This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baida, G.
Right arrow Articles by Roos, R. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baida, G.
Right arrow Articles by Roos, R. P.

 Previous Article  |  Next Article 

Journal of Virology, June 2008, p. 5879-5886, Vol. 82, No. 12
0022-538X/08/$08.00+0     doi:10.1128/JVI.02432-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

A Subgenomic Segment of Theiler's Murine Encephalomyelitis Virus RNA Causes Demyelination{triangledown}

Gleb Baida,1 Brian Popko,1,2 Robert L. Wollmann,3 Spyridon Stavrou,4 Wensheng Lin,1 Maria Tretiakova,3 Thomas N. Krausz,3 and Raymond P. Roos1,2,4*

Department of Neurology,1 The Jack Miller Center for Peripheral Neuropathy,2 Department of Pathology,3 Committee of Microbiology, University of Chicago Pritzker School of Medicine, Chicago, Illinois 606374

Received 12 November 2007/ Accepted 28 March 2008


arrow
ABSTRACT
 
The DA strain of Theiler's murine encephalomyelitis virus (TMEV) causes a persistent central nervous system (CNS) infection of mice with a restricted virus gene expression and induces an inflammatory demyelinating disease that is thought to be immune mediated and a model of multiple sclerosis (MS). The relative contribution of virus vis-à-vis the immune system in the pathogenesis of DA-induced white matter disease remains unclear, as is also true in MS. To clarify the pathogenesis of DA-induced demyelination, we used Cre/loxP technology to generate a transgenic mouse that has tamoxifen (Tm)-inducible expression of a subgenomic segment of DA RNA in oligodendrocytes and Schwann cells. Tm-treated young transgenic mice developed progressive weakness leading to death, with abnormalities of oligodendrocytes and Schwann cells and demyelination, but without inflammation, demonstrating that DA virus can play a direct pathogenic role in demyelination. Tm treatment of mice at a later age resulted in milder disease, with evidence of peripheral nerve remyelination and focal fur depigmentation; surviving weak mice had persistent expression of the recombined transgene in the CNS, suggesting that the DA subgenomic segment can cause cellular dysfunction but not death, possibly similar to the situation seen during DA virus persistence. These studies demonstrate that DA RNA or a DA protein(s) is toxic to myelin-synthesizing cells. This Cre/loxP transgenic system allows for spatially and temporally controlled expression of the viral transgene and is valuable for clarifying nonimmune (and immune) mechanisms of demyelination induced by TMEV as well as other viruses.


arrow
INTRODUCTION
 
DA and other strains of the TO subgroup of Theiler's murine encephalomyelitis virus (TMEV) produce a biphasic disease in weanling mice, with an initial subclinical neuronal degeneration followed by a chronic inflammatory central nervous system (CNS) white matter disease (reviewed in reference 24). DA virus can be isolated from the CNS for the life of the mouse, with the main sites of virus persistence in macrophages and oligodendrocytes. The immune system appears to play a key role in the white matter disease. CD4+ and CD8+ T cells are important in the development of demyelination (23), as is epitope spreading (14). DA virus-induced disease serves as an excellent model of multiple sclerosis (MS) because of the similarity in their pathology and because the demyelination is believed to be immune mediated in both disease processes. Although the immune system is important in mediating DA virus-induced disease, persistence of the virus also appears critical to the white matter disease.

We sought to clarify the role of DA RNA/gene products and the immune response in the pathogenesis of the white matter disease. We were particularly interested in the following proteins, in their normal context downstream of the DA 5'-untranslated region (5'UTR) (Fig. 1A): (i) L, located at the most amino end of the polyprotein, perturbs nucleo-cytoplasmic trafficking and thereby interferes with type I interferon production (facilitating virus growth in certain cell types) and protein translation (8, 19, 30, 32). (ii) L* is an 18-kDa protein synthesized out of frame with the polyprotein in TO subgroup strains of TMEV from an initiation codon that is 13 nucleotides (nt) downstream from the polyprotein's AUG (1, 9) (Fig. 1A). TO subgroup strains are the only picornaviruses that synthesize a protein out of frame with the polyprotein, suggesting its importance in the unusual phenotype of these strains. A mutant virus with a change of the L* AUG to ACG (1) or with a stop codon in the L* reading frame (31) (but with no change in the predicted amino acid sequence of the polyprotein) fails to persist or demyelinate, supporting a role for L* in these activities. L* fosters virus persistence by interfering with virus clearance normally carried out by CD4+ T cells (11) and by enhancing growth of the virus in mouse macrophages (7). (iii) The capsid proteins, encoded by P1, which is just downstream from the L coding region, make up the infectious particle; these proteins are the major target of the host's antivirus immune response and are therefore of interest with respect to virus clearance and persistence.


Figure 1
View larger version (24K):
[in this window]
[in a new window]

 
FIG. 1. The DA virus genome, subgenomic transgene, and amplified products following PCR and RT-PCR of tissues. (A) The TMEV single-stranded RNA genome of approximately 8,100 nt (not drawn to scale). The 5'UTR precedes the polyprotein coding region, which has the leader (L) coding region at its most amino terminus. The genomic region of P1 is divided into 1A, 1B, 1C, and 1D coding regions, which synthesize the structural capsid proteins VP4, VP2, VP3, and VP1, respectively. The polyprotein's initiation codon is at nt 1066, while the L* initiation codon in the case of the DA strain is at nt 1079. There is a stop codon (UAG) for L* at nt 1547. The dotted line shows the subgenomic region that is included in the transgene. (B) Schematic representation (not drawn to scale) of DA5'UTRLL*P1 (top panel), showing the loxP sites (that flank an upstream transcription stop) as triangles, and DA5'UTRLL*P1{Delta} (bottom panel) after Cre-induced recombination. (C) The upper panel shows an agarose gel of amplified products following PCR with primers to detect recombination of genomic DNA from homogenates of sciatic nerve (lanes 1 to 3), spinal cord (lanes 4 to 6), brain (lanes 7 to 9), and muscle (lanes 10 to 12) from the following animals: a Tm-treated mouse that only carries the DA subgenomic transgene (lanes 1, 4, 7, and 10); a DA/Cre mouse not treated with Tm (lanes 2, 5, 8, and 11); a DA/Cre mouse treated with Tm (lanes 3, 6, 9, and 12). Only neural tissues from Tm-treated DA/Cre mice showed an amplified band of the predicted size of ~300 bp. The lower panel shows amplified products that were obtained from a separate PCR using the primer pair that detects the DA subgenomic transgene irrespective of recombination. The bands at the predicted size of 200 bp are present in all lanes. (D) Agarose gel of amplified products following RT-PCR, using primers to detect recombination, from RNA extracted from the spinal cord (lane 2), lung (lane 3), and brain (lane 4) from a Tm-treated DA/Cre mouse. Lane 1 has no cDNA template. A band (arrow) of the predicted size of ~300 bp was present in the spinal cord and brain, but not lung.

In order to clarify the function of the DA 5'UTR, L, L*, and the capsid proteins with respect to DA virus-induced late demyelinating disease, we generated a mouse that expresses this viral subgenomic region as a transgene in a cell type in which the virus is known to persist, viz., the oligodendrocyte (22). We hypothesized that this transgenic mouse might show a phenotype of interest, clarifying the function of one or more of the expressed genes within myelinating cells. In addition, the transgenic mouse, whether it shows a phenotype or not, might be of value in immunological studies, e.g., T-cell transfer studies using DA virus-infected demyelinated mice as donors. In order to be able to control the time of transgenic expression and to avoid tolerance in immunological studies, we sought to make the expression of the DA subgenomic region inducible. The Cre/loxP recombination system provided a means to achieve our goals of site-specific and inducible expression of the DA subgenomic region. We therefore generated double transgenic (DA/Cre) mice that carried a tamoxifen (Tm)-inducible Cre recombinase protein under the control of the myelin proteolipid protein (PLP) transcriptional control element along with a DA subgenomic region preceded by a floxed transcription stop. Interestingly, the DA/Cre mice developed abnormalities of oligodendrocytes and Schwann cells with demyelination, but without inflammatory infiltrates.


arrow
MATERIALS AND METHODS
 
Transgenic construct. A transgene which contained the chicken β-actin promoter followed by a floxed transcription terminator, by DA5'UTRLL*P1, and then by the globin poly(A) signal was constructed in the following way. (i) A transcription terminator surrounded by loxP sites was engineered. The transcription terminator was selected to be a very efficient stop because of concerns that the mRNA that contained the downstream DA RNA internal ribosome entry site (IRES) might initiate translation, causing "leakiness" with synthesis of the DA L, L*, and P1 proteins in the uninduced state. The terminator sequence, βwt (4, 5), contained the genomic sequence of the human β-globin gene, including the coding region with introns, followed by the 3'UTR. The sequence was amplified from pβwt (obtained from N. J. Proudfoot) using the following primers, which contained a HindIII enzyme cleavage site: forward, 5'-CGCAACCAAGCTTCATGGTGCACCTGACTC-3'; reverse, 5'-CGCAACCAAGCTTATTTATTCATCCCACATAACTGAA-3'. The PCR product was digested with HindIII and ligated into a pBS246 loxP cassette vector (Gibco) that had been digested with HindIII. The resulting plasmid was called pBS246β loxP. (ii) The DA5'UTRLL*P1 fragment was amplified from pDAFL3 (25) using the following primers, which contained NheI enzyme cleavage sites: forward, 5'-AGCAACCGCTAGCATCGATAATACGACTCACTA-3'; reverse, 5'-AGCAACCGCTAGCTTATTCAAGTTCGAGAATGGGGAC-3'. The PCR product was digested with NheI and cloned into SpeI-digested pBS246β loxP, ~50 nucleotides downstream from the 3'-flanking loxP site. (iii) The transcription terminator sequence and DA5'UTRLL*P1 fragment within pBS246β loxP were removed from the resulting plasmid with NotI and inserted into a derivative of pCAGGS (16) that contained a NotI site. The resultant construct containing the chicken β-actin promoter followed by floxed transcription terminator, by DA5'UTRLL*P1, and by the globin poly(A) signal was digested, purified by agarose gel electrophoresis, and then used for pronuclear injection.

Transgenic mice. Transgenic mice were produced by the University of Chicago Transgenic Mouse Core. Superovulated C57BL6/J females were mated to male C57BL6/J mice to produce fertilized eggs for injection with the DA subgenomic construct. Injected eggs were transferred to pseudopregnant females and left to develop. Pups were born ~19 to 20 days later and examined daily. At 15 to 18 days, a tail biopsy was taken to determine the genotype of the pups. Transgene-positive pups (founders) were saved and bred to make lines.

Double transgenic mice were inoculated intraperitoneally with 0.1 mg Tm per 1 g of body weight each day for 10 consecutive days. Mice were anesthetized with ketamine and in some cases perfused with phosphate-buffered saline (PBS) followed with 4% paraformaldehyde (pH 7.3).

Recombination and RNA analysis. Mice were sacrificed, tissues were collected, and virus genomic DNA was isolated with DNeasy (Qiagen, Valencia, CA). For PCR, the following primers were used to detect recombination: forward, 5'-CGTATCACGAGGCCCTTTCGTCTTC-3' (which anneals 32 nucleotides upstream of 5'-loxP site); reverse, 5'- CTATTCCGAGGAACCTGGGTTAGGG (which anneals downstream of the 3'-loxP within the DA 5'UTR). The following primers were used to show the presence of the transgene irrespective of recombination: forward, 5'-TACTATGGCACCTCTCCTCTTGGA-3' (which anneals to the DA viral RNA negative sense strand at nucleotide 1485); reverse, 5'-CAGCCGCAAGAACTTTATCCGTTG-3' (which anneals at nucleotide 1684 of DA viral RNA). The amplified products were analyzed by agarose gel electrophoresis.

RNA was isolated by RNeasy (Qiagen) and subjected to reverse transcriptase PCR (RT-PCR) using random hexamers and Superscript III Platinum (Invitrogen, Carlsbad, CA) to generate cDNA followed by PCR (Eppendorf Mastermix); the same primers were used as those shown above for the genomic DNA PCR analysis. The amplified products were analyzed by agarose gel electrophoresis.

Western blot assay. Homogenates of the brain and spinal cord from animals sacrificed at various times after Tm treatment were electrophoresed on a 12.5% sodium dodecyl sulfate-polyacrylamide gel and subjected to Western blot analysis using a biotinylated anti-VP1 monoclonal antibody, as well as rabbit polyclonal anti-VP1, anti-L, and anti-L* antibodies, followed by an ECL-Plus Western blotting detection system (Amersham Biosciences, Piscataway, NJ). Other Western blot assays involved homogenates of BHK-21 cells that were prepared 24 to 48 h after transfection with peGFP-N1 (a eukaryotic expression vector which expresses green fluorescent protein [GFP]) or a cotransfection of peGFP-N1 along with one of the following: L with GFP fused to its carboxyl end cloned into peGFP-N1, a control pcDNA3.1 vector (Invitrogen, Carlsbad, CA), the recombined DA5'UTRLL*P1 vector, the unrecombined DA5'UTRLL*P vector, or a bicistronic luciferase construct (similar to one previously published except that the DA IRES is present in the bicistronic space [6]); in this case, polyclonal rabbit anti-GFP antibody (Clontech, Palo Alto, CA) was used followed by horseradish peroxidase-conjugated anti-rabbit immunoglobulin G (Cell Signaling, Danvers, MA) for the immunostaining.

Immunohistochemical analysis. At various times after Tm treatment, animals were perfused with 4% paraformaldehyde. Tissues were dissected, placed in 4% paraformaldehyde for 3 h and then 30% sucrose for ~72 h, and then embedded in OCT compound (Sakura Finetechnical Co., Torrance, CA). For immunofluorescence studies, frozen sections from tissues were placed in PBS for 5 min, permeabilized with a PBS solution containing 0.3% Triton X-100, and then placed for 1 h at room temperature in blocking solution (4% bovine serum albumin and 0.15% Tween in PBS) prior to incubation overnight at 4°C with biotinylated anti-VP1 monoclonal antibody diluted in the blocking solution. Sections were washed in PBS three times for 5 min followed by 1-hour incubation at room temperature with fluorescein-conjugated biotin diluted 1:200 in blocking solution. Sections were washed in PBS three times for 5 min and mounted in antifade mounting solution (Fisher, Pittsburgh, PA) prior to imaging. For immunoperoxidase studies, paraffin-embedded sections were deparaffinized, then endogenous peroxidase was blocked with 3% H2O2, and additional blocking was carried out with incubation with goat serum. Biotinylated anti-VP1 monoclonal antibody was overlaid overnight at 4°C. Following washes in PBS, biotin-labeled peroxidase was added followed by washes and development with diaminobenzidine. For CC1 staining, spinal cords, corpus callosum, and optic nerves were incubated in 4% paraformaldehyde in 1x PBS for 2 to 2.5 h, embedded in Tissue-Tek OCT compound, and frozen at –80°C. These tissues were stained using mouse monoclonal antibodies against adenomatus polyposis coli (clone CC1; Calbiochem, San Diego, CA). Stained sections were imaged with a digital Zeiss Axiovert 25 microscope, and morphometric analysis was performed with a Zeiss AxioCam HRC camera using AxioVision 3.1 acquisition software. At least 10 nonoverlapping rectangular areas (~50,000 µm2 each) of white matter from four different randomly selected parts were analyzed for CC1-positive cells. Data were analyzed by one-way analysis of variance followed by the Newman-Keuls test; a P value of <0.05 was considered statistically significant. For the spinal cord, results are presented as the mean ± standard error of the mean of animals from three independent experiments.

Teased fiber preparation. Mice were sacrificed and perfused with 4% paraformaldehyde in PBS. After fixation in 4% paraformaldehyde, sciatic nerve segments, approximately 1 cm long, were washed in PBS and immersed in a 2% solution of osmium tetroxide for 2 h, then washed several times with PBS and incubated overnight in a collagenase solution, and then washed in PBS and subsequently immersed in glycerol for several days, all at room temperature. Individual axons were then teased from the fascicle, dragged onto glass slides, washed with ethanol to remove the glycerol, and coverslipped for examination with a standard light microscope.

Histopathology, electron microscopy, and immunofluorescence studies. Brain, spinal cord, and sciatic nerve specimens for light and electron microscopic examination were processed for paraffin or Epon embedding and sectioning using standard procedures.

Skin studies. Grossly depigmented skin regions from the lip, ventral trunk, and distal limb were dissected from double transgenic mice, formalin fixed, and paraffin embedded. Similar regions were dissected from control littermates for a comparison of the skin histology. Distal limb samples were decalcified for 3 h prior to formalin fixation. Five-micrometer-thick sections were stained with hematoxylin and eosin or with hematoxylin alone.


arrow
RESULTS
 
Double transgenic DA/Cre mice. As described in Materials and Methods, a construct containing the chicken β-actin promoter upstream of a transcriptional terminator flanked by loxP sequences, followed by the DA 5'UTR and the coding region for L, L*, and the capsid regions (Fig. 1B), was injected into the pronuclei of C57BL/6 fertilized eggs. Transgenic mouse lines were obtained as demonstrated by PCR. These mice were crossed with previously described PLP/CreERT mice (2), in which the PLP transcriptional control element drives expression of Cre recombinase protein, which is fused to a mutated ligand-binding domain of the human estrogen receptor and therefore confers Tm inducibility. In Tm-treated mice that carry both the DA subgenomic region transgene and PLP/CreERT, Cre is predicted to enter the nucleus of myelinating cells and remove the transcription terminator upstream of DA5'UTRLL*P1, thereby allowing spatially and temporally controlled expression of the DA subgenomic region.

Two independent lines of Cre/DA mice were prepared that behaved similarly. Genomic DNA from tissues of DA/Cre mice was subjected to PCR followed by agarose gel electrophoresis using primers that detect recombination (Fig. 1C, upper panel). This analysis showed recombination after Tm treatment (with deletion of the transcription stop) within the sciatic nerve, brain, and spinal cord of DA/Cre mice (Fig. 1C, lanes 3, 6, and 9). A greater amount of the amplified recombined band was apparent in sciatic nerve compared to spinal cord and brain, presumably reflecting the large proportion of cells with PLP expression in this tissue. Nonneural tissue from Tm-treated DA/Cre mice (Fig. 1C, lane12), neural tissue from Tm-treated single transgenic mice (Fig. 1C, lanes 1, 2, and 7), and neural tissue from DA/Cre mice that was not Tm treated (Fig. 1C, lanes 2, 5, and 8) failed to show evidence of recombination.

RT-PCR analysis of total RNA from the brain and spinal cord from the Tm-treated DA/Cre mice showed a band of the predicted size following the Cre-induced recombination in brain and spinal cord (Fig. 1D, lanes 2 and 4), but not nonneural tissue (Fig. 1D, lane 3). Although DA subgenomic RNA was expressed in the CNS and presumably the peripheral nervous system, there was no evidence of virus protein antigen in Western blot assays of sciatic nerve homogenates and in immunohistochemical and immunofluorescent assays of brain, spinal cord, and sciatic nerve sections using a biotinylated anti-VP1 capsid monoclonal antibody as well as two different rabbit polyclonal anti-VP1 antibodies and a rabbit anti-L and anti-L* antibodies (data not shown). We suspect that the reason for the absence of virus protein expression is related to a downregulation of protein translation caused by L protein (see below).

Tm-treated double transgenic DA/Cre mice develop weakness. Three- to seven-week-old DA/Cre mice that were treated with Tm began to show weakness of their hind limbs usually 1 to 3 weeks after the last Tm injection. This weakness progressed over a week or less to involve the forelimbs (Fig. 2A). Animals with severe weakness had shallow respirations and usually became moribund within a couple of weeks after the onset of signs and were euthanized.


Figure 2
View larger version (102K):
[in this window]
[in a new window]

 
FIG. 2. Phenotype of DA/Cre mice. (A) A DA/Cre mouse 22 days after Tm treatment (begun at 21 days of age), showing paralysis of the hind legs and weakness of the forelegs. (B) A DA/Cre mouse 3 months after Tm treatment (begun at 7 weeks of age) with a littermate control. The DA/Cre mouse shows depigmentation of fur in several regions. (C) Hematoxylin staining of perioral skin from the littermate control shown in panel B, demonstrating brown melanin pigment in dermal dendritic melanocytes, follicular bulb melanocytes, and hair shaft. Magnification, x400. (D) Hematoxylin staining of depigmented perioral skin of the DA/Cre mouse shown in panel B, demonstrating no melanin pigment. Magnification, x400.

DA/Cre mice that were treated with Tm at 7 weeks of age or older tended to develop more subtle weakness, which generally appeared weeks after Tm administration. In some cases this weakness decreased over time, i.e., the mice appeared to gain strength over weeks or months. Interestingly, these mice also developed focal depigmentation of their fur, most clearly seen in the distal limbs, ventral trunk, perioral regions, and ears (Fig. 2B). Histological analysis of the skin showed a decrease of follicular melanocytes and dermal dendritic melanocytes and a decrease in pigment in hair shafts compared to normal littermates (Fig. 2C and D).

No weakness was observed in DA/Cre mice that were not Tm treated or in single transgenic mice that were Tm treated.

Tm-treated double transgenic DA/Cre mice show abnormalities of oligodendrocytes and Schwann cells with demyelination. Because Tm-treated DA/Cre mice developed hind leg weakness and because PLP is expressed in Schwann cells in the peripheral nervous system, mice were first tested for abnormalities of the peripheral nerves. Electrophysiological studies showed a statistically significant prominent slowing of sciatic nerve conduction velocity of the Tm-treated DA/Cre mice compared to littermate controls, suggesting an abnormality of peripheral nerve myelin and a decrease in the amplitude of the compound muscle action potential (data not shown). In addition, no sural nerve sensory action potential could be elicited in DA/Cre mice that were tested 14, 35, 54, and 180 days after Tm treatment (that was begun at 4, 7, 5, and 8 weeks of age, respectively) in contrast to littermate controls. (data not shown).

Moribund Tm-treated DA/Cre mice were euthanized, and the sciatic nerves, brains, and spinal cords were processed for histological examination. Individual myelinated axons teased from the sciatic nerve showed prominent segmental demyelination (Fig. 3A). Epon-embedded sections of the sciatic nerve confirmed the demyelination of peripheral nerve axons seen in the teased fiber preparations; 60% of axons greater than 1.3 µm in diameter in a representative section of the sciatic nerve of a moribund Tm-treated DA/Cre mouse were unmyelinated or were very thinly myelinated compared to the Tm-treated littermate control, in which the comparably sized axons were all myelinated. Schwann cells filled with myelin debris were found surrounding intact axons or adjacent to intact demyelinated axons (Fig. 3B and C). Some of the axons were fully myelinated and surrounded by Schwann cells that appeared normal, presumably because the recombination mediated by Cre is incomplete in removing DNA segments between loxP sites. There was no evidence of T-cell infiltration and only rare macrophage infiltration within the peripheral nerve; these rare macrophages appeared to be responding to the degeneration rather than playing an active role in the demyelination. Immunohistochemical studies of the sciatic nerve demonstrated rare macrophages and T cells similar to the response seen in controls (data not shown).


Figure 3
View larger version (179K):
[in this window]
[in a new window]

 
FIG. 3. Pathology of Tm-treated DA/Cre mice. (A to C) DA/Cre mouse euthanized 18 days after Tm treatment (begun at 4 weeks of age). (D) DA/Cre mouse euthanized 3 months after Tm treatment (begun at 7 weeks of age). Arrows, some demyelinated axons; closed arrowhead, myelin debris; open arrowhead, remyelinated axon. (A) Teased fiber preparation from the sciatic nerve showing a single osmicated myelinated axon, demonstrating two foci of segmental demyelination (upper panel) and a bundle of adjacent myelinated axons demonstrating multiple foci of segmental demyelination (lower panel). (B) Electron micrograph of longitudinally oriented sciatic nerve, demonstrating an intact demyelinated axon. A Schwann cell adjacent to the demyelinated axon contains myelin debris. Magnification, x3,000. (C) Electron micrograph of transversely oriented sciatic nerve, demonstrating intact demyelinated axon surrounded by Schwann cell cytoplasm with degenerative changes and myelin debris. Magnification, x5,400. (D) Transverse section through the sciatic nerve, demonstrating a thin myelin sheath, characteristic of remyelination, around a large axon. The adjacent myelin sheaths are of the appropriate thickness for the diameter of the axons they surround. Magnification, x5,400.

Sections of the brain and spinal cord were paraffin embedded and hematoxylin and eosin stained or embedded in Epon and stained with toluidine blue. Although examination of the cerebral hemispheres, cerebellum, corpus callosum, and spinal cord of DA/Cre mice by both light and electron microscopy failed to show clear demyelination (data not shown), other studies demonstrated abnormalities of oligodendrocytes and myelin. Frozen sections of the spinal cord, corpus callosum, and optic nerves were stained with CC1 antibody directed against adenomatus polyposis coli, an oligodendrocyte marker. There was a 25 to 50% loss (P < 0.001) in the number of CC1-immunoreactive cells in the spinal cord, corpus callosum, and optic nerve when sections from four Tm-treated DA/Cre mice from separate litters were compared to sections from five littermate Tm-treated control mice that carried a single or no transgene (Fig. 4A to C); there was minimal overlap between the number of CC1-immunoreactive cells in these three tissues compared to the numbers in the corresponding tissues from littermate controls, i.e., 30 of a total of 32 sections from the DA/Cre mice had a number of CC1-immunoreactive cells, which was lower than the number of CC1-immunoreactive cells in 40 sections from the corresponding tissues of littermate controls. The difference in CC1 immunoreactivity was most prominent in the optic nerves of the DA/Cre mice, prompting us to examine this highly myelinated tissue ultrastructurally. Epon-embedded toluidine blue-stained sections of the optic nerves of Tm-treated DA/Cre mice demonstrated no clear abnormalities in oligodendrocytes or prominent areas of demyelination; however, there tended to be a subtle increase in clusters of unmyelinated axons compared to control mice (Fig. 4D and E). There were 169 unmyelinated axons in a total of 1,480 axons (12.1%) present in five electron micrograph images of the optic nerve of the Tm-treated DA/Cre mice compared to 47 unmyelinated axons in a total of 1,620 axons (2.9%) in the Tm-treated littermate controls, demonstrating that there was a significant increase in unmyelinated axons (P < 0.01) in the optic nerves of the DA/Cre mice.


Figure 4
View larger version (127K):
[in this window]
[in a new window]

 
FIG. 4. Abnormalities of the CNS white matter of Tm-treated DA/Cre mice. Nonoverlapping rectangular areas (~50,000 µm2 each) of white matter were analyzed for CC1-positive cells. (A) The mean number of CC1 antibody staining cells from 20 areas of 14 separate sections of the spinal cord from three DA/Cre mice (that were treated with Tm for 10 days starting at ~3 weeks of age and euthanized when moribund ~1.5 to 3 weeks after the last Tm dose) was significantly less (P < 0.001) than in 22 areas of 9 sections from the spinal cord of three littermates that carried no or a single transgene and had identical Tm treatment. (B) The mean number of CC1 antibody staining cells from six areas of three sections of the corpus callosum from one of the DA/Cre transgenic mice that were immunostained in panel A was significantly decreased (P < 0.001) compared to four areas from two sections of one of the nontransgenic littermates that were immunostained in panel A. (C) The mean number of CC1 antibody staining cells from seven areas from six sections of the optic nerve from a DA/Cre mouse that was treated with Tm for 10 days starting at ~4 weeks of age and euthanized when moribund 19 days later was significantly less (P < 0.001) than 12 areas from six sections of the optic nerve from two single transgenic littermates that had identical Tm treatment. (D) Electron micrograph of the optic nerve of the DA/Cre mouse (that was immunostained in panel C), showing clusters of unmyelinated axons in the optic nerve (circled areas). Magnification, x2,500. (E) Electron micrograph of the optic nerve of a control Tm-treated littermate that was immunostained in panel C. Magnification, x2,500.

As noted above, DA/Cre mice that were treated with Tm at 7 weeks of age had a more subtle weakness than those treated at an earlier age; in addition, the motor deficits appeared to lessen over time. Epon-embedded sections of the sciatic nerves of these mice showed evidence of remyelination (Fig. 3D). CNS tissue from weak animals treated with Tm at an older age was processed for RT-PCR. Interestingly, there was evidence of persistent expression of the full length of the recombined subgenomic segment (Fig. 5) for as long as 3 months (the longest time sampled) after Tm treatment, demonstrating that cells containing this segment had not died but presumably had abnormalities that led to weakness. In contrast, RT-PCR of CNS tissue from a noninduced double transgenic mouse and an induced single transgenic mouse showed no evidence of recombination after 30 cycles of amplification (data not shown).


Figure 5
View larger version (46K):
[in this window]
[in a new window]

 
FIG. 5. The recombined DA subgenomic construct is present and expressed in a surviving DA/Cre mouse ~3 months after Tm treatment. RT-PCR of CNS from a DA/Cre mouse 3 months after Tm treatment that was begun at age 7 weeks. A series of primers was used that covered the full length of the transgene's RNA from the 5' end (LoxP-5'UTR; lanes 1 to 3) through some of the coding region (VP3; lanes 4 to 6) to the termination codon (VP1-stop; lanes 7 to 9). The sizes of the amplified segment correspond to the expressed full length of the recombined transgene. -, no RT; +, plasmid; M, marker.

DA L downregulates host cell protein expression. A recent study showed that encephalomyocarditis virus, a cardiovirus similar to TMEV, downregulates cellular protein expression by interfering with nucleo-cytoplasmic transport and mRNA export (19). For this reason, we wondered whether the failure to detect virus protein in the Tm-treated DA/Cre mouse was a result of the expression of DA L. In order to investigate this we performed a Western immunoblot assay, testing the level of GFP expression from a vector that only expresses GFP (peGFP-N1) with and without cotransfection of a peGFP-N1 vector that expresses L (fused to GFP). Figure 6A, a representative Western blot of homogenates from BHK-21 cells, shows that GFP expression in peGFP-N1 is lower when cotransfected along with L-GFP (lane 3) than when cotransfected with control pcDNA3.1 vector. Interestingly, longer exposures showed that there was also minimal expression of the L-GFP fusion protein, indicating that its expression was also decreased (data not shown). A separate Western blot assay (Fig. 6B) showed a lower GFP expression when peGFP-N1 was cotransfected with the recombined DA5'UTRLL*P1 transgene (lane 2) than with a control pcDNA3.1 vector (lane 3) or a bicistronic luciferase vector containing the DA IRES in the intercistronic region (lane 4). Figure 6C shows another Western blot and demonstrates a lower level of GFP staining following cotransfection of peGFP-N1 with the recombined transgene (lane 1) than with the unrecombined transgene (lane 2).


Figure 6
View larger version (38K):
[in this window]
[in a new window]

 
FIG. 6. Western immunoblot results, showing a decrease in expression of GFP when DA L protein is expressed. All transfections involved an identical amount of a GFP expression vector, peGFP-N1, and an identical total amount of DNA. The arrow shows the predicted mobility of GFP. Homogenates of BHK-21 cells were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by Western blot analysis using anti-GFP antibody and then ECL-Plus Western blot detection. (A) Results for homogenate not transfected (lane 1) or transfected with peGFP-N1 (lane 2) along with pcDNA3.1 vector or peGFP-N1 and the DA L coding region cloned into peGFPN-1 (so that GFP is fused to its carboxyl end) (lane 3). This Western blot is representative and shows a decrease in the expression of GFP as a result of cotransfection with L-GFP. Longer exposures showed that there was also minimal expression of L-GFP, indicating that its expression was also decreased. (B) A separate Western blot showing homogenate not transfected (lane 1) or transfected with peGFP-N1 along with the recombined DA5'UTRLL*P1 transgene (lane 2), with pcDNA3.1 vector (lane 3), or with a bicistronic luciferase vector with the DA IRES in the intercistronic region (lane 4). The Western blot is representative and shows a decrease in the expression of GFP when cotransfected with the recombined transgene but not with a bicistronic vector containing the DA IRES. (C) A separate Western blot of homogenates of BHK-21 cells showing transfection of peGFP-N1 along with the recombined transgene (lane 1) or the unrecombined transgene (lane 2). This Western blot shows that there is a decrease in GFP expression following cotransfection with the recombined, but not the unrecombined, transgene.


arrow
DISCUSSION
 
The DA strain and other members of the TO subgroup of TMEV produce a chronic inflammatory CNS demyelinating disease that is thought to be immune mediated. There is also evidence that supports a key role for the virus in demyelination. For example, DA virus is known to cause demyelination in infected nude mice (26, 27). Furthermore, DA virus antigen and virions have been identified in oligodendrocytes (22), which have a "dying back" pathology (21). The relative contribution of the pathogen's direct effect vis-à-vis immune-mediated damage in the pathogenesis of DA-induced white matter disease remains unclear, as is also the case with other virus-induced demyelinating diseases (13, 33) as well as MS. In order to clarify the function of selected DA virus genes and to generate mice for immunological studies, we made use of the Cre/loxP system to provide inducible and cell-type-specific expression of part of the DA virus genome in oligodendrocytes (and Schwann cells), a cell type in which DA virus is known to persist.

Although the DA/Cre mice that we prepared had evidence of RNA expression of the virus subgenomic segment, there was no evidence of virus protein synthesis. We suspect that the absence of expression of virus proteins is a result of the activity of the L protein. L has been shown to downregulate protein expression in the case of encephalomyocarditis virus, a cardiovirus similar to TMEV, by interfering with nucleo-cytoplasmic transport and mRNA export (19). Our studies of transfected BHK-21 cells demonstrated that DA L interferes with protein expression and even its own expression following transfection into cells (Fig. 6A). The transgene has a similar effect on protein expression following transfection of BHK-21cells, but it is less prominent than following transfection of L, perhaps because L is fused to P1 in the transgene (Fig. 6B and C); one would anticipate that the effect of the transgene would be magnified with its continuous expression in glial cells of a mouse and would not be diluted with rapid cell division, as in the case of BHK-21 cells.

DA/Cre mice treated with Tm at 3 weeks of age developed progressive weakness leading to death. There was evidence of demyelinated peripheral nerves with abnormalities of Schwann cells and oligodendrocytes. A recent report has demonstrated that DA can cause Schwann cell death and peripheral nerve demyelination (3). The finding of abnormalities of myelin-synthesizing cells and demyelination in the DA/Cre mouse in the absence of inflammatory pathology demonstrates that DA viral genes can cause abnormalities of myelin-synthesizing cells and demyelination without a contribution from the immune system.

One question that arose in the present study was why CNS demyelination (which was suggested by a subtle increase in clusters of unmyelinated axons in the optic nerve compared to control mice) was not as prominent as the peripheral nerve demyelination in DA/Cre mice, especially considering the finding of the CC1 staining abnormalities of the oligodendrocyte. There are several possible explanations for this finding. (i) It is possible that CNS demyelination was not prominent because of issues related to timing or sampling. For example, it is possible that Schwann cell dysfunction and peripheral nerve demyelination occurred before CNS demyelination became easily detectable because Tm levels were higher and more available earlier in the periphery than in the CNS following intraperitoneal injections, perhaps because CNS penetration of Tm may be inefficient. In addition, mice may die from peripheral nerve dysfunction (perhaps causing respiratory insufficiency) prior to the development of prominent CNS demyelination. (ii) Schwann cells may be more susceptible to the toxicity of DA5'UTRLL*P1 than oligodendrocytes. Peripheral nerve demyelination may not generally be seen following DA infection because the usual route of infection is intracerebral.

There are two prior reports concerning the generation of mice carrying DA subgenomic constructs as transgenes (12, 29). In contrast to the DA/Cre mouse, neither of the other transgenic mice developed a phenotype, presumably because of the differences in the transgene and the level and timing of the transgene's expression.

Interestingly, mice treated with Tm later in life developed a more mild weakness and did not die. These mice had evidence of persistent expression of the recombined transgene in the CNS for months after treatment, suggesting that the presence of the DA subgenomic construct can lead to dysfunction, but not death, of at least some myelin-synthesizing cells. The persistence of the DA subgenomic construct in the CNS along with dysfunction of myelin-synthesizing cells is similar to what is seen in the case of DA virus demyelinated mice, where there is a restricted virus gene expression (with very little infectious virus in the face of abundant virus genome in the CNS) and demyelination. Our finding that a DA virus subgenomic construct can cause cellular dysfunction over a prolonged period of time may reflect a disturbance of the differentiated or "luxury" function of a cell type (17). Surviving Tm-treated DA/Cre mice developed depigmentation. A previously published study (10) found that the PLP promoter has activity in melanocytes during embryonic development. We suspect that the depigmentation observed in the Tm-treated older DA/Cre mice is secondary to dysfunction or death of these same neural crest-derived melanocytes. No depigmentation was seen in animals that were Tm treated at 3 weeks, presumably because these animals died before the growth of new (depigmented) hair.

The mechanisms by which the virus genes or gene products of TMEV or other picornaviruses cause death or dysfunction of cells within an animal are unclear. Our studies suggest that DA RNA (the 5'UTR or the coding region of the RNA) and/or one or more of the DA proteins (L, L*, or one of the capsid proteins) are toxic to cells. There are several possible mechanisms for the toxicity. (i) The viral RNA could be toxic, as described for a number of nonviral diseases (15, 20), because of sequestration of proteins that bind the RNA and are important for cell viability. Cell-type-specific proteins that are important in key cellular functions are known to bind the IRES in the picornavirus 5'UTR; for example, neuronal polypyrimidine tract binding protein, which is important in neural cell splicing of particular cellular mRNAs, binds the TMEV 5'UTR (18). (ii) One or more of the DA viral proteins could be toxic. As noted above, a recent study demonstrated that L of encephalomyocarditis virus, a cardiovirus similar to TMEV, is a downregulator of new protein synthesis because it blocks mRNA export from the nucleus (19); one could presume that expression of DA L would also lead to cellular toxicity, especially in myelinating cells, which are very sensitive to abnormalities in translation (28). Another possibility is that DA capsid proteins encoded by P1 are toxic because they are not processed by the virus 3C protease. This seems less likely, since no capsid proteins were detected by immunohistochemistry or on Western blots. Our recent studies suggest that the subgenomic construct's toxicity is cell type specific, since transfection of the construct into cultured BHK-21 cells failed to cause apoptosis or a significant disturbance in cell growth (data not shown). We now plan to generate mice that carry a smaller segment of DA5'UTRLL*P1 in order to delineate the pathogenic region. In addition, we plan to use DA/Cre mice in immunological investigations in order to better clarify the contribution of the immune system to the late disease.

One could perhaps take issue with some artificial aspects of the transgenic mouse system and the possibility that nonphysiological aspects of the system may lead to phenotypes that do not have a real parallel with that seen following virus infection. For example, in contrast to DA virus-infected cells, L and the capsid proteins that are predicted to be expressed in the transgenic mouse will remain unprocessed because the coding region for viral proteases is not present in the transgene. Although it is true that L and the capsid proteins are processed during DA virus infection (and not cleaved in the DA/Cre mice), there is a period during infection in which the proteins are present in an unprocessed state. In addition, peptides of P1 and other viral proteins are the targets of antiviral T-cell responses. Another potential issue with the DA/Cre mouse is that cDNA corresponding to the TMEV subgenomic RNA enters the nucleus and is transcribed. Although this admittedly never occurs during infection, one should note that the frequent in vitro use of transfection of subgenomic segments of virus genes (with the presence of viral RNA within the nucleus) has been of value in clarifying the function of viral proteins. Despite these shortcomings, our Cre/loxP transgenic system may be valuable in helping to clarify the role of viral gene products within cells of a living organism and the importance of the host immune response in disease pathogenesis. A similar approach was recently used while this paper was in preparation in order to investigate enterovirus myocarditis (34).


arrow
ACKNOWLEDGMENTS
 
This work was supported by the following grants: The National Multiple Sclerosis Society (RG 3456-A-10) and the National Institutes of Health (RO1 NS37958) (to R.P.R.) and a Multiple Sclerosis Society Career Transition Fellowship (TA 3026-A-1) (to W.L.).

The assistance of Hansen Ho and gifts of DA virus antibody from R. Fujinami and pβwt from N. J. Proudfoot are gratefully acknowledged.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Neurology, 5841 S. Maryland Ave., MC2030, The University of Chicago, Chicago, IL 60637. Phone: (773) 702-5659. Fax: (773) 834-9089. E-mail: rroos{at}neurology.bsd.uchicago.edu Back

{triangledown} Published ahead of print on 9 April 2008. Back


arrow
REFERENCES
 
    1
  1. Chen, H. H., W. P. Kong, L. Zhang, P. L. Ward, and R. P. Roos. 1995. A picornaviral protein synthesized out of frame with the polyprotein plays a key role in a virus-induced immune-mediated demyelinating disease. Nat. Med. 1:927-931.[CrossRef][Medline]
  2. 2
  3. Doerflinger, N. H., W. B. Macklin, and B. Popko. 2003. Inducible site-specific recombination in myelinating cells. Genesis 35:63-72.[CrossRef][Medline]
  4. 3
  5. Drescher, K. M., and S. M. Tracy. 2007. Injection of the sciatic nerve with TMEV: a new model for peripheral nerve demyelination. Virology 359:233-242.[CrossRef][Medline]
  6. 4
  7. Dye, M. J., and N. J. Proudfoot. 2001. Multiple transcript cleavage precedes polymerase release in termination by RNA polymerase II. Cell 105:669-681.[CrossRef][Medline]
  8. 5
  9. Dye, M. J., and N. J. Proudfoot. 1999. Terminal exon definition occurs cotranscriptionally and promotes termination of RNA polymerase II. Mol. Cell 3:371-378.[CrossRef][Medline]
  10. 6
  11. Guest, S., E. Pilipenko, K. Sharma, K. Chumakov, and R. P. Roos. 2004. Molecular mechanisms of attenuation of the Sabin strain of poliovirus type 3. J. Virol. 78:11097-11107.[Abstract/Free Full Text]
  12. 7
  13. Himeda, T., Y. Ohara, K. Asakura, Y. Kontani, M. Murakami, H. Suzuki, and M. Sawada. 2005. A lentiviral expression system demonstrates that L* protein of Theiler's murine encephalomyelitis virus (TMEV) is essential for virus growth in a murine macrophage-like cell line. Virus Res. 108:23-28.[CrossRef][Medline]
  14. 8
  15. Kong, W.-P., G. D. Ghadge, and R. P. Roos. 1994. Involvement of cardiovirus leader in host cell-restricted virus expression. Proc. Natl. Acad. Sci. USA 91:1796-1800.[Abstract/Free Full Text]
  16. 9
  17. Kong, W. P., and R. P. Roos. 1991. Alternative translation initiation site in the DA strain of Theiler's murine encephalomyelitis virus. J. Virol. 65:3395-3399.[Abstract/Free Full Text]
  18. 10
  19. Leone, D. P., S. Genoud, S. Atanasoski, R. Grausenburger, P. Berger, D. Metzger, W. B. Macklin, P. Chambon, and U. Suter. 2003. Tamoxifen-inducible glia-specific Cre mice for somatic mutagenesis in oligodendrocytes and Schwann cells. Mol. Cell. Neurosci. 22:430-440.[CrossRef][Medline]
  20. 11
  21. Lin, X., X. Ma, M. Rodriguez, and R. P. Roos. 2004. CD4+ T cells are important for clearance of DA strain of TMEV from the central nervous system of SJL/J. mice. Int. Immunol. 16:1237-1240.[Abstract/Free Full Text]
  22. 12
  23. Lin, X., M. K. Njenga, A. J. Johnson, K. D. Pavelko, C. S. David, L. R. Pease, and M. Rodriguez. 2002. Transgenic expression of Theiler's murine encephalomyelitis virus genes in H-2b mice inhibits resistance to virus-induced demyelination. J. Virol. 76:7799-7811.[Abstract/Free Full Text]
  24. 13
  25. Matthews, A. E., E. Lavi, S. R. Weiss, and Y. Paterson. 2002. Neither B cells nor T cells are required for CNS demyelination in mice persistently infected with MHV-A59. J. Neurovirol. 8:257-264.[CrossRef][Medline]
  26. 14
  27. Miller, S. D., C. L. Vanderlugt, W. S. Begolka, W. Pao, K. L. Neville, R. L. Yauch, and B. S. Kim. 1997. Epitope spreading leads to myelin-specific autoimmune responses in SJL mice chronically infected with Theiler's virus. J. Neurovirol. 3:S62-S65.[Medline]
  28. 15
  29. Moseley, M. L., T. Zu, Y. Ikeda, W. Gao, A. K. Mosemiller, R. S. Daughters, G. Chen, M. R. Weatherspoon, H. B. Clark, T. J. Ebner, J. W. Day, and L. P. Ranum. 2006. Bidirectional expression of CUG and CAG expansion transcripts and intranuclear polyglutamine inclusions in spinocerebellar ataxia type 8. Nat. Genet. 38:758-769.[CrossRef][Medline]
  30. 16
  31. Niwa, H., K. Yamamura, and J. Miyazaki. 1991. Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108:193-199.[CrossRef][Medline]
  32. 17
  33. Oldstone, M. B., Y. N. Sinha, P. Blount, A. Tishon, M. Rodriguez, R. von Wedel, and P. W. Lampert. 1982. Virus-induced alterations in homeostasis: alteration in differentiated functions of infected cells in vivo. Science 218:1125-1127.[Abstract/Free Full Text]
  34. 18
  35. Pilipenko, E. V., E. G. Viktorova, S. T. Guest, V. I. Agol, and R. P. Roos. 2001. Cell-specific proteins regulate viral RNA translation and virus-induced disease. EMBO J. 20:6899-6908.[CrossRef][Medline]
  36. 19
  37. Porter, F. W., Y. A. Bochkov, A. J. Albee, C. Wiese, and A. C. Palmenberg. 2006. A picornavirus protein interacts with Ran-GTPase and disrupts nucleocytoplasmic transport. Proc. Natl. Acad. Sci. USA 103:12417-12422.[Abstract/Free Full Text]
  38. 20
  39. Ranum, L. P., and T. A. Cooper. 2006. RNA-mediated neuromuscular disorders. Annu. Rev. Neurosci. 29:259-277.[CrossRef][Medline]
  40. 21
  41. Rodriguez, M. 1985. Virus-induced demyelination in mice: "dying back" of oligodendrocytes. Mayo Clin. Proc. 60:433-438.[Medline]
  42. 22
  43. Rodriguez, M., J. L. Leibowitz, and P. W. Lampert. 1983. Persistent infection of oligodendrocytes in Theiler's virus-induced encephalomyelitis. Ann. Neurol. 13:426-433.[CrossRef][Medline]
  44. 23
  45. Rodriguez, M., K. D. Pavelko, M. K. Njenga, W. C. Logan, and P. J. Wettstein. 1996. The balance between persistent virus infection and immune cells determines demyelination. J. Immunol. 157:5699-5709.[Abstract]
  46. 24
  47. Roos, R. P. 2002. Pathogenesis of Theiler's murine encephalomyelitis virus-induced disease, p. 427-435. In B. L. Semler and E. Wimmer (ed.), Molecular biology of picornaviruses. ASM Press, Washington, DC.
  48. 25
  49. Roos, R. P., S. Stein, Y. Ohara, J. L. Fu, and B. L. Semler. 1989. Infectious cDNA clones of the DA strain of Theiler's murine encephalomyelitis virus. J. Virol. 63:5492-5496.[Abstract/Free Full Text]
  50. 26
  51. Roos, R. P., and R. Wollmann. 1984. DA strain of Theiler's murine encephalomyelitis virus induces demyelination in nude mice. Ann. Neurol. 15:494-499.[CrossRef][Medline]
  52. 27
  53. Rosenthal, A., R. S. Fujinami, and P. W. Lampert. 1986. Mechanism of Theiler's virus-induced demyelination in nude mice. Lab. Investig. 54:515-522.[Medline]
  54. 28
  55. Scheper, G. C., M. S. van der Knaap, and C. G. Proud. 2007. Translation matters: protein synthesis defects in inherited disease. Nat. Rev. Genet. 8:711-723.[CrossRef][Medline]
  56. 29
  57. Shaw-Jackson, C., and T. Michiels. 1999. Absence of internal ribosome entry site-mediated tissue specificity in the translation of a bicistronic transgene. J. Virol. 73:2729-2738.[Abstract/Free Full Text]
  58. 30
  59. Usui, T., Y. Hamada, and M. Arita. 1974. A case of Guillain-Barre syndrome associated with coxsackie b-5 virus infection. Tokushima J. Exp. Med. 21:17-19.[Medline]
  60. 31
  61. Van Eyll, O., and T. Michiels. 2002. Non-AUG-initiated internal translation of the L* protein of Theiler's virus and importance of this protein for viral persistence. J. Virol. 76:10665-10673.[Abstract/Free Full Text]
  62. 32
  63. van Pesch, V., O. van Eyll, and T. Michiels. 2001. The leader protein of Theiler's virus inhibits immediate-early alpha/beta interferon production. J. Virol. 75:7811-7817.[Abstract/Free Full Text]
  64. 33
  65. Wu, G. F., A. A. Dandekar, L. Pewe, and S. Perlman. 2000. CD4 and CD8 T cells have redundant but not identical roles in virus-induced demyelination. J. Immunol. 165:2278-2286.[Abstract/Free Full Text]
  66. 34
  67. Xiong, D., T. Yajima, B. K. Lim, A. Stenbit, A. Dublin, N. D. Dalton, D. Summers-Torres, J. D. Molkentin, H. Duplain, R. Wessely, J. Chen, and K. U. Knowlton. 2007. Inducible cardiac-restricted expression of enteroviral protease 2A is sufficient to induce dilated cardiomyopathy. Circulation 115:94-102.[Abstract/Free Full Text]


Journal of Virology, June 2008, p. 5879-5886, Vol. 82, No. 12
0022-538X/08/$08.00+0     doi:10.1128/JVI.02432-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Ricour, C., Delhaye, S., Hato, S. V., Olenyik, T. D., Michel, B., van Kuppeveld, F. J. M., Gustin, K. E., Michiels, T. (2009). Inhibition of mRNA export and dimerization of interferon regulatory factor 3 by Theiler's virus leader protein. J. Gen. Virol. 90: 177-186 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baida, G.
Right arrow Articles by Roos, R. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baida, G.
Right arrow Articles by Roos, R. P.