCATGATTACAGACGAAGAGGAAATC 3' (binding upstream of the HBD-encoding sequences in the AAV-2 and AAV-DJ cap genes).

Creation of viral peptide display libraries based on AAV-2 and AAV-DJ. The actual libraries of infectious AAV plasmids carrying random 21-mer oligonucleotides were again created in a multistep approach, similar to the generation of our shuffled library. First, we destroyed the SfiI site in wild-type AAV-2 rep in the context of the p{Delta}TR18 plasmid (carrying AAV-2 rep and cap) (27). Primers used were 5' GTGAGTAAGGCACCGGAGGCCC 3' and 5' GGGCCTCCGGTGCCTTACTCAC 3' (the nucleotide change disrupting the SfiI site is underlined and shown in bold). The mutated rep gene was then PCR amplified using the same BglII site-containing forward primer described above and, as the reverse primer, 5' GGTAGC AGATCT GTTTAAAC CATTTATTGTTCAAAGATGCAGTC 3' (the BglII site is in bold, the PmeI site is underlined and shown in bold italics, and the AAV-2 rep stop codon is underlined and shown in italics). This fragment was inserted into BglII-cut pTRUF3 to become flanked by AAV-2 ITRs. The resulting construct was linearized by cutting with HindIII and PmeI, and the mutated AAV-2 and AAV-DJ cap genes (containing two adjacent SfiI sites but lacking any insert) were inserted as HindIII/PmeI fragments. In a final step, we then cloned a library of 21-mer oligonucleotides encoding random peptides into the two plasmids. The 21-mers were flanked by sequences comprising BglI sites, so that after cleavage they would be compatible with the SfiI-cut AAV rep-cap plasmids. The full sequence of the forward primer was 5' CAGTCGGCCAGAGAGGC (NNB)7 GCCCAGGCGGCTGACGAG 3' (BglI sites are underlined and shown in bold), with B representing the nucleotide T, C, or G (see Results). To create a double-stranded oligonucleotide for actual BglI cleavage and cloning, primer 5' CTCGTCAGCCGCCTGG 3' was used in a second-strand synthesis reaction as described previously (50). The presence of random 21-mer inserts or of 21-mer inserts selected after biopanning (see below) in individual clones was confirmed using the HBD sequencing primer.

AAV protein analyses. Western blot and immunofluorescence analyses were carried out as reported previously (29) by using the monoclonal B1 antibody (useful because its 8-amino-acid epitope [see Fig. 2D and Fig. S4 in the supplemental material] is largely conserved across known AAV serotypes) for the detection of immobilized AAV capsid proteins. For immunofluorescence studies, polyclonal antisera were diluted 1:200 in 1x phosphate-buffered saline (PBS) while monoclonal antibodies (B1, A20, and 303.9) were used undiluted. Atomic structure models were created using DeepView Swiss-PdbViewer software version 3.7 (www.expasy.org/spdbv) and VIPER (viperdb.scripps.edu/oligomer_multi.php).


Figure 2
View larger version (75K):
[in this window]
[in a new window]

 
FIG. 2. Molecular evolution of AAV vectors via DNA family shuffling. (A) The AAV capsid library was serially amplified on primary or transformed human liver cells. Purified human Igs (IVIG) were added to increase the selection pressure and to force vector evolution. Each scheme yielded a distinct pool of viral capsids (pools A to C). The alignment of ≥96 clones per pool with the sequences of the eight parental viruses confirmed the enrichment with specific sequences in association with increasing selection pressure. 5x, five times. (B) First 217 amino acids of the VP1 capsid protein for each pool. Colors represent the relationships to the parental strains (serotypes 2, 4, 5, 8, and 9), as also shown and detailed in Fig. S3 in the supplemental material. Arrowheads represent point mutations. Start codons for all three capsid proteins are shown. Pool C contained a single clone, designated AAV-DJ. (C) Putative atomic structure for each pool (the previously reported AAV-2 structure [Protein Data Bank file 1LP3 {http://www.rcsb.org}] was used as the basis for modeling; this structure lacks the residues represented in panel B). Thin green lines indicate sequence homology among the AAV-2, AAV-8, and AAV-9 parents. Residues shown as colored balls were derived from a subset of parental strains (see panel B for color codes; note that beige symbolizes AAV-5 in pool A here). AAV capsid symmetry axes (pool A) and four of the five loops (pool B) are shown. The location of two arginines as part of the conserved HBD (37) at the tip of loop IV is shown for AAV-DJ (pool C). (D) Capsid protein sequence of AAV-DJ. The three parental viruses are shown as thin lines above the sequence (AAV-2, red; AAV-8, blue; AAV-9, orange). Locations of the capsid loops, VP start codons, and the first residue of the atomic structure are indicated. A20 and B1 epitopes are boxed in blue and red, respectively (two mutations in the A20 epitope are shown by blue asterisks). Two recently identified immunogenic AAV-2 peptides (47) are boxed in yellow (AAV-DJ carries three point mutations, indicated by asterisks). Residues in green boxes form the conserved AAV-2 HBD (asterisks denote two arginines mutagenized in this study). Red asterisks denote residues previously discovered using other methods and believed to determine AAV-2 immunogenicity (see the text).

 
In vitro transduction, binding, and cleavage assays. All transformed cell lines were maintained in Dulbecco's modified Eagle's medium (Gibco) containing 10% fetal calf serum, 2 mM L-glutamine, and 50 IU each of penicillin and streptomycin/ml at 37°C in 5% CO2. Fresh primary human hepatocytes (in 6-well plates without Matrigel) were obtained from Admet (Durham, NC) and maintained in hepatocyte basal medium (Cambrex, Walkersville, MD) with recommended supplements. The titration of gfp-expressing recombinant AAV particles was performed in 96-well plates (27), following the normalization of each virus stock to 2 x 109 particles/ml. For in vitro neutralization studies, 50-µl aliquots of each vector preparation were incubated with serial 10-fold dilutions of IVIG or mouse sera (following a 1-h heat inactivation step at 56°C) for 1 h at 37°C prior to titration on cells. Titers of neutralizing antibodies were calculated as reported previously (29). Details of the cell binding and cathepsin B digestion were reported recently (2).

In vivo biopanning. Wild-type FVB mice (6 to 8 weeks old; Jackson Laboratory, Bar Harbor, ME) were inoculated with the shuffled or peptide-displaying libraries at the doses indicated below. The mice also received different volumes (see Results) of wild-type adenovirus stocks purchased from the American Type Culture Collection (ATCC; Manassas, VA): human adenovirus C deposited as adenovirus 5 (catalog number VR-5) and mouse adenovirus (catalog number VR-550). Total inoculum volumes were 300 µl of 1x PBS for liver panning (injected via the tail vein) and 50 µl of 1x PBS for lung panning. For the latter, the mice were briefly anesthesized using an isoflurane vaporizer and placed on their backs. The virus suspension was then carefully pipetted directly onto both nostrils, resulting in the rapid aspiration of the suspension within a few seconds. Typically, 7 days postinfection, the mice were sacrificed and the organs were harvested, minced, and frozen in aliquots in liquid nitrogen. Total genomic DNA was prepared (as reported in reference 27) from one aliquot for subsequent PCR amplification of AAV DNA by using Platinum Pfx polymerase (Invitrogen) and specific primers flanking the entire capsid gene. For the shuffled cap genes, the primers were identical to those used before for in vitro biopanning. For the peptide-encoding cap genes, we used the same forward primer but a serotype-specific reverse primer: for AAV-2, 5' TTACAGATTACGAGTCAGGTATC 3', and for AAV-DJ, 5' TTACAGATTACGGGTGAGGTAAC 3'. As before, the cap genes were then cloned using the Zero Blunt TOPO PCR cloning kit and sequenced using either T3 and T7 primers for the shuffled genes or the HBD sequencing primer for the peptide-expressing clones. Another aliquot was freeze-thawed three times in liquid nitrogen in 200 µl of 1x PBS and additionally homogenized to release intact AAV particles. Tissue debris was spun down (16,000 x g for 5 min), and the supernatant was heat inactivated (30 min at 65°C to kill amplified adenovirus) and then used for reinoculation into new mice (for liver tissue, up to 100 µl, and for lung tissue, 25 µl), together with freshly added helper adenovirus. In some cases (see below), the supernatant (50 µl) was depleted of murine immunoglobulin G (IgG) prior to reinfection by using a commercial kit (ProteoPrep immunoaffinity albumin and IgG depletion kit) according to the instructions provided by the manufacturer (Sigma, St. Louis, MO).

Expression studies with mice. Wild-type female C57BL/6 mice (6 to 8 weeks old) were purchased from the Jackson Laboratory (Bar Harbor, ME). Recombinant AAVs expressing the hFIX or hAAT genes in 300 µl of 1x PBS were administered via tail vein infusion. Blood was collected at the indicated time points via retro-orbital bleeding, and plasma hFIX or hAAT levels were determined via an enzyme-linked immunosorbent assay as described previously (28, 52). Recombinant AAVs expressing the firefly luciferase gene in 300 µl of 1x PBS were infused via the tail vein for liver transduction or administered nasally in 50 µl of 1x PBS for lung transduction. Luciferase experiments were conducted with wild-type female FVB/NJ mice (6 to 8 weeks old) from the Jackson Laboratory (Bar Harbor, ME), and expression in live animals was monitored as described previously (28). Recombinant AAV-DJ variants expressing the lacZ gene were also given nasally. Two weeks later, animals were euthanized, the tracheas were cannulated, and lungs were inflated with 2% low-melting-point agarose and then sectioned with a Vibratome sectioning system into 100-µm slices, which were fixed overnight at 4°C in 4% paraformaldehyde. For β-galactosidase detection, lung slices were washed three times for 5 min each time in a solution of 1x PBS, 2 mM MgCl2, 0.02% NP-40, and 0.01% sodium deoxycholate and then incubated overnight at room temperature in the dark in a solution containing the β-galactosidase substrate X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside). Lungs were postfixed in 4% paraformaldehyde and stored at 4°C in 1x PBS. All procedures were approved by the Animal Care Committee at Stanford University. Genomic DNA was extracted from mouse tissues and analyzed via Southern blotting using hFIX gene-specific probes as reported previously (53).

Immunologic in vivo assays. For passive immunization studies, mice were injected intravenously (via the tail vein) with 40 µl (low dose) or 200 µl (high dose) of IVIG (100 mg/ml) diluted in 1x PBS in a total volume of 300 µl and, 24 h later, infused (via the tail vein) with 2 x 1011 recombinant hFIX gene-expressing AAV particles. For cross-neutralization studies, mice were immunized against individual AAV serotypes by the peripheral infusion of 1011 recombinant hAAT gene-expressing particles. Three weeks later, mouse sera were collected for in vitro neutralization assays before the mice were reinfused with 1011 (or 5 x 1011 for AAV-2) (see below) recombinant hFIX gene-expressing AAV particles. In an experiment for which the data are not shown, the two AAV injections were carried out in the reverse order (first hFIX-expressing particles and then hAAT-expressing particles); the conclusions substantiated those presented below (see Fig. 9C).


Figure 9
View larger version (35K):
[in this window]
[in a new window]

 
FIG. 9. In vivo and in vitro neutralization of AAV-DJ and wild-type AAVs. (A) Mice (n = 4 per group) passively immunized with IVIG (4 or 20 mg) were injected with hFIX-expressing AAV. Plasma hFIX levels per virus and time point are shown as percentages of corresponding levels in control mice (those receiving PBS instead of IVIG). (B) Mice (n = 4 per group) immunized with the higher IVIG dose were also injected with the AAV-DJ HBD mutants. AAV-2, AAV-9, and AAV-DJ were included as controls. hFIX expression from the HBD mutants was marginal, comparable to that from AAV-2. (C) Mice (n = 4 per group) were injected with PBS or 1011 particles of hAAT-expressing AAV-2, AAV-8, AAV-9, or AAV-DJ (x axis), and 3 weeks later, they were reinjected with 1011 particles of hFIX-expressing viruses (5 x 1011 for the least efficient AAV-2, due to the enzyme-linked immunosorbent assay detection limit of ~10 ng/ml). Shown are stable hFIX levels for each group as measured 6 weeks after the second injection. (D) Sera were taken from the mice described in the legend to panel C at the time of reinjection (bars H [higher dose]), as well as from a parallel group injected with a lower dose (bars L) of 2 x 1010 particles. Titers of neutralizing antibodies (NAb) against the wild-type AAVs or AAV-DJ were determined as detailed in Materials and Methods. pi, postinjection.

 

    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Generation of an AAV capsid library via DNA family shuffling. A chimeric AAV capsid library was generated from eight parental wild-type viruses of human, primate, or nonprimate origin (Fig. 1A). In line with our primary goal, to evolve novel AAV capsids on liver cells in vitro, they were chosen based on performance in culture (AAV-2) or in liver tissue (AAV-8 and AAV-9), their substantial sequence divergence from AAV-2 (AAV-4, AAV-5, and avian, bovine, and caprine AAVs), or their low prevalence in the human population (all but AAV-2 and AAV-5). The conditions for AAV DNA family shuffling were established in small-scale studies (schematically depicted in Fig. 1B and C) in order to optimize parameters, including the choice of DNA polymerases for the PCRs and the lengths of the subgenomic capsid fragments (see Materials and Methods for details). The best conditions were then upscaled to yield a hybrid capsid-encoding plasmid library with a complexity of ~7 x 105 distinct sequences. Packaging via the cotransfection of 293 cells with an adenoviral helper plasmid resulted in the final viral library, with a particle titer of ~8.2 x 1011 genomes/ml (total volume, 4 ml from ~109 cells, i.e., ~3,300 particles per cell).

The isolation and sequencing of 48 randomly chosen clones confirmed extensive genetic diversity and validated the presence of all eight parental viruses in the final pool (see Fig. S1 and S2 in the supplemental material). Importantly, there was no apparent bias toward particular serotypes or combinations thereof in our library, nor did we obtain evidence for preferred hot spots for recombination. Instead, all eight parents were found in a random pattern, which is the ideal result. We were especially pleased to find recombinants with elements from very diverse serotypes, such as AAV-4 and AAV-5 (see data for clone S8 in Fig. S1 in the supplemental material), as it confirmed the potential of DNA family shuffling to create hybrids from parents differing by as much as ~50%. As a result, the capsids in our library reflected and recapitulated the diversity of natural AAVs, exemplified by the fact that the levels of clonal homology to the AAV-2 prototype ranged anywhere from 46 to 93% (see Fig. S1 and S2 in the supplemental material). This wide sequence diversity positively distinguishes our methodology from previous AAV libraries, in which all resulting particles remained over 99% identical to the single parental virus, usually AAV-2 (46, 50, 58, 59, 76) (see also Discussion). Last but not least, we observed several point mutations in individual clones but found no evidence for lethal mutations or frameshifts. This outcome was in line with our expectations, as a hallmark of DNA family shuffling is the in-frame recombination of related functional sequences. This result further distinguishes our methodology from prior AAV evolution approaches, particularly those based on error-prone PCR, in which the offspring were frequently not viable (46, 59).

Stringent selection of AAV variants on human liver cells. To screen for capsids with enhanced efficiency in liver cells, we serially (five times) amplified our library on human primary hepatocytes (Fig. 2A, pool A) or hepatoma cells (Huh-7 and HepG2) (Fig. 2A, pools B and C) as detailed in Materials and Methods. The extraction and sequencing of viral DNA from up to 192 clones per cell type (384 clones total) yielded 369 full-length capsid genes, whose compositions are shown in Fig. 2B and C. Strikingly, all clones showed predominant homology to five of the eight starting viruses, serotypes 2, 4, 5, 8, and 9, and had retained an HBD from the AAV-2 parent. Notably, this domain, whose function is binding to the primary AAV-2 receptor heparan sulfate proteoglycan (72), was clearly underrepresented in the unselected library, where it was found in only 3 of 48 clones (~6%) (see, e.g., data for clone S8 in Fig. S2 in the supplemental material), in line with the random presence of AAV-2 sequences. The enrichment with and conservation of the HBD during selection on cultured cells suggested its crucial role for in vitro transduction. Indeed, vectors made from 10 individual capsids gave infectious titers similar to those of wild-type AAV-2 and exceeding those of HBD-deficient serotypes 8 and 9 (data not shown).

Despite the similarity of pools A (primary cells) and B (cell lines), we recovered only a single capsid sequence twice (Fig. 3, lane A), while all other 367 clones differed from each other by at least three amino acids (defined as our redundancy cutoff). In a direct comparison of the two pools, we noted the increased accumulation of serotype-specific residues, together with a reduction of random point mutations, in the capsids from the hepatocyte cell lines (Fig. 2B and C). This finding likely reflected the fact that HepG2 and Huh-7 cell lines are substantially more homogenous than primary human hepatocytes, which often vary among batches and donors. Nonetheless, the clonal heterogeneity even in the more evolved pool B prevented the reasonable selection and study of single sequences. To further force the evolution of individual capsids, we thus applied additional strong negative selection pressure to our library via incubation with pooled human antisera (IVIG) prior to reamplification (see Fig. S3 in the supplemental material). The high-level neutralizing activity of our particular IVIG batch (GamimuneN [10%]; Bayer) against multiple serotypes, especially AAV-2, implied its potential to eliminate capsids displaying prevalent epitopes from the library. Any surviving capsids were deemed to be useful in humans, with regard to the high frequency of neutralizing anti-AAV-2 antibodies in the population (63).


Figure 3
View larger version (51K):
[in this window]
[in a new window]

 
FIG. 3. In vitro analysis of selected shuffled capsids. Following five consecutive amplifications of the AAV library on primary human hepatocytes, viral DNA was extracted from 10 randomly chosen clones (with the exception of the clone corresponding to lanes A, which was recovered twice from pool A), and the cap genes were subcloned into an AAV helper plasmid. (A) Western blot (using B1 antibody) showing differences in the expression levels and sizes of the individual VP proteins compared to those of wild-type AAVs (wtAAV). (B) Results from titration of infectious gfp-expressing particles. The helper plasmids described above were used to package a gfp-expressing AAV vector plasmid, and titers of recombinant particles in crude cell extracts were determined (n = 3) as detailed in Materials and Methods. All shuffled clones gave higher titers than the AAV-8 or AAV-9 helpers. No linear correlation between VP protein expression levels (A) and titers (B) could be made, suggesting that the various chimeras differed in their packaging efficacy, infectivity, and/or other parameters.

 
The sequencing of 96 clones after five passages under IVIG pressure revealed successful enrichment with a single chimera. This clone, termed AAV-DJ, displayed predominant sequence homology to serotypes 2, 8, and 9 (Fig. 2B and D) at levels (85 to 92%) similar to those of the homology of these wild types to one another (Table 1). Notably, AAV-DJ was distinguished from its closest natural relative, AAV-2, by a total of 60 amino acids (>8% of the VP1 capsid protein). It was thus substantially more divergent than, and compared highly favorably to, the bulk of previously evolved capsids, which typically differed from their single parent by only up to seven residues (depending on the library type, but in all cases corresponding to <1% of the capsid protein). AAV-DJ also showed ~60% identity to the other five parental viruses, explained by the fact that all eight wild-type AAVs used in our study were at least ~50% homologous to one another (Table 1). As a result, many individual residues in the AAV-DJ sequence could not be assigned to a particular parent.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Sequence homology of AAV-DJ and wild-type AAV capsid proteinsa

 
Clearly, AAV-DJ was more evolved than the clones obtained in the absence of IVIG, as was already evident from the data in Fig. 2B and C and as was further confirmed by sequence homology comparisons to pool A (from primary human hepatocytes). Indeed, the 10 clones in pool A displayed higher relative similarities to AAV-2, while AAV-DJ was more homologous to AAV-8 (Table 2). This finding validated our initial assumption that IVIG pressure would lead to an elimination of AAV-2 epitopes from our library. Concurrently, AAV-DJ was only ~88 to 90% homologous to pool A, which further highlights its divergence from capsids evolved under less stringent conditions (the use of heterogeneous primary cells and the lack of IVIG pressure for pool A).


View this table:
[in this window]
[in a new window]

 
TABLE 2. Homology of pool A and C and wild-type AAV capsid genes and proteinsa

 
Molecular evolution affects mostly exposed capsid regions. AAV capsids are complex three-dimensional protein structures, suggesting that the majority of amino acid changes resulting from our evolution process would occur on the exterior of the virion, at positions accessible to the selection pressure. Indeed, the bulk of the 60 non-AAV-2 residues in AAV-DJ were located in the loops extruding from the particle, especially in the major loop IV (Fig. 2C and D and also see Fig. S4 in the supplemental material). Consequently, the overall identity of AAV-DJ to its eight parents dropped from ~31% (for the total VP1 protein) to only ~18% in this exposed capsid region. Importantly, the AAV capsid loops contain most of the residues critical for natural receptor binding or for antibody recognition or escape. This arrangement explains the observed lack of AAV-DJ detection by the AAV-2-specific A20 antibody, as the conformational epitope of the A20 antibody (80) was dispersed over three of the five capsid loops and disrupted by two point mutations in AAV-DJ (Fig. 4). In contrast, the highly conserved residues constituting the capsid core remained mostly unchanged in AAV-DJ, as their inaccessible location on the inside of the assembled particle protected them from synthetic (or natural) AAV evolution. This arrangement also explains why all eight parental AAVs in our study (and perhaps all naturally occurring AAVs) showed ~31% overall identity and at least 50% homology in pairwise comparisons (see Fig. S4 in the supplemental material and Table 1).


Figure 4
View larger version (34K):
[in this window]
[in a new window]

 
FIG. 4. Presentation of epitopes on the AAV-DJ capsid. Shown at the top are the putative AAV-2 epitope for the monoclonal antibody A20 (a conformational epitope comprising three distinct peptides [see also Fig. 2D]) and the corresponding sequences in AAV-DJ, AAV-8, and AAV-9 (amino acid changes compared to the sequence of AAV-2 are highlighted in red [AAV-DJ] or orange [AAV-8 and AAV-9]). The bottom panels show results from immunofluorescence studies of cells cotransfected with the various helper constructs and an adenoviral helper plasmid (to boost gene expression from the AAV plasmids). The two amino acid changes in AAV-DJ were already sufficient to abolish the binding of the A20 antibody, validating and narrowing down the A20 epitope (80) and thus exemplifying the potential of DNA family shuffling as a reverse-genetics tool. AAV-DJ cross-reacted with both the polyclonal anti-AAV-2 and anti-AAV-8 sera, as expected from its chimeric structure. Similar cross-reactivity with these sera was also observed for wild types 2, 8, and 9. The fact that AAV-DJ, AAV-8, and AAV-9 were detected by the B1 antibody (initially raised against AAV-2 capsid proteins) was not surprising considering the high degree of conservation of its epitope in natural AAVs (see Fig. S4 in the supplemental material). All mono- and polyclonal anti-AAV antibodies were described previously (78, 79), except for the polyclonal rabbit anti-AAV-8 antiserum. 303.9, anti-Rep; B1, anti-VP; {alpha}AAV-2, anti-AAV-2 VP serum; A20, anti-AAV-2 capsids; {alpha}AAV-8, anti-AAV-8 VP serum.

 
The critical roles of the residues in the capsid loops were further apparent upon alignments of AAV-DJ sequences with those of the 10 clones from pool A (Fig. 5). As mentioned above (Table 2), most clones from pool A had preserved AAV-2 sequences, while AAV-DJ was more related to serotypes 8 and 9 than the pool A clones were. In analogy to the results of the previous wild-type comparison, we noted that the greatest sequence diversity occurred in the exposed regions, with many of the changes clustered within loops I, IV, and V. Intriguingly, our alignments confirmed 6 of the 12 previously reported hypervariable regions (HVRs) in the AAV capsid gene (11, 16) but, moreover, identified several further hot spots of sequence diversity (Fig. 5 and also see Fig. S4 in the supplemental material). Most of them were located in the N termini of VP1 and VP2, while others were dispersed among the areas corresponding to HVRs 2 to 5. Our observation of multiple differences between the N termini of AAV-DJ and pool A was not surprising, as the N-terminal region is temporarily exposed during the AAV life cycle (7, 40, 68) and thus potentially subject to evolution pressure.


Figure 5
View larger version (36K):
[in this window]
[in a new window]

 
FIG. 5. Protein sequence alignments for AAV-DJ and 10 clones from pool A. Shown are full protein alignments for the 10 clones described in the legend to Fig. 3. (The clones correspond to lanes A to J in Fig. 3 and are listed in order; e.g., clone A4 corresponds to lanes A, and clone A11 corresponds to lanes B, etc.). AAV-DJ served as the standard to highlight the different degrees of evolution between pools A and C (in which clones were selected with [pool C] or without [pool A] IVIG [Fig. 2A]). The clone A4 sequence is shown as a full sequence, as clone A4 was recovered twice from pool A. Residues identical in A4 and AAV-DJ are colored in red, while changes are shown in yellow. Only amino acids divergent from AAV-DJ are shown for the other nine clones (for the origin of these residues, see the wild-type sequences in Fig. S4 in the supplemental material and also see the text). The horizontal bars indicate the capsid loops (see Fig. S4 in the supplemental material). Note that many changes in the 10 clones from pool A were clustered in these loops, as could be expected. Moreover, the gene regions corresponding to six of these cluster regions were identical to 6 of the 12 previously reported HVRs (HVRs 1, 3, 4, 5, 11, and 12 among the previously described HVRs 1 to 12, identified by green boxes) in the AAV capsid gene. Intriguingly, our alignments also identified several further regions of sequence diversity not described before, especially in the VP1 and VP2 N termini. The dotted orange lines mark a highly conserved phospholipase 2A domain in the VP1 N terminus; note the unique amino acid change (D97H) in clone C8 (yet the capsid was infectious [see Fig. 3]). The three purple boxes show the A20 epitope; note that almost all clones had fully maintained the respective consensus sequence from AAV-2 (H in the first and V in the second part of the epitope) but that AAV-DJ had not (compare Fig. 4). The blue box shows the location of two of the five residues (two arginines) which constitute the HBD; they were fully conserved in all clones.

 
Notably, the phospholipase 2A domain in the VP1 N terminus, critical for particle infectivity (7, 86), remained highly conserved, with the single exception of clone C8 from pool A. In striking contrast to the N termini of the rest of the capsids, the AAV-DJ capsid N terminus was almost entirely derived from AAV-2, while the clones in pool A carried multiple dispersed residues from AAV-8 or AAV-9. These amino acids, especially the new clusters identified by our alignments, and their roles in the infection cycle should be very interesting targets for future AAV studies. These findings and considerations highlight the vast potential of DNA family shuffling, not only as a means to evolve viral vectors, but also as a functional genomics tool, useful to unravel basic virus biology.

In summary, we have cloned, sequenced (fully or partially), and compared a total of 513 candidates from our library before and after various selection schemes. Of the 465 clones from pools A to C, one was recovered twice (from pool A), while the 96 clones from pool C were completely identical (AAV-DJ). All other clones differed from one another by at least three amino acids and were not identified among the 48 clones from the unselected library. Likewise, AAV-DJ was found neither in pools A and B nor in the original library, confirming its specific evolution under stringent IVIG selection.

Recombinant AAV-DJ vectors mediate superior in vitro transduction. We next generated gfp-expressing vectors from the AAV-DJ capsid gene and compared their in vitro infectivities to those of the eight most commonly used wild-type AAVs (serotypes 1 through 6, 8, and 9), including five of the AAV-DJ parents (serotypes 2, 4, 5, 8, and 9). Impressively, titration on 14 cell types from different species and tissues, including primary human hepatocytes, melanoma cells, and embryonic stem cells, showed that AAV-DJ vectors were not only superior to all HBD-negative wild-type viruses (up to 100,000-fold better than AAV-8 or AAV-9), but also substantially better than AAV-2 (Table 3 and data not shown). Ratios of total to infectious particles were frequently far below 500, highlighting the extreme efficiency of AAV-DJ in vitro and suggesting its particular usefulness for ex vivo gene transfer applications. The only exceptions on which AAV-DJ was not most efficient were human monocytes and dendritic cells (Table 3). On these cells, AAV-1 and AAV-6 outperformed the other vectors, albeit AAV-DJ was among the most efficient capsids. Our data for AAV-1 confirm and extend the findings of a recent study in which this serotype also surpassed AAV-2 to AAV-5 on murine hematopoietic stem cells (87). As expected, AAV-DJ transduction was largely unaffected by IVIG (similar to AAV-8 and AAV-9 transduction) (data not shown).


View this table:
[in this window]
[in a new window]

 
TABLE 3. In vitro infectivities of AAV-DJ and wild-type vectorsa

 
To investigate the role of the AAV-DJ HBD, we mutated two crucial arginines (37, 56) into the respective residues in AAV-8 or AAV-9 (Fig. 6A and B). Green fluorescent protein expression from the resulting mutants was reduced by several orders of magnitude and was as low as that from serotypes 8 and 9 (Fig. 6C and Table 3) (results for mutants DJ/8 and DJ/9 were identical). The drop in infectivity correlated well with reduced binding to cells (Fig. 6D). However, cell attachment alone cannot explain the unusual infectivity of AAV-DJ, as AAV-2 actually bound 10-fold more efficiently. We rather assume a synergistic or additive effect from sharing beneficial properties from all AAV-DJ parents, resulting in the enhancement of multiple steps in AAV-DJ transduction. One likely outcome was the combination of efficient primary receptor binding (from AAV-2, compared to AAV-8 and AAV-9) with rapid virus processing and uncoating (from AAV-8) (73) (Fig. 6E). A further explanation may be that the juxtaposition of subunits from different parents created a unique property, such as the use of an unidentified coreceptor for faster capsid internalization (see also Discussion and Fig. 12 below). An important role in infectivity was likely also played by the unique AAV-DJ N terminus, which differed from those of all other recovered clones (see above).


Figure 12
View larger version (43K):
[in this window]
[in a new window]

 
FIG. 12. Model of an AAV VP3 trimer (panel A, top view down the threefold symmetry axis; panel B, side view) created using Swiss-PdbViewer (www.expasy.org/spdbv/text/getpc.htm) and the VIPER oligomer generator (viperdb.scripps.edu/oligomer_multi.php), with the following parameters: T=1 capsid structure; selected matrices A5, A6, and A17; and Protein Data Bank file no. 1LP3 (Fig. 2C) for the AAV-2 sequence. Sequence motifs that may contribute to AAV receptor binding are colored as follows (serotypes with the highest degree of conservation are shown in parentheses): purple, HPD; red, motif with similarity to the NSSRDLG peptide (in AAV-DJ and AAV-2, 534-NGRDSL-539; numbers refer to the AAV-DJ sequence) (compare Fig. 2D); blue, motif with similarity to the NDVRAVS peptide (in AAV-DJ and AAV-2, 505-RVS[KT]SADNNNS-516); and yellow, another motif with (partial) similarity to the NSSRDLG peptide (in AAV-DJ and AAV-9, 277-SGGSSNDN-284). Note how all four motifs are exposed on the capsid surface (B) and how pairs of motifs are located in close proximity to each other (yellow and red motifs or blue and purple motifs), as well as near the HBD (purple), suggesting that they may act cooperatively in receptor binding. Intriguingly, AAV-DJ has the only capsid combining all four motifs in one sequence, perhaps contributing to its high level of efficacy (see the text).

 
AAV-DJ yields robust hFIX expression in mouse liver tissue. Based on the high level of efficacy of the AAV-DJ capsid in vitro, we became interested in evaluating vectors based on this novel chimera in mouse liver tissue in vivo. For this purpose, we produced recombinant AAV-DJ particles expressing the hFIX gene from a robust liver-specific promoter (53). Controls were wild-type capsids of serotypes 2, 8, and 9 and mutants DJ/8, DJ/9, and 2/8 (HBD negative) and 8/2 (HBD positive) (see above and Fig. 6A and D). Immunocompetent C57BL/6 mice were infused via the tail vein with particle doses of each virus ranging over four orders of magnitude (5 x 109 to 1 x 1012 particles), and plasma hFIX levels were monitored for up to 4 months.

We observed dose-dependent expression from the AAV-DJ capsid at levels equivalent to those from AAV-8 and AAV-9, the best two naturally identified AAVs for liver tissue reported thus far (18, 19, 52) (Fig. 7A and data not shown for the 5 x 109 dose). All three viruses readily outperformed the AAV-2 prototype at any dose and expressed over 100% of normal hFIX levels already after the intravenous injection of 5 x 1010 particles (AAV-2 matched these levels only at a dose of 1012 particles, i.e., a 20-fold-higher dose). Quantification and analyses of persisting vector DNA confirmed the similarity of AAV-DJ, AAV-8, and AAV-9 and their comparable degrees of superiority over AAV-2 (see Fig. S5 in the supplemental material). These results were verified in analogous experiments using two alternative expression cassettes (data not shown).


Figure 7
View larger version (49K):
[in this window]
[in a new window]

 
FIG. 7. hFIX expression from AAV-DJ in mice. (A) Dose-dependent and liver-specific hFIX expression. C57BL/6 mice (n = 3 to 8) were infused with all four hFIX-expressing vectors via peripheral tail vein injection. Gray shading indicates the range from 1 to 100% of normal hFIX levels in humans (0.05 to 5 µg/ml). Levels over 1% are considered to be therapeutic in hemophiliacs. Note that AAV-8, AAV-9, and AAV-DJ vectors exceeded the 100% level already at the lowest dose, whereas AAV-2 required a 20-fold-higher dose. (B) hFIX expression from the AAV-DJ HBD mutants (n = 3 per group). Shown are results from two representative doses; there was no significant difference from the results for AAV-DJ. (C) In contrast, the AAV-2 or AAV-8 HBD mutants expressed less hFIX than the corresponding wild types (n = 3 per group). (D) AAV-DJ showed unique transduction kinetics at a maximum dose of 7 x 1012 particles. The onset of gene expression was delayed compared to that from AAV-8 or AAV-9, yet hFIX levels became similar after ~40 days (n = 3 per group). The AAV-DJ HBD mutants showed intermediate kinetics; stable hFIX levels were eventually also similar to those from AAV-8 and AAV-9 (and AAV-DJ). pi, postinjection.

 
Curiously, the two DJ HBD mutants were indistinguishable from AAV-DJ (and serotypes 8 and 9) at these doses, while the corresponding AAV-2 mutant (2/8) was inferior to wild-type AAV-2 (Fig. 7B and C). Different expression levels for AAV-8 and the HBD-positive 8/2 mutant were also noted, albeit here, the wild type performed better (Fig. 7C). This finding suggested an essential function of heparin binding for liver gene expression from AAV-2, corroborating previous findings with this serotype (37), but a redundancy for more efficient natural or synthetic capsids (those of AAV-DJ and serotypes 8 and 9). Moreover, together with our data from the in vitro assays (see above), these results exemplified the differential effects of the HBD on AAV transduction in culture and in organisms.

The AAV HBD plays a multifaceted role in vivo. Interestingly, additional studies indicated an even more complex role for the HBD in vivo. At a maximal dose of 7 x 1012 particles, the transduction profiles of the most efficient viruses became unique. All HBD-negative variants showed faster transduction kinetics than AAV-DJ, although all viruses eventually (after ~1.5 months) gave similar expression levels (Fig. 7D). A similarly slow response at extreme particle doses with a resulting lag phase had previously been reported for AAV-2 (53, 67) and was confirmed here (data not shown). The fact that AAV-DJ and AAV-2 share the HBD suggests a common molecular mechanism involving this domain, likely at the level of post-vector entry (e.g., particle trafficking or uncoating). However, this idea warrants further investigation in view of studies reporting blunted dose responses also for AAV-1 and AAV-5, which both lack a consensus HBD (52).

A second function of the HBD became apparent upon analyses of vector DNA biodistribution (Fig. 8A and Table 4). We corroborated previous reports of unrestricted tropism of AAV-8 and AAV-9 (HBD negative) (17, 18, 34, 52, 60), which readily transduced all tested tissues at a dose of 1012 particles per mouse. In striking contrast, AAV-2 and likewise AAV-DJ (both HBD positive) were restricted to liver tissue and, to a lesser extent, heart, kidney, and spleen tissues and were near or below the detection limit in all other tissues. In fact, the quantification of double-stranded vector DNA (using liver tissue as an internal standard for each group) showed that AAV-DJ transduced lung, brain, pancreas, and gut tissue about two- to fourfold less efficiently than wild types 8 and 9 (Table 4). The effect of the HBD on viral tropism was best exemplified by comparing AAV-DJ to the DJ/8 mutant: HBD deletion alleviated the liver restriction and expanded transduction to all nonhepatic tissues, including the brain, identical to the transduction patterns of AAV-8 and AAV-9. These findings not only corroborate but also may help explain a series of reports on the wide tissue dissemination of vectors based on HBD-negative natural serotypes (AAV-1 and AAV-4 to AAV-9) in mice, dogs, and monkeys (17, 29, 37, 52, 60), in contrast to that of the HBD-positive AAV-2. Notably, AAV-DJ also transduced nonhepatic tissues at the maximum dose of 7 x 1012 particles but still to a lesser extent than the HBD-negative viruses, in particular AAV-9 (Fig. 8A and Table 4). Importantly, even at this dose, brain and also lung transduction remained marginal.


Figure 8
View larger version (78K):
[in this window]
[in a new window]

 
FIG. 8. Vector DNA biodistribution and dose response. (A) Genomic DNA extracted from nine tissue types (li, liver; lu, lung; h, heart; k, kidney; s, spleen; b, brain; p, pancreas; g, gut; and m, muscle) was analyzed for the presence of hFIX-expressing vector DNA. The results and the reference standard shown are representative of data for the two highest doses used here. The AAV-DJ transduction pattern was more restricted to liver, heart, kindey, and spleen tissues than those of AAV-8, AAV-9, and the HBD mutants. At the highest dose (7 x 1012 particles), AAV-DJ spillover into nonhepatic tissues was also less obvious than that of the other vectors. The HBD-negative AAV-2/8 mutant gave increased heart transduction compared to wild-type AAV-2, confirming previous data (37) (an unknown production deficiency prevented evaluation at the highest dose). (B) Comparison of vector DNA levels in liver following transduction with increasing particle doses (from left to right, 5 x 1010, 2 x 1011, 1 x 1012, and 7 x 1012 particles). AAV-DJ showed a blunted response at the highest dose, likely correlating with its slower onset of gene expression (Fig. 7D).

 

View this table:
[in this window]
[in a new window]

 
TABLE 4. Relative levels of transduction of nonhepatic tissues with AAV vectorsa

 
Additional side-by-side comparison of all liver vector DNA levels showed similar dose responses for the non-AAV-2 viruses at doses between 5 x 1010 and 1 x 1012 particles (Fig. 8B), in agreement with our expression data (see above). However, at 7 x 1012 particles, the HBD-negative viruses persisted at slightly higher copy numbers than AAV-DJ. The data in Fig. 7D, as well as our previous findings with AAV-8 (52), imply that this outcome resulted from faster transduction with the HBD-negative viruses than with the HBD-positive viruses. This effect in turn likely increased the steady-state levels of viral DNA. Because the levels of expression from all viruses eventually became similar (Fig. 7D), we further hypothesize that the majority of additional genomes were silenced over time. While the latter conclusion is also supported by the results of our earlier work (52), more detailed studies are needed to prove the ensuing opposite idea, that a higher proportion of vector DNA copies from AAV-DJ transduction than from transduction with HBD-negative viruses remains transcriptionally active in the liver.

AAV-DJ partly escapes humoral neutralization in mice. We next quantified liver transduction in the presence of human serum to assess AAV-DJ's ability to evade neutralization in vivo. Therefore, we passively immunized mice with IVIG prior to the infusion of hFIX-expressing AAV-2, AAV-8, AAV-9, or AAV-DJ. As predicted, AAV-2 expression was nearly completely abolished. In contrast, transduction with AAV-DJ, AAV-8, or AAV-9 was inhibited in a dose-dependent manner, with AAV-DJ showing intermediate resistance at the high IVIG dose and efficient evasion (similar to that by serotypes 8 and 9) at the low IVIG dose (Fig. 9A). These results were essentially confirmed with a second independent IVIG batch from another vendor (Carimune [12%]; Behring AG) (data not shown). Interestingly, the DJ HBD mutants were fully neutralized, comparable to AAV-2 (Fig. 9B). This observation suggested that the HBD affected the display of epitopes on the capsid, thus implying yet another role of this domain for the AAV particle. Alternatively, published data for wild-type AAVs (17), as well as our own preliminary findings (data not shown), indicate that this domain may determine in vivo vector pharmacokinetics by enhancing the clearance of HBD-positive capsids from the blood and, thus, reducing their exposure to neutralizing antibodies.

Lastly, we assessed the feasibility of repeatedly administering the differe