This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Whalen, K. A.
Right arrow Articles by Schaffhausen, B. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Whalen, K. A.
Right arrow Articles by Schaffhausen, B. S.

 Previous Article  |  Next Article 

Journal of Virology, May 2008, p. 4946-4954, Vol. 82, No. 10
0022-538X/08/$08.00+0     doi:10.1128/JVI.02650-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Polyomavirus Middle T Antigen Induces the Transcription of Osteopontin, a Gene Important for the Migration of Transformed Cells{triangledown}

Kerry A. Whalen,1,{dagger} Georg F. Weber,2 Thomas L. Benjamin,3 and Brian S. Schaffhausen1*

Department of Biochemistry, Tufts University School of Medicine, 136 Harrison Avenue, Boston, Massachusetts 02111,1 College of Pharmacy, University of Cincinnati Medical Center, Cincinnati, Ohio 45267,2 Department of Pathology, Harvard Medical School, Boston, Massachusetts 021153

Received 13 December 2007/ Accepted 29 February 2008


arrow
ABSTRACT
 
Middle T antigen (MT) is the principal oncoprotein of murine polyomavirus. Experiments on the acute immediate effects of MT expression on cellular RNA levels showed that expression of osteopontin (OPN) was strongly induced by MT expression. Osteopontin is a protein known to be associated with cancer. It has a role in tumor progression and invasion. Protein analysis confirmed that MT induced the secretion of OPN into the extracellular medium. Expression of antisense OPN RNA had no effect on the growth of MT-transformed cells. However, it had a strong effect on the ability of MT transformants to migrate or to fill a wound. Analysis of MT mutants implicated both the SHC and phosphatidylinositol 3-kinase pathways in OPN induction. Reporter assays showed that MT regulated the OPN promoter through two of its PEA3 (polyoma enhancer activator 3) sites. As critical PEA3 sites are also part of the polyomavirus enhancer, the same signaling important for viral replication also contributes to virally induced metastatic potential.


arrow
INTRODUCTION
 
Murine polyomavirus causes a broad range of tumors in various types of cells and has been a valuable model for studying growth regulation (21, 29, 33). Middle T antigen (MT) is the principal oncoprotein of polyomavirus that is necessary (9, 79) and often sufficient (81) for transformation in vitro. MT delivered as a transgene or a retrovirus can induce tumors in a wide variety of tissues (5, 38, 55, 78, 104). Viruses carrying mutant MTs often are defective for transformation in vitro or tumorigenesis in vivo (7, 18, 35, 100). Similarly, transgenic mutant MTs show different phenotypes from the wild type (96).

MT is associated with membranes and underlying cytoskeletal elements (2, 46, 69, 75). Its ability to transform depends upon that association (9). MT functions as a kind of adaptor, on which cellular signaling proteins are assembled. It binds the A and C subunits of protein phosphatase 2A (63, 90). As a result of this association, MT is able to bind protein tyrosine kinases of the SRC family (SRC, YES, and FYN) (15, 17, 42, 52). In the protein tyrosine kinase complex, MT is phosphorylated on three major tyrosine residues: 315, 322, and 250 (10, 39, 44, 68). Each of these sites represents a connection to a signal generator: 315 to phosphatidylinositol 3-kinase (PI3K) and one or more additional interacting proteins (41, 49, 97), 250 to SHC (8, 24) and thence to GRB2 and SOS, and 322 to phospholipase C-{gamma}1 (PLC-{gamma}1) (77) and potentially PI3K as well. Mutation of amino acid 322 has had a modest effect in some transformation assays (57), but there is a striking effect at low serum concentration (77). Mutation of tyrosine 250 has a dramatic effect on MT transforming ability (57), as do mutations in the regions amino terminal to position 250 (the NPTY motif) (27, 28). Tyrosine 250 represents part of the binding site for the adaptor SHC, and that binding leads to tyrosine phosphorylation of SHC (8, 24). In turn, SHC binding and tyrosine phosphorylation are responsible for the recruitment of GRB2. Association with PI3K is profoundly important for transformation in vitro (10). In fact, MT (86) does not transform PI3K catalytic subunit p110{alpha} knockout cells. Loss of PI3K binding has a dramatic effect on the tumor profile in mice as well (34). However, this picture of the three phosphorylation sites does not tell the whole MT story. Additional minor tyrosine phosphorylation sites may also contribute to the MT phenotype (12). Finally, serine phosphorylation at 257, which controls association with the 14-3-3 family, affects the ability of MT to cause salivary gland tumors (18).

This work concerns the regulation of the stress response and metastasis gene osteopontin (OPN) by MT. Physiologically, OPN is an acute-phase cytokine that is secreted by T cells and macrophages upon activation. It mediates the homing of immune system cells and activates cellular immune responses (4). OPN has been strongly associated with cancer. It plays an important role in tumor progression (65) and metastasis (62, 89, 105). It can promote both cell migration (83) and invasion (82). OPN also prevents programmed cell death in response to diverse stimuli (23, 45, 95), which may bear on the anchorage-independent survival of metastasizing cells. There has been some study of the connections between MT and OPN. Mammary epithelial cells that were OPN–/– could not be transformed by MT (14). Jessen and colleagues (47) compared a low-metastasis MT breast cell line (Db) to one that was highly metastatic (Met). The highly metastatic line produced OPN that was necessary for metastasis. However, OPN was not sufficient in this system. In the nonmetastatic line, overexpression of OPN did not generate metastases, suggesting that additional MT-dependent processes are required.

The study reported here was designed to measure the immediate effect of MT on transcription patterns in 3T3 cells in a manner similar to that of Klucky (51). Among the abundantly expressed genes, OPN was the one most affected by MT. Analysis of both RNA and protein confirmed that MT induced OPN expression. Reporter assays showed that MT regulated the OPN promoter through its PEA3 (polyoma enhancer activator 3) sites. MT genetics indicated that the effects on the OPN promoter involved both SHC and PI3K pathways. Although expression of antisense OPN RNA had no effect on the growth of MT-transformed cells, it strongly suppressed the ability of MT transformants to migrate or to fill a wound.


arrow
MATERIALS AND METHODS
 
Cell lines, transfections, and infections. NIH 3T3 cells and A31 BALB/c cells were obtained from the American Type Culture Collection. Cells were grown in Dulbecco's modified Eagle's medium (DMEM; Gibco) and supplemented with 10% calf serum (CS; HyClone). Transfections of NIH 3T3 cells were carried out by the calcium phosphate precipitation method of Chen and Okayama (11). Tet-off regulated cell lines were created using the Tet-off mouse 3T3 cells and the pBIG vector (Clontech). Wild-type MT was cloned into the pBIG vector, and cell lines were selected using puromycin (5 µg/ml). Tumor-derived cell lines were obtained from C3H/BiDa mice inoculated with polyomavirus.

The packaging cell line Bosc293T was used to generate high-titer retrovirus for infection of A31 BALB/c cells. Ten micrograms of each retrovirus construct was transfected by the calcium phosphate precipitation method. The cells were infected in the presence of 8 µg/ml Polybrene (Sigma), with the retroviral supernatant harvested 48 h posttransfection of the packaging cell lines. Infected cells were selected in DMEM containing 10% calf serum and 5 µg/ml puromycin. Cells were doubly infected with MT and antisense OPN or empty vector and selected in DMEM containing 10% calf serum, 5 µg/ml puromycin, and 3 µg/ml blasticidin.

DNA constructs and infections. The following pCMV MT constructs were used and have been described previously: 315F (10), 250F (8); 322 (77), 315YAAA and 315FAAA (41), {Delta}190, 250F/322F, 250F/315F/322F, and 248 (28). The constructs of the OPN promoter, the various deletion mutants (36), and the antisense OPN have been described previously (105). The 110-CAAX construct was originally created by Hu et al. (43). Standard PCR methods based on Pfu polymerase (Stratagene) were used to generate OPN PEA3 mutants with the following oligonucleotides: upstream PEA3 site, forward (5'CTTTGTGTGTGTTTCCTTTTCT(GAA)TTTTTTTTTTTTTAACCAC 3') and reverse (5' GTGGTTAAAAAAAAAAAAA(TTC)AGAAAAGGAAACACACACAAAG 3'); and downstream PEA3 site, PEA3 (5' CAAAACCAGAGGA(TTC)AGTGTAGGAGCAGGTGGGCC 3') and PEA4 (5' GGCCCACCTGCTCCTACACT (GAA)TCCTCTGGTTTTG3'). The integrity of all DNA constructs was confirmed by DNA sequencing.

Luciferase assays. NIH 3T3 cells were transfected at a confluence of 20% with 1 µg of OPN-luciferase (OPN-luc) and the various deletion/promoter mutants with 500 ng pCMV MT expression vector and placed into 0.2% CS starvation medium 6 h posttransfection. Cells were harvested approximately 48 h posttransfection and resuspended in buffer (25 mM Tris [pH 7.5], 1 mM EDTA) and subjected to freeze-thaw three times. The lysates were cleared by Eppendorf centrifugation and assayed for luciferase activity.

RNA analysis. Tet-off wild-type MT cells were grown in the presence or absence of doxycycline at a concentration of 1 µg/ml, and RNA was collected 48 h later. Total RNA was collected using the Trizol reagent (Invitrogen) according to the manufacturer's protocol. Briefly, 2 ml of Trizol reagent was added to a 100-mm dish and cells were displaced by pipetting. The samples were allowed to sit for 5 min, after which 0.4 ml of chloroform was added to the Trizol. The tubes were shaken and spun for 2 min. The aqueous phase was removed, and the RNA was precipitated with isopropanol and spun at 4°C. The RNA was washed with 75% ethanol and centrifuged. The RNA was redissolved using diethyl pyrocarbonate-treated water. Purity and yield were determined by spectrophotometry at 260 and 280 nm.

Expression levels were measured on the total RNA using the Mergen ExpressChip DNA mouse chip microarray, version M01 (Mergen Ltd., San Leandro, CA; http://www.mergen-ltd.com).

For Northern blotting analysis, 10 µg of total RNA was separated on a 1.2% agarose gel containing formaldehyde and blotted onto nylon membranes (Amersham). The blot was probed with full-length OPN 32P labeled by random priming with Klenow fragment (New England Biolabs). The blot was hybridized overnight, washed and placed on a PhosphorImager cassette, and quantified using ImageQuant software (Molecular Dynamics).

Antibodies and Western blotting. Bradford protein assays were carried out on cell extracts to ensure that equal amounts of proteins were loaded. PN116 anti-T antibody used in Western blots has been described previously (40). MT blotting was carried out as described previously (40). The anti-OPN antibody was obtained from R&D Systems. For OPN blotting, serum-free supernatant was collected from the various cell lines and was electrophoresed on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels under nonreducing conditions. The resulting nitrocellulose blot was probed with the anti-OPN antibody and visualized with the ECL enhanced chemiluminescence reagent. Recombinant OPN produced in mouse cells as a positive control for blotting was obtained from R&D Systems.

Growth curves. Cells were plated at a density of 2.5 x 104 per well in 12-well plates. At the indicated time points, cells were washed with phosphate-buffered saline, fixed in 10% formaldehyde, and rinsed with distilled water. Cells were then stained with 0.2% crystal violet (Sigma) for 30 min, washed with distilled water, and dried. Cell-associated dye was extracted with 1 ml of 10% acetic acid, and the optical density at 590 nm (OD590) was measured. Values were normalized to the OD at day 0 for each of the cell types. Each point was determined in triplicate.

Chemokinesis/wound healing assay. BALB/c MT cell lines were starved for 24 h prior to the assay in serum-free media. Transwell (Corning) 8-µm-pore-size filters were coated with fibronectin (10 µg/ml) on both sides. A total of 5 x 104 cells per filter were added to the upper chamber, and serum-free medium was added to the bottom chamber. After 6 h, the number of cells per optical field on the lower side of the membrane was counted.

For in vitro wound healing assays, the cells were plated at 3 x 105 per 100-mm dish. After 2 days, the cells were placed under serum-free conditions and were disrupted by scratching with a Gilson Pipet-man equipped with a 1,000-µl tip. Repopulation of the cell-free area was examined under an inverted microscope after 16 h. In this time frame under serum-free conditions, cell division is negligible.


arrow
RESULTS
 
MT activates the expression of OPN. To examine the acute effects of MT on cells, lines were created that expressed MT conditionally. MT cDNA was first cloned into the pBIG Tet-off regulatory vector. Mouse 3T3 cell lines were then isolated after transfection with the MT vector. Figure 1A shows that the expression of MT was regulated by the presence of doxycycline. Microarray analysis was done using RNA collected from cells grown in the presence of doxycycline (–MT) or in the absence of doxycycline (+MT). Of abundant RNAs, the OPN gene was the gene most affected, with expression increasing eightfold when MT was expressed (data not shown). This result led to more detailed analysis. RNA prepared from control and MT-expressing cells was subjected to Northern blot analysis utilizing full-length radiolabeled OPN as a probe. Figure 1B shows that the level of OPN mRNA is up-regulated in the presence of MT.


Figure 1
View larger version (33K):
[in this window]
[in a new window]

 
FIG. 1. Expression of MT induces expression of OPN. (A) Tet-off MT cell lines were grown in the presence (+) or absence (–) of doxycycline (Dox) and harvested 48 h later. MT was immunoprecipitated and subjected to in vitro protein kinase assay (top), or cell extracts of equal amounts of protein determined by Bradford analysis were run on SDS-PAGE and blotted using anti-T antibody PN116. (B) Northern blotting was done with total RNA from Tet-off regulated MT-expressing cells in the presence (+) or absence (–) of doxycycline. Equal amounts of RNA were loaded by assessment of the levels of 28S and 18S RNA present (not shown). The blot was probed for OPN (indicated by the arrow).

We then extended the RNA analysis to the level of protein expression. OPN is a secreted protein. By examining the tissue culture medium, it was clear that the expression of OPN protein was induced when the expression of MT was induced (Fig. 2A). To further connect the activation of OPN to MT and tumorigenesis, extracts from four tumor-derived cell lines from polyomavirus-infected mice were tested (Fig. 2B). Three of the four tumors (a mammary tumor, an osteosarcoma, and a hemangiosarcoma) were OPN positive. The fourth, a lung tumor, was OPN negative. Lung tumors are not typically a part of the polyoma tumor spectrum (21), and blotting for T antigens was negative. We therefore consider this tumor to be of spontaneous origin.


Figure 2
View larger version (42K):
[in this window]
[in a new window]

 
FIG. 2. Tet-off regulated MT-expressing MEF cells show specific expression of OPN in the absence of doxycycline. (A) Mouse embryonic fibroblast cells expressing MT under the control of doxycycline (Dox) were placed into serum-free medium containing doxycycline (+) or no doxycycline (–) 24 h prior to harvesting. (Top) Cell supernatant was collected and run on a nondenaturing SDS-PAGE gel and blotted with anti-OPN antibody. Recombinant (REC) OPN produced in mouse cells was run as a control. (Bottom) Cell extracts were blotted with anti-T antibody PN116. (B) Tumor cell lines obtained from different tissues were placed into serum-free medium 24 h prior to harvesting. Supernatant was collected and run on a nondenaturing SDS-PAGE gel and blotted with anti-OPN antibody. Lanes: 1, 3T3 cells; 2, 3T3 cells transformed with MT; 3, hemangioma; 4, bone; 5; lung; and 6, breast.

OPN up-regulation contributes to the MT phenotype. In order to determine the effect of OPN expression on MT-expressing cells, A31 BALB/c MT cells were infected with antisense OPN or a control vector. After selection in puromycin, the cells were examined for OPN expression. Antisense OPN RNA reduced the level of OPN protein dramatically (Fig. 3A), consistent with previous reports that have shown antisense RNA to be highly effective in reducing the levels of OPN protein (76, 105). The growth rates of the doubly transduced cell lines were tested by plating cells in triplicate into 12-well plates. Within 1 day, MT-expressing A31 cells had a significantly (P < 0.05) increased growth rate compared to control A31 cells. However, the presence of the empty vector control or antisense OPN vector did not affect the growth rate (Fig. 3B). This result indicated that the ability to induce OPN did not contribute significantly to the growth advantage of the MT cells.


Figure 3
View larger version (41K):
[in this window]
[in a new window]

 
FIG. 3. Expression of antisense OPN RNA significantly reduces the expression of OPN produced from MT cells but does not affect the growth properties of the cells. (A) Controls or cell lines expressing control or antisense OPN constructs were placed into serum-free medium 24 h prior to harvesting. Cell extracts were run on SDS-PAGE and blotted using anti-OPN or anti-T PN116 monoclonal antibody. (B) MT induces cell growth independently of OPN. A total of 2.5 x 104 cells were plated per 12-well dish, and cell numbers per well were determined using the staining protocol described in Materials and Methods. Each data point represents the mean ± standard deviation of three measurements. A31 (solid line); MT, MT-expressing cells (solid diamonds); MT + V, MT plus vector controls (solid triangles); MT + AS-OPN, MT + antisense OPN (solid squares).

Previous reports have suggested a connection between OPN expression and metastatic potential of MT-transformed breast cells (47). Such a connection is not unexpected, since OPN is an important factor in tumor dissemination and in increasing the malignant phenotype of cells (22). One aspect of this phenotype is cell migration. A quantitative analysis of cell motility (chemokinesis) was performed using Transwell chambers. The Transwell filters were coated with fibronectin, 5 x104 cells were placed in the upper chamber, and serum-free medium was placed in the lower chamber. After 6 h, the numbers of cells per optical field on the lower side of the filter were counted. As shown in Fig. 4A, MT-transformed cells migrate at an increased rate compared to A31 controls. The MT cells containing OPN antisense had a migratory phenotype similar to that of the A31 control cell lines, whereas expression of the control vector had no effect on migration. The contribution of OPN to migratory activity was also shown in an in vitro wound healing assay. Monolayers of cells in serum-free medium were disrupted by scratching, a common method to assess the potential for directed migration. Repopulation of the cell-free area was examined under an inverted scope. MT A31 or vector controls could be shown to migrate into the open area after 16 h (Fig. 4B), but again the OPN antisense-containing MT cells behaved like the controls. Both of these assays suggest a pivotal role for OPN in the migratory phenotype of MT-expressing cells.


Figure 4
View larger version (73K):
[in this window]
[in a new window]

 
FIG. 4. Mobility of MT cells is dependent upon OPN. (A) Transwell chambers were coated on both sides with fibronectin, a total of 5 x 104 cells were placed in the upper chamber, and serum-free medium was placed in the lower chamber. After 6 h, the numbers of cells per optical field on the lower side of the membrane were counted. The data represent three independent samples per cell line. Cell lines used: A31, A31 BALB/c cells; WT MT, A31 BALB/c cells stably expressing MT; WT MT + V, A31 BALB/c cells stably expressing MT along with control vector; WT MT + AS, A31 BALB/c cells stably expressing MT along with antisense OPN. (B) Cells were plated at 3 x 105 per 100-mm dish. After 2 days, the cells were placed under serum-free conditions and the monolayer was disrupted with a pipette tip. Repopulation of the cell-free area was examined under an inverted microscope.

MT activation of OPN transcription is dependent upon two PEA3 sites within the OPN promoter. Increases in OPN protein followed from increases in OPN RNA, suggesting that the effect of MT was at the level of transcription. To investigate the transcriptional effect, a series of reporter assays were carried out. In transient transfection experiments, wild-type MT activated a promoter construct containing sequences to –740 approximately fivefold (Fig. 5B). This increase is similar to that seen in the Northern blot experiments, suggesting that the MT effect is largely transcriptional. The OPN promoter contains a substantial number of transcription factor binding sites and regulatory targets (Fig. 5A). In order to narrow down the region within the OPN promoter responsive to MT, we used OPN-luc reporter constructs containing various truncations. Mutant analysis indicated that the region between –258 and –88 contains the response elements primarily responsible for MT activation (Fig. 5B). Within this region, there are PEA3 sites. PEA3 belongs to the Ets family of transcription factors (reviewed in reference 25), and MT is known to activate PEA3 sites (94). The core binding sequence of Ets transcription factors is 5'-GGA(A/T)-3'. Mutants were constructed to inactivate the two proximal PEA3 sites by mutating the GGA to GAA. Examination of these mutants showed that the loss of a single PEA3 site had little effect on MT-dependent promoter activation (data not shown). However, mutation of both PEA3 sites caused a significant reduction in MT-induced activation (Fig. 5C). Although the arrangement of PEA3 sites in the rat OPN promoter is very different, multiple PEA3 sites had to be mutated there, too, to see an effect on activity (31). It is not surprising that MT activation of the OPN promoter occurs through the PEA3 sites, since the polyoma proteins have been previously shown to activate the transcription of the PEA3 transcription factors. It is also worth noting that in the original gene chip analysis, MT increased the level of PEA3 mRNA (not shown).


Figure 5
View larger version (17K):
[in this window]
[in a new window]

 
FIG. 5. Reporter assays with OPN promoter constructs. (A) Schematic representation of the OPN promoter and the various deletion constructs. Many of the transcription factor binding sites are indicated (6, 30, 32, 36, 54, 56, 67, 80, 87, 91). (B, upper panel) NIH 3T3 cells were transiently transfected with wild-type MT (MT) or vector control (C) along with luciferase (luc) reporter constructs under the control of fragments of the OPN promoter. The lengths of the OPN promoter truncation mutants tested were –740 to +79, –472 to +79, –258 to +79, and –88 to +79. Luciferase activity is expressed in relative units and normalized to 1 for the control. Cells were harvested approximately 48 h posttransfection and assayed for luciferase activity. (Lower panel) Aliquots of the extract were run on SDS-PAGE and blotted with anti-T monoclonal antibody PN116 to confirm protein expression. (C, upper panel) NIH 3T3 cells were transiently transfected with wild-type MT (MT) or vector control (C) along with luciferase (luc) reporter constructs of 2-luc (–258 to +79) and PEA-2X (–258 to +79) mutated at the two PEA3 sites within this region. (Lower panel) Aliquots of the extract were run on SDS-PAGE and blotted with anti-T monoclonal antibody PN116 to confirm protein expression.

MT activation of the OPN promoter depends on the PI3K and SHC binding sites. Genetic analysis was used to determine which MT signaling pathways were responsible for activation of the OPN promoter. Single point mutations in MT at either the SHC (248L) or PI3K (Y315YAA or 315FAA) binding sites had only a modest effect on expression from the OPN promoter (Fig. 6A). However, a double mutant in both PI3K and SHC binding sites reduced activity significantly. This observation suggests that the expression of the OPN gene is dependent upon contributions from both the SHC and PI3K signaling pathways. The dependence upon either the PI3K or SHC MT signaling pathways has been seen for the ability of MT to promote continued cell cycle progression (60). It has also been observed for cellular gene activation in the case of the urokinase plasminogen activator (uPA) gene (84). To confirm the reporter assay results, A31 cell lines expressing various MT mutants were examined for OPN expression. Figure 6B shows that mutations that affected both the SHC and PI3K binding sites abolished activation. Single mutations at residue 248 or 315 had less effect. The single mutation at the PLC-{gamma}1 binding site at 322 had the smallest effect on expression. There were differences in the mobilities of the OPN that presumably reflect differences in glycosylation of the protein in the distinct cell lines (50). Their significance requires further investigation.


Figure 6
View larger version (48K):
[in this window]
[in a new window]

 
FIG. 6. MT regulates OPN expression through the PI3K and SHC pathways. (A) NIH 3T3 cells were transiently transfected with the OPN-luc construct and the MT constructs indicated. 315YAA and 315FAA are PI3K, while 248L is SHC. Approximately 40 h posttransfection, cells were harvested and lysed and luciferase activity was measured. CON, control. (B) MT-expressing cell lines were placed under serum-starved conditions, and the medium was collected 24 h poststarvation for OPN analysis by Western blotting. Lane 1, A31 control cells; lane 2, 248L MT (SHC); lane 3, 250 MT (SHC and PI3K); lane 4, 315F MT (PI3K); lane 5, 322 MT (PLC-{gamma}); lane 6, 250/322 MT; lane 7, 250/315/322 MT; and lane 8, wild-type MT.

The contribution of PI3K is especially interesting, because one difference between low-metastasizing and highly metastatic cells in the Jessen study (47) was mutation of MT at the PI3K site at Y315 and Y322. We therefore further explored which branches of the PI3K pathway are responsible for the activation. The MT protein activates both Akt and Rac1 through stimulation of PI3K (59, 85). We first confirmed the role of PI3K in the activation of the OPN gene by using a construct for constitutively activated PI3K, the 110-CAAX protein, in OPN reporter assays. The 110-CAAX construct was capable of inducing modest activation of the OPN-luc promoter (Fig. 7A). We then evaluated the effects of the PI3K downstream targets Rac and Akt. Cotransfection of the activated RacV12 construct resulted in a fivefold activation of the OPN-luc reporter (Fig. 7B). On the other hand, transfection with Akt had no effect. These data indicate that the Rac1 branch of the PI3K pathway, but not the Akt branch, is primarily responsible for the activation of the OPN gene.


Figure 7
View larger version (12K):
[in this window]
[in a new window]

 
FIG. 7. The activated form of PI3K (110-CAAX) and the activated form of Rac (Act Rac) are capable of activating the OPN promoter. CON, control. NIH 3T3 cells were transiently cotransfected with the –258 OPN-luc reporter and the indicated plasmids. Five hours posttransfection, the cells were placed into starvation medium, and 48 h posttransfection, the cells were harvested and lysed and luciferase activity was measured. 110-CAAX is a constitutively active form of PI3K (A). RACV12 (Act Rac) is a constitutively active form of RAC. AKT is an expression construct for Akt kinase (B).


arrow
DISCUSSION
 
Initial array analysis focused attention on the connection between MT and OPN. MT activates the expression of OPN at the level of transcription, leading to secretion of the protein into the medium. This occurs as an acute, immediate response to the introduction of MT. To do this, MT primarily targets PEA3 sites in the OPN promoter. Both SHC and PI3K signals emanating from MT contribute to OPN activation.

Although the resulting expression of OPN did not affect the growth rate of the transformed cells, it makes an important contribution to their ability to migrate. Antisense OPN RNA introduced into MT-expressing cells had no effect on the increased growth phenotype. This suggests that MT enhances the growth rate of cells independently of its ability to activate OPN expression. These observations are consistent with previous reports, in which the migratory potential of breast cancer cells was directly related to the expression of OPN (47). The lack of a connection between growth and OPN activation has been seen in other contexts. Akt enhances the growth rate of cells independently of OPN (105). MT, of course, is known to promote cell growth and activate the AKT enzyme through the PI3K signaling pathway (20, 59, 60).

Activation through PEA3 sites is an example of a virus simultaneously using a signaling system directly for its own expression and to affect host cell gene expression. PEA3/Ets sites have long been known to be important for the function on the polyoma enhancer (12, 58) and are involved in transcriptional regulation (92, 102). They are also important for viral DNA replication (13, 66).

PEA3/Ets sites are cellular targets for transcriptional regulation as well—over 400 cellular target genes have been identified (73). A number of these genes are known to be involved in tumor progression, including proteases such as matrix metalloproteases MMP-1, MMP-3, and MMP-9 (71), which are known to be essential for extracellular matrix degradation, a key event in tumor cell invasion. There is also previous evidence linking these transcription factors to OPN expression in a variety of contexts. For the mouse, ETS1 and ETS2 proteins bind directly to the OPN promoter and have the ability to activate gene expression (88). Ets-2 expression in that system was connected to OPN expression upon osteoblast differentiation. In skeletal muscle tissue, PEBP (polyoma enhancer-binding protein) and ETS1 protein were able to bind to and synergistically activate the OPN promoter (67). In the rat, where the arrangement of PEA3 sites on the OPN promoter is rather different, PEA3 is nonetheless important for OPN expression (31). The same authors examined human breast cancer lines and showed a correlation between expression of OPN and expression of PEA3 and Ets-1.

The Ets transcription factor family is quite large, with 26 members in mice (37). Many of these members are important in cancer (37, 73). Ets-1 is a well-studied proto-oncogene that can transform NIH 3T3 cells in vitro (72). The parathyroid-related protein, PTHrP (26, 61), is a potent angiogenic factor (1) that is also responsive to Ets-1. PTHrP is also an important factor in promoting metastasis of breast cancer cells to the bone by induction of bone degradation (101). Our gene arrays do not indicate that MT induces changes in RNA levels for Ets-1, Ets-2, or Elk-1. There is an increase in PEA3 (not shown). The PEA3 proteins were originally named because of their ability to bind to the sites in the polyoma enhancer; cloning identified PEA3 itself (98). Expression of dominant-negative PEA3 or a PEA3 knockout has a strong effect on tumorigenesis (53, 74).

MT uses both its connection to SHC and connection to PI3K to activate the OPN promoter. The requirement for both pathways is reminiscent of the effect of MT on uPA (84). MT does seem to upregulate PEA3 RNA levels (not shown), but it is likely that the promoter regulation seen here is also a result of modifications. The Ets family is regulated by phosphorylation (103), acetylation (19), and sumoylation (48). For example, Ets-1 is positively regulated via phosphorylation by extracellular-signal-related kinase (ERK) at threonine 38 (16, 64, 93, 99). This site is termed the Ras-responsive phosphorylation site because the activation of Ras leads to the activation of ERK1/2 and in turn to phosphorylation of the Ets-1 protein. (70). Interestingly, the activation of mitogen-activated protein kinases by cytokines can also be blocked by PI3K inhibitors or by dominant-negative Rac (3). MT binding to PI3K (84) as well as SHC (28, 57) leads to the activation of the mitogen-activated protein kinase pathway, although the activation is not particularly robust. In light of the ability of SHC to activate OPN seen here, it may be surprising that a low-metastasis MT breast cell line (Db) (47), which contains a PI3K and PLC-{gamma}1 mutant MT but is expected to activate SHC, did not produce OPN. The lack of OPN production may well be due to differences in regulation in different cell types. It is known, for example, that the site at amino acid 250 that binds SHC is dispensable for transformation in human mammary cells (86), but not in A3l cells. An alternative possibility that cannot be excluded is that the adaptation of cells to culture results in changes in signaling patterns.

It is clear both from previous work and that reported here that OPN makes an important contribution to the MT phenotype. It is required for MT transformants to migrate or fill in a wound. These are two properties that would be expected to be important for metastasis. Indeed, the work of Jessen and colleagues (47) shows that it is. We could not confirm this requirement, because preliminary experiments with our cells did not show significant metastasis before the animals had to be sacrificed because of the size of the primary tumors. Finally, it is also important to remember that overexpression of OPN was not sufficient in their work to cause metastasis. Determination of the other targets of MT signaling remains an important task.


arrow
ACKNOWLEDGMENTS
 
This study was supported by grants from the NIH (PO1-CA50661 to B.S.S., RO1-CA34722 to B.S.S., and RO1-CA-90992 to T.L.B.) and a Department of Defense breast cancer grant (DAMD17-02-0510 to G.F.W.).

We thank David Denhardt for supplying the OPN reporter constructs.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biochemistry, Tufts University School of Medicine, 136 Harrison Avenue, Boston, MA 02111. Phone: (617) 636-6868. Fax: (617) 636-2409. E-mail: brian.schaffhausen{at}tufts.edu Back

{triangledown} Published ahead of print on 12 March 2008. Back

{dagger} Present address: Wyeth Pharmaceuticals, Cambridge MA 02140. Back


arrow
REFERENCES
 
    1
  1. Akino, K., A. Ohtsuru, K. Kanda, A. Yasuda, T. Yamamoto, Y. Akino, S. Naito, M. Kurokawa, N. Iwahori, and S. Yamashita. 2000. Parathyroid hormone-related peptide is a potent tumor angiogenic factor. Endocrinology 141:4313-4316.[Abstract/Free Full Text]
  2. 2
  3. Andrews, D. W., J. Gupta, and G. Abisdris. 1993. Evidence that the middle T antigen of polyomavirus interacts with the membrane skeleton. Mol. Cell. Biol. 13:4703-4713.[Abstract/Free Full Text]
  4. 3
  5. Arai, A., E. Kanda, and O. Miura. 2002. Rac is activated by erythropoietin or interleukin-3 and is involved in activation of the Erk signaling pathway. Oncogene 21:2641-2651.[CrossRef][Medline]
  6. 4
  7. Ashkar, S., G. F. Weber, V. Panoutsakopoulou, M. E. Sanchirico, M. Jansson, S. Zawaideh, S. R. Rittling, D. T. Denhardt, M. J. Glimcher, and H. Cantor. 2000. Eta-1 (osteopontin): an early component of type-1 (cell-mediated) immunity. Science 287:860-864.[Abstract/Free Full Text]
  8. 5
  9. Bautch, V. L., S. Toda, J. A. Hassell, and D. Hanahan. 1987. Endothelial cell tumors develop in transgenic mice carrying polyoma virus middle T oncogene. Cell 51:529-537.[CrossRef][Medline]
  10. 6
  11. Bidder, M., J. S. Shao, N. Charlton-Kachigian, A. P. Loewy, C. F. Semenkovich, and D. A. Towler. 2002. Osteopontin transcription in aortic vascular smooth muscle cells is controlled by glucose-regulated upstream stimulatory factor and activator protein-1 activities. J. Biol. Chem. 277:44485-44496.[Abstract/Free Full Text]
  12. 7
  13. Bronson, R., C. Dawe, J. Carroll, and T. Benjamin. 1997. Tumor induction by a transformation-defective polyoma virus mutant blocked in signaling through Shc. Proc. Natl. Acad. Sci. USA 94:7954-7958.[Abstract/Free Full Text]
  14. 8
  15. Campbell, K. S., E. Ogris, B. Burke, W. Su, K. R. Auger, B. J. Druker, B. S. Schaffhausen, T. M. Roberts, and D. C. Pallas. 1994. Polyoma middle T antigen interacts with SHC via the NPTY (Asn-Pro-Thr-Tyr) motif in middle T. Proc. Natl. Acad. Sci. USA 91:6344-6348.[Abstract/Free Full Text]
  16. 9
  17. Carmichael, G., B. Schaffhausen, D. Dorsky, D. Oliver, and T. Benjamin. 1982. The role of the carboxy terminus of middle T antigen of polyoma virus. Proc. Natl. Acad. Sci. USA 79:3579-3583.[Abstract/Free Full Text]
  18. 10
  19. Carmichael, G., B. S. Schaffhausen, G. Mandel, T. J. Liang, and T. L. Benjamin. 1984. Transformation by polyoma virus is drastically reduced by substitution of phenylalanine for tyrosine at residue 315 of middle-sized tumor antigen. Proc. Natl. Acad. Sci. USA 81:679-683.[Abstract/Free Full Text]
  20. 11
  21. Chen, C. A., and H. Okayama. 1988. Calcium phosphate-mediated gene transfer: a highly efficient transfection system for stably transforming cells with plasmid DNA. BioTechniques 6:632-637.[Medline]
  22. 12
  23. Chen, L., X. Wang, and M. M. Fluck. 2006. Independent contributions of polyomavirus middle T and small T to the regulation of early and late gene expression and DNA replication. J. Virol. 80:7295-7307.[Abstract/Free Full Text]
  24. 13
  25. Chen, M. C., D. Redenius, F. Osati-Ashtiani, and M. M. Fluck. 1995. Enhancer-mediated role for polyomavirus middle T/small T in DNA replication. J. Virol. 69:326-333.[Abstract]
  26. 14
  27. Chen, Y., and S. R. Rittling. 2003. Novel murine mammary epithelial cell lines that form osteolytic bone metastases: effect of strain background on tumor homing. Clin. Exp. Metastasis 20:111-120.[CrossRef][Medline]
  28. 15
  29. Cheng, S. H., R. Harvey, P. C. Espino, K. Semba, T. Yamamoto, K. Toyoshima, and A. E. Smith. 1988. Peptide antibodies to the human c-fyn gene product demonstrate pp59c-fyn is capable of complex formation with the middle-T antigen of polyomavirus. EMBO J. 7:3845-3855.[Medline]
  30. 16
  31. Coffer, P., M. de Jonge, A. Mettouchi, B. Binetruy, J. Ghysdael, and W. Kruijer. 1994. junB promoter regulation: Ras mediated transactivation by c-Ets-1 and c-Ets-2. Oncogene 9:911-921.[Medline]
  32. 17
  33. Courtneidge, S., and A. E. Smith. 1983. Polyoma virus transforming protein associates with the product of the c-src cellular gene. Nature 303:435-439.[CrossRef][Medline]
  34. 18
  35. Culleré, X., P. Rose, U. Thathamangalam, A. Chatterjee, K. P. Mullane, D. C. Pallas, T. L. Benjamin, T. M. Roberts, and B. S. Schaffhausen. 1998. Serine 257 phosphorylation regulates association of polyomavirus middle T antigen with 14-3-3 proteins. J. Virol. 72:558-565.[Abstract/Free Full Text]
  36. 19
  37. Czuwara-Ladykowska, J., V. I. Sementchenko, D. K. Watson, and M. Trojanowska. 2002. Ets1 is an effector of the transforming growth factor beta (TGF-beta) signaling pathway and an antagonist of the profibrotic effects of TGF-beta. J. Biol. Chem. 277:20399-20408.[Abstract/Free Full Text]
  38. 20
  39. Dahl, J., A. Jurczak, L. A. Cheng, D. C. Baker, and T. L. Benjamin. 1998. Evidence of a role for phosphatidylinositol 3-kinase activation in the blocking of apoptosis by polyomavirus middle T antigen. J. Virol. 72:3221-3226.[Abstract/Free Full Text]
  40. 21
  41. Dawe, C. J., R. Freund, G. Mandel, K. Ballmer-Hofer, D. A. Talmage, and T. L. Benjamin. 1987. Variations in polyoma virus genotype in relation to tumor induction in mice. Characterization of wild type strains with widely differing tumor profiles. Am. J. Pathol. 127:243-261.[Abstract]
  42. 22
  43. Denhardt, D. T., and X. Guo. 1993. Osteopontin: a protein with diverse functions. FASEB J. 7:1475-1482.[Abstract]
  44. 23
  45. Denhardt, D. T., C. A. Lopez, E. E. Rollo, S. M. Hwang, X. R. An, and S. E. Walther. 1995. Osteopontin-induced modifications of cellular functions. Ann. N. Y. Acad. Sci. 760:127-142.[Medline]
  46. 24
  47. Dilworth, S. M., C. E. Brewster, M. D. Jones, L. Lanfrancone, G. Pelicci, and P. G. Pelicci. 1994. Transformation by polyoma virus middle T-antigen involves the binding and tyrosine phosphorylation of Shc. Nature 367:87-90.[CrossRef][Medline]
  48. 25
  49. Dittmer, J. 2003. The biology of the Ets1 proto-oncogene. Mol. Cancer 2:29.[CrossRef][Medline]
  50. 26
  51. Dittmer, J., S. D. Gitlin, R. L. Reid, and J. N. Brady. 1993. Transactivation of the P2 promoter of parathyroid hormone-related protein by human T-cell lymphotropic virus type I Tax1: evidence for the involvement of transcription factor Ets1. J. Virol. 67:6087-6095.[Abstract/Free Full Text]
  52. 27
  53. Druker, B. J., L. E. Ling, B. Cohen, T. M. Roberts, and B. S. Schaffhausen. 1990. A completely transformation-defective point mutant of polyomavirus middle T antigen which retains full associated phosphatidylinositol kinase activity. J. Virol. 64:4454-4461.[Abstract/Free Full Text]
  54. 28
  55. Druker, B. J., L. Sibert, and T. M. Roberts. 1992. Polyomavirus middle T-antigen NPTY mutants. J. Virol. 66:5770-5776.[Abstract/Free Full Text]
  56. 29
  57. Eddy, B. 1969. Polyoma virus. Virol. Monogr. 7:1-114.
  58. 30
  59. El-Tanani, M., R. Barraclough, M. C. Wilkinson, and P. S. Rudland. 2001. Metastasis-inducing DNA regulates the expression of the osteopontin gene by binding the transcription factor Tcf-4. Cancer Res. 61:5619-5629.[Abstract/Free Full Text]
  60. 31
  61. El-Tanani, M., A. Platt-Higgins, P. S. Rudland, and F. C. Campbell. 2004. Ets gene PEA3 cooperates with beta-catenin-Lef-1 and c-Jun in regulation of osteopontin transcription. J. Biol. Chem. 279:20794-20806.[Abstract/Free Full Text]
  62. 32
  63. El-Tanani, M. K., R. Barraclough, M. C. Wilkinson, and P. S. Rudland. 2001. Regulatory region of metastasis-inducing DNA is the binding site for T cell factor-4. Oncogene 20:1793-1797.[CrossRef][Medline]
  64. 33
  65. Fluck, M. M., and S. Z. Haslam. 1996. Mammary tumors induced by polyomavirus. Breast Cancer Res. Treat. 39:45-56.[CrossRef][Medline]
  66. 34
  67. Freund, R., C. J. Dawe, J. P. Carroll, and T. L. Benjamin. 1992. Changes in frequency, morphology, and behavior of tumors induced in mice by a polyoma virus mutant with a specifically altered oncogene. Am. J. Pathol. 141:1409-1425.[Abstract]
  68. 35
  69. Freund, R., A. Sotnikov, R. T. Bronson, and T. L. Benjamin. 1992. Polyoma virus middle T is essential for virus replication and persistence as well as for tumor induction in mice. Virology 191:716-723.[CrossRef][Medline]
  70. 36
  71. Guo, X., Y. P. Zhang, D. A. Mitchell, D. T. Denhardt, and A. F. Chambers. 1995. Identification of a ras-activated enhancer in the mouse osteopontin promoter and its interaction with a putative ETS-related transcription factor whose activity correlates with the metastatic potential of the cell. Mol. Cell. Biol. 15:476-487.[Abstract]
  72. 37
  73. Gutierrez-Hartmann, A., D. L. Duval, and A. P. Bradford. 2007. ETS transcription factors in endocrine systems. Trends Endocrinol. Metab. 18:150-158.[CrossRef][Medline]
  74. 38
  75. Guy, C. T., R. D. Cardiff, and W. J. Muller. 1992. Induction of mammary tumors by expression of polyomavirus middle T oncogene: a transgenic mouse model for metastatic disease. Mol. Cell. Biol. 12:954-961.[Abstract/Free Full Text]
  76. 39
  77. Harvey, R., B. A. Oostra, G. J. Belsham, P. Gillett, and A. E. Smith. 1984. An antibody to a synthetic peptide recognizes polyomavirus middle-T antigen and reveals multiple in vitro tyrosine phosphorylation sites. Mol. Cell. Biol. 4:1334-1342.[Abstract/Free Full Text]
  78. 40
  79. Holman, P. S., O. V. Gjoerup, T. Davin, and B. S. Schaffhausen. 1994. Characterization of an immortalizing N-terminal domain of polyomavirus large T antigen. J. Virol. 68:668-673.[Abstract/Free Full Text]
  80. 41
  81. Hong, Y. K., A. Mikami, B. Schaffhausen, T. Jun, and T. M. Roberts. 2003. A new class of mutations reveals a novel function for the original phosphatidylinositol 3-kinase binding site. Proc. Natl. Acad. Sci. USA 100:9434-9439.[Abstract/Free Full Text]
  82. 42
  83. Horak, I. D., T. Kawakami, F. Gregory, K. C. Robbins, and J. B. Bolen. 1989. Association of p60fyn with middle tumor antigen in murine polyomavirus-transformed rat cells. J. Virol. 63:2343-2347.[Abstract/Free Full Text]
  84. 43
  85. Hu, Q., A. Klippel, A. J. Muslin, W. J. Fantl, and L. T. Williams. 1995. Ras-dependent induction of cellular responses by constitutively active phosphatidylinositol-3 kinase. Science 268:100-102.[Abstract/Free Full Text]
  86. 44
  87. Hunter, T., M. A. Hutchinson, and W. Eckhart. 1984. Polyoma middle-T antigen can be phosphorylated on tyrosine at multiple sites in vitro. EMBO J. 3:73-80.[Medline]
  88. 45
  89. Hwang, S. M., C. A. Lopez, D. E. Heck, C. R. Gardner, D. L. Laskin, J. D. Laskin, and D. T. Denhardt. 1994. Osteopontin inhibits induction of nitric oxide synthase gene expression by inflammatory mediators in mouse kidney epithelial cells. J. Biol. Chem. 269:711-715.[Abstract/Free Full Text]
  90. 46
  91. Ito, Y. 1979. Polyoma virus-specific 55K protein isolated from plasma membrane of productively infected cells is virus-coded and important for cell transformation. Virology 98:261-266.[CrossRef][Medline]
  92. 47
  93. Jessen, K. A., S. Y. Liu, C. G. Tepper, J. Karrim, E. T. McGoldrick, A. Rosner, R. J. Munn, L. J. Young, A. D. Borowsky, R. D. Cardiff, and J. P. Gregg. 2004. Molecular analysis of metastasis in a polyomavirus middle T mouse model: the role of osteopontin. Breast Cancer Res. 6:R157-R169.[CrossRef][Medline]
  94. 48
  95. Ji, Z., C. Degerny, N. Vintonenko, J. Deheuninck, B. Foveau, C. Leroy, J. Coll, D. Tulasne, J. L. Baert, and V. Fafeur. 2007. Regulation of the Ets-1 transcription factor by sumoylation and ubiquitinylation. Oncogene 26:395-406.[CrossRef][Medline]
  96. 49
  97. Kaplan, D. R., M. Whitman, B. Schaffhausen, L. Raptis, R. L. Garcea, D. Pallas, T. M. Roberts, and L. Cantley. 1986. Phosphatidylinositol metabolism and polyoma-mediated transformation. Proc. Natl. Acad. Sci. USA 83:3624-3628.[Abstract/Free Full Text]
  98. 50
  99. Kazanecki, C. C., D. J. Uzwiak, and D. T. Denhardt. 2007. Control of osteopontin signaling and function by post-translational phosphorylation and protein folding. J. Cell. Biochem. 102:912-924.[CrossRef][Medline]
  100. 51
  101. Klucky, B., B. Koch, M. Radolf, P. Steinlein, and E. Wintersberger. 2004. Polyomavirus tumorantigens have a profound effect on gene expression in mouse fibroblasts. Oncogene 23:4707-4721.[CrossRef][Medline]
  102. 52
  103. Kornbluth, S., M. Sudol, and H. Hanafusa. 1987. Association of the polyomavirus middle-T antigen with c-yes protein. Nature 325:171-173.[CrossRef][Medline]
  104. 53
  105. Kurpios, N. A., N. A. Sabolic, T. G. Shepherd, G. M. Fidalgo, and J. A. Hassell. 2003. Function of PEA3 Ets transcription factors in mammary gland development and oncogenesis. J. Mammary Gland Biol. Neoplasia 8:177-190.[CrossRef][Medline]
  106. 54
  107. Lammi, J., J. Huppunen, and P. Aarnisalo. 2004. Regulation of the osteopontin gene by the orphan nuclear receptor NURR1 in osteoblasts. Mol. Endocrinol. 18:1546-1557.[Abstract/Free Full Text]
  108. 55
  109. Lewis, B. C., D. S. Klimstra, and H. E. Varmus. 2003. The c-myc and PyMT oncogenes induce different tumor types in a somatic mouse model for pancreatic cancer. Genes Dev. 17:3127-3138.[Abstract/Free Full Text]
  110. 56
  111. Malyankar, U. M., R. Hanson, S. M. Schwartz, A. L. Ridall, and C. M. Giachelli. 1999. Upstream stimulatory factor 1 regulates osteopontin expression in smooth muscle cells. Exp. Cell Res. 250:535-547.[CrossRef][Medline]
  112. 57
  113. Markland, W., B. A. Oostra, R. Harvey, A. F. Markham, W. H. Colledge, and A. E. Smith. 1986. Site-directed mutagenesis of polyomavirus middle-T antigen sequences encoding tyrosine 315 and tyrosine 250. J. Virol. 59:384-391.[Abstract/Free Full Text]
  114. 58
  115. Martin, M., J. Piette, M. Yaniv, W. Tang, and W. Folk. 1988. Activation of the polyomavirus enhancer by a murine activator protein1 (AP1) homolog and two contiguous proteins. Proc. Natl. Acad. Sci. USA 85:5839-5843.[Abstract/Free Full Text]
  116. 59
  117. Meili, R., P. Cron, B. Hemmings, and K. Ballmer-Hofer. 1998. Protein kinase B/Akt is activated by polyomavirus middle-T antigen via a phosphatidylinositol 3-kinase-dependent mechanism. Oncogene 16:903-907.[CrossRef][Medline]
  118. 60
  119. Mullane, K. P., M. Ratnofsky, X. Culleré, and B. Schaffhausen. 1998. Signaling from polyomavirus middle T and small T defines different roles for protein phosphatase 2A. Mol. Cell. Biol. 18:7556-7564.[Abstract/Free Full Text]
  120. 61
  121. Naito, S., K. Shimizu, M. Nakashima, T. Nakayama, T. Ito, M. Ito, S. Yamashita, and I. Sekine. 2000. Overexpression of Ets-1 transcription factor in angiosarcoma of the skin. Pathol. Res. Pract. 196:103-109.[Medline]
  122. 62
  123. Oates, A. J., R. Barraclough, and P. S. Rudland. 1996. The identification of osteopontin as a metastasis-related gene product in a rodent mammary tumour model. Oncogene 13:97-104.[Medline]
  124. 63
  125. Pallas, D. C., L. K. Shahrik, B. L. Martin, S. Jaspers, T. B. Miller, D. L. Brautigan, and T. M. Roberts. 1990. Polyoma small and middle T antigens and SV40 small t antigen form stable complexes with protein phosphatase 2A. Cell 60:167-176.[CrossRef][Medline]
  126. 64
  127. Paumelle, R., D. Tulasne, Z. Kherrouche, S. Plaza, C. Leroy, S. Reveneau, B. Vandenbunder, V. Fafeur, and D. Tulashe. 2002. Hepatocyte growth factor/scatter factor activates the ETS1 transcription factor by a RAS-RAF-MEK-ERK signaling pathway. Oncogene 21:2309-2319.[CrossRef][Medline]
  128. 65
  129. Rittling, S. R., and A. F. Chambers. 2004. Role of osteopontin in tumour progression. Br. J. Cancer 90:1877-1881.[CrossRef][Medline]
  130. 66
  131. Rochford, R., C. T. Davis, K. K. Yoshimoto, and L. P. Villarreal. 1990. Minimal subenhancer requirements for high-level polyomavirus DNA replication: a cell-specific synergy of PEA3 and PEA1 sites. Mol. Cell. Biol. 10:4996-5001.[Abstract/Free Full Text]
  132. 67
  133. Sato, M., E. Morii, T. Komori, H. Kawahata, M. Sugimoto, K. Terai, H. Shimizu, T. Yasui, H. Ogihara, N. Yasui, T. Ochi, Y. Kitamura, Y. Ito, and S. Nomura. 1998. Transcriptional regulation of osteopontin gene in vivo by PEBP2alphaA/CBFA1 and ETS1 in the skeletal tissues. Oncogene 17:1517-1525.[CrossRef][Medline]
  134. 68
  135. Schaffhausen, B., and T. L. Benjamin. 1981. Comparison of phosphorylation of two polyoma virus middle T antigens in vivo and in vitro. J. Virol. 40:184-196.[Abstract/Free Full Text]
  136. 69
  137. Schaffhausen, B. S., H. Dorai, G. Arakere, and T. L. Benjamin. 1982. Polyoma virus middle T antigen: relationship to cell membranes and apparent lack of ATP-binding activity. Mol. Cell. Biol. 2:1187-1198.[Abstract/Free Full Text]
  138. 70
  139. Seidel, J. J., and B. J. Graves. 2002. An ERK2 docking site in the Pointed domain distinguishes a subset of ETS transcription factors. Genes Dev. 16:127-137.[Abstract/Free Full Text]
  140. 71
  141. Sementchenko, V. I., and D. K. Watson. 2000. Ets target genes: past, present and future. Oncogene 19:6533-6548.[CrossRef][Medline]
  142. 72
  143. Seth, A., and T. S. Papas. 1990. The c-ets-1 proto-oncogene has oncogenic activity and is positively autoregulated. Oncogene 5:1761-1767.[Medline]
  144. 73
  145. Seth, A., and D. K. Watson. 2005. ETS transcription factors and their emerging roles in human cancer. Eur. J. Cancer 41:2462-2478.[Medline]
  146. 74
  147. Shepherd, T. G., L. Kockeritz, M. R. Szrajber, W. J. Muller, and J. A. Hassell. 2001. The pea3 subfamily ets genes are required for HER2/Neu-mediated mammary oncogenesis. Curr. Biol. 11:1739-1748.[CrossRef][Medline]
  148. 75
  149. Silver, J., B. Schaffhausen, and T. Benjamin. 1978. Tumor antigens induced by nontransforming mutants of polyoma virus. Cell 15:485-496.[CrossRef][Medline]
  150. 76
  151. Su, L., A. B. Mukherjee, and B. B. Mukherjee. 1995. Expression of antisense osteopontin RNA inhibits tumor promoter-induced neoplastic transformation of mouse JB6 epidermal cells. Oncogene 10:2163-2169.[Medline]
  152. 77
  153. Su, W., W. Liu, B. Schaffhausen, and T. Roberts. 1995. Association of polyomavirus middle tumor antigen with phospholipase C-gamma 1. J. Biol. Chem. 270:12331-12335.[Abstract/Free Full Text]
  154. 78
  155. Tehranian, A., D. W. Morris, B. H. Min, D. J. Bird, R. D. Cardiff, and P. A. Barry. 1996. Neoplastic transformation of prostatic and urogenital epithelium by the polyoma virus middle T gene. Am. J. Pathol. 149:1177-1191.[Abstract]
  156. 79
  157. Templeton, D., and W. Eckhart. 1982. Mutation causing premature termination of the polyoma virus middle T antigen blocks cell transformation. J. Virol. 41:1014-1024.[Abstract/Free Full Text]
  158. 80
  159. Tezuka, K., D. T. Denhardt, G. A. Rodan, and S. Harada. 1996. Stimulation of mouse osteopontin promoter by v-Src is mediated by a CCAAT box-binding factor. J. Biol. Chem. 271:22713-22717.[Abstract/Free Full Text]
  160. 81
  161. Treisman, R., U. Novak, J. Favaloro, and R. Kamen. 1981. Transformation of rat cells by an altered polyoma virus genome expressing only the middle T protein. Nature 292:595-600.[CrossRef][Medline]
  162. 82
  163. Tuck, A. B., D. M. Arsenault, F. P. O'Malley, C. Hota, M. C. Ling, S. M. Wilson, and A. F. Chambers. 1999. Osteopontin induces increased invasiveness and plasminogen activator expression of human mammary epithelial cells. Oncogene 18:4237-4246.[CrossRef][Medline]
  164. 83
  165. Tuck, A. B., B. E. Elliott, C. Hota, E. Tremblay, and A. F. Chambers. 2000. Osteopontin-induced, integrin-dependent migration of human mammary epithelial cells involves activation of the hepatocyte growth factor receptor (Met). J. Cell. Biochem. 78:465-475.[CrossRef][Medline]
  166. 84
  167. Urich, M., M. Y. el Shemerly, D. Besser, Y. Nagamine, and K. Ballmer-Hofer. 1995. Activation and nuclear translocation of mitogen-activated protein kinases by polyomavirus middle-T or serum depend on phosphatidylinositol 3-kinase. J. Biol. Chem. 270:29286-29292.[Abstract/Free Full Text]
  168. 85
  169. Urich, M., M. Senften, P. E. Shaw, and K. Ballmer-Hofer. 1997. A role for the small GTPase Rac in polyomavirus middle-T antigen-mediated activation of the serum response element and in cell transformation. Oncogene 14:1235-1241.[CrossRef][Medline]
  170. 86
  171. Utermark, T., B. S. Schaffhausen, T. M. Roberts, and J. J. Zhao. 2007. The p110{alpha} isoform of phosphatidylinositol 3-kinase is essential for polyomavirus middle T antigen-mediated transformation. J. Virol. 81:7069-7076.[Abstract/Free Full Text]
  172. 87
  173. Vanacker, J. M., C. Delmarre, X. Guo, and V. Laudet. 1998. Activation of the osteopontin promoter by the orphan nuclear receptor estrogen receptor related alpha. Cell Growth Differ. 9:1007-1014.[Abstract]
  174. 88
  175. Vary, C. P., V. Li, A. Raouf, R. Kitching, I. Kola, C. Franceschi, M. Venanzoni, and A. Seth. 2000. Involvement of Ets transcription factors and targets in osteoblast differentiation and matrix mineralization. Exp. Cell Res. 257:213-222.[CrossRef][Medline]
  176. 89
  177. Wai, P. Y., and P. C. Kuo. 2004. The role of Osteopontin in tumor metastasis. J. Surg. Res. 121:228-241.[CrossRef][Medline]
  178. 90
  179. Walter, G., R. Ruediger, C. Slaughter, and M. Mumby. 1990. Association of protein phosphatase 2A with polyoma virus medium tumor antigen. Proc. Natl. Acad. Sci. USA 87:2521-2525.[Abstract/Free Full Text]
  180. 91
  181. Wang, D., S. Yamamoto, N. Hijiya, E. N. Benveniste, and C. L. Gladson. 2000. Transcriptional regulation of the human osteopontin promoter: functional analysis and DNA-protein interactions. Oncogene 19:5801-5809.[CrossRef][Medline]
  182. 92
  183. Wasylyk, B., C. Wasylyk, P. Flores, A. Begue, D. Leprince, and D. Stehelin. 1990. The c-ets proto-oncogenes encode transcription factors that cooperate with c-Fos and c-Jun for transcriptional activation. Nature 346:191-193.[CrossRef][Medline]
  184. 93
  185. Wasylyk, C., A. P. Bradford, A. Gutierrez-Hartmann, and B. Wasylyk. 1997. Conserved mechanisms of Ras regulation of evolutionary related transcription factors, Ets1 and Pointed P2. Oncogene 14:899-913.[CrossRef][Medline]
  186. 94
  187. Wasylyk, C., P. Flores, A. Gutman, and B. Wasylyk. 1989. PEA3 is a nuclear target for transcription activation by non-nuclear oncogenes. EMBO J. 8:3371-3378.[Medline]
  188. 95
  189. Weber, G. F., B. Adler, and S. Ashkar. 1999. Osteopontin in oxidative stress responses, p. 97-112. In R. R. Ruffolo, Jr., G. Z. Feuerstein, A. J. Hunter, G. Poste, and B. W. Metcalf (ed.), Inflammatory cells and mediators in CNS diseases. Harwood Academic Publishers, Amsterdam, The Netherlands.
  190. 96
  191. Webster, M. A., J. N. Hutchinson, M. J. Rauh, S. K. Muthuswamy, M. Anton, C. G. Tortorice, R. D. Cardiff, F. L. Graham, J. A. Hassell, and W. J. Muller. 1998. Requirement for both Shc and phosphatidylinositol 3' kinase signaling pathways in polyomavirus middle T-mediated mammary tumorigenesis. Mol. Cell. Biol. 18:2344-2359.[Abstract/Free Full Text]
  192. 97
  193. Whitman, M., D. R. Kaplan, B. Schaffhausen, L. Cantley, and T. M. Roberts. 1985. Association of phosphatidylinositol kinase activity with polyoma middle-T competent for transformation. Nature 315:239-242.[CrossRef][Medline]
  194. 98
  195. Xin, J. H., A. Cowie, P. Lachance, and J. A. Hassell. 1992. Molecular cloning and characterization of PEA3, a new member of the Ets oncogene family that is differentially expressed in mouse embryonic cells. Genes Dev. 6:481-496.[Abstract/Free Full Text]
  196. 99
  197. Yang, B.-S., C. A. Hauser, G. Henkel, M. S. Colman, C. Van Beveren, K. J. Stacey, D. A. Hume, R. A. Maki, and M. C. Ostrowski. 1996. Ras-mediated phosphorylation of a conserved threonine residue enhances the transactivation activities of c-Ets1 and c-Ets2. Mol. Cell. Biol. 16:538-547.[Abstract]
  198. 100
  199. Yi, X., J. Peterson, and R. Freund. 1997. Transformation and tumorigenic properties of a mutant polyomavirus containing a middle T antigen defective in Shc binding. J. Virol. 71:6279-6286.[Abstract]
  200. 101
  201. Yin, J. J., K. Selander, J. M. Chirgwin, M. Dallas, B. G. Grubbs, R. Wieser, J. Massague, G. R. Mundy, and T. A. Guise. 1999. TGF-beta signaling blockade inhibits PTHrP secretion by breast cancer cells and bone metastases development. J. Clin. Investig. 103:197-206.[Medline]
  202. 102
  203. Yoo, W., M. E. Martin, and W. R. Folk. 1991. PEA1 and PEA3 enhancer elements are primary components of the polyomavirus late transcription initiator element. J. Virol. 65:5391-5400.[Abstract/Free Full Text]
  204. 103
  205. Yordy, J. S., and R. C. Muise-Helmericks. 2000. Signal transduction and the Ets family of transcription factors. Oncogene 19:6503-6513.[CrossRef][Medline]
  206. 104
  207. Yoshida, T., and D. Hanahan. 1994. Murine pancreatic ductal adenocarcinoma produced by in vitro transduction of polyoma middle T oncogene into the islets of Langerhans. Am. J. Pathol. 145:671-684.[Abstract]
  208. 105
  209. Zhang, G., B. He, and G. F. Weber. 2003. Growth factor signaling induces metastasis genes in transformed cells: molecular connection between Akt kinase and osteopontin in breast cancer. Mol. Cell. Biol. 23:6507-6519.[Abstract/Free Full Text]


Journal of Virology, May 2008, p. 4946-4954, Vol. 82, No. 10
0022-538X/08/$08.00+0     doi:10.1128/JVI.02650-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Fluck, M. M., Schaffhausen, B. S. (2009). Lessons in Signaling and Tumorigenesis from Polyomavirus Middle T Antigen. Microbiol. Mol. Biol. Rev. 73: 542-563 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Whalen, K. A.
Right arrow Articles by Schaffhausen, B. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Whalen, K. A.
Right arrow Articles by Schaffhausen, B. S.