JVI Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
JVI.02558-06v1
81/9/4900    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Terzian, C.
Right arrow Articles by Vartanian, J.-P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Terzian, C.
Right arrow Articles by Vartanian, J.-P.

 Previous Article  |  Next Article 

Journal of Virology, May 2007, p. 4900-4903, Vol. 81, No. 9
0022-538X/07/$08.00+0     doi:10.1128/JVI.02558-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Induction of Mutations in Drosophila melanogaster gypsy Retroelements by Modulation of Intracellular Deoxynucleoside Triphosphate Pools In Vivo{triangledown}

Christophe Terzian,1,{dagger} Michel Henry,2 Andreas Meyerhans,3 Simon Wain-Hobson,2 and Jean-Pierre Vartanian2*

Institut de Génétique Humaine—CNRS, 141, rue de la Cardonille, F-34396 Montpellier Cedex 5, France,1 Unité de Rétrovirologie Moléculaire, CNRS URA 3015, Institut Pasteur, 28 rue du Dr. Roux, F-75724 Paris cedex 15, France,2 Department of Virology, Institute of Medical Microbiology, University of the Saarland, D-66421 Homburg/Saar, Saarbrücken, Germany3

Received 20 November 2006/ Accepted 5 February 2007


    ABSTRACT
 Top
 ABSTRACT
 TEXT
 REFERENCES
 
The retroviral mutation rate is susceptible to a number of variables, including the balance between intracellular deoxynucleoside triphosphate (dNTP) pools. While this follows from tissue culture studies, the issue has never been addressed directly in vivo. To explore this question in a tractable experimental system, we analyzed the impact of thymidine treatment on the synthesis of gypsy retroelement cDNA from Drosophila melanogaster during development through to hatching. The mutation frequency was enhanced approximately 16-fold over the levels seen in the experimental background. Due to the lack of proofreading, these gypsy elements represent hypervariable loci within the Drosophila genome, suggesting that dNTP pool imbalances in vivo are mutagenic.


    TEXT
 Top
 ABSTRACT
 TEXT
 REFERENCES
 
Intracellular deoxynucleoside triphosphate (dNTP) pool imbalances during replication are generally mutagenic in vitro (8, 9, 16, 17, 18, 29). The allosteric enzyme ribonucleotide reductase ensures a pool of deoxynucleoside diphosphates that are further phosphorylated to yield dNTPs, dUTP being subsequently degraded by dUTPase (21, 25). Although the synthesis of dTTP is independent of the presence of ribonucleotide reductase, it has a negative effect on CDP reduction by this enzyme and results in a detectably lower intracellular concentration of dCTP (2, 21, 25). Thymidine (Thd) is therefore efficient at influencing dNTP pools, as it not only increases the dTTP concentration but also decreases the concentration of dCTP. Furthermore, the enhanced imbalance in the [dTTP]/[dCTP] ratio is conducive to the formation of Gtemplate:T pairs, the most stable of all mismatches (5, 20).

The replication of some viruses is susceptible to modulation by thymidine and hydroxyurea, both of which impinge on dNTP synthesis (19, 28). In the case of retroviruses, treatment by thymidine would result in rG:dT mismatches that go uncorrected because, like that of all RNA viruses, cDNA synthesis occurs in the absence of proofreading (3, 13, 14, 19, 31). Hence, retroelements represent hypersensitive loci.

The Drosophila melanogaster gypsy endogenous retrovirus has three large open reading frames (ORFs) bounded by two long terminal repeats (12, 15, 26). Despite being an endogenous element, gypsy is infectious (6, 30). The flamenco (flam) locus, located on the X chromosome, is a major regulator of gypsy (24). In restrictive strains, functional flam alleles maintain gypsy proviruses in a repressed state. By contrast, in permissive strains, e.g., the MG strain, proviral amplification results from infection of the female germ line and subsequent insertions into the chromosomes of the progeny (23).

We found that the addition of 1 mM thymidine to standard Drosophila medium inhibited egg laying. To overcome this problem, between 300 and 500 D. melanogaster MG permissive strain eggs were placed on standard medium (4) and allowed to hatch and grow to adults (Fig. 1A). The medium was supplemented with 1 mM Thd, 1 mM Thd-1 mM deoxycytidine (dCyd)-200 µM tetrahydrouridine (THU), or 1 mM dCyd-200 µM THU. dCyd was added to counter the depletion of dCTP resulting from Thd treatment. THU was used to protect against spontaneous deamination of dCyd by deoxycytidine deaminases.


Figure 1
View larger version (31K):
[in this window]
[in a new window]

 
FIG. 1. Experimental procedures and modulation of D. melanogaster egg viability by modulation of DNA precursor metabolites. (A) MG embryos were raised on standard Drosophila medium with or without drugs. Transposed proviral gypsy copies were then analyzed in the progeny of MG females. Thd and 2'-dCyd were purchased from Sigma, and THU was purchased from Calbiochem. (B) Restricting D. melanogaster egg-to-adult viability by treatment with 1 mM Thd as well as reversing the effect by addition of 1 mM dCyd (plus 200 µM THU). Data are expressed as the percentage of young adult numbers divided by initial egg number relative to control (no drug) egg-to-adult viability. Bars represent 95% confidence intervals.

 
In the presence of 1 mM Thd, 75% of the eggs did not hatch (Fig. 1B). The remaining 25% became young flies, albeit requiring more development time than the nontreated eggs (data not shown). The viability of eggs treated with 1 mM dCyd-200 µM THU was significantly higher than that of eggs placed on medium supplemented with 1 mM Thd. Eggs placed on medium supplemented with 1 mM Thd-1 mM dCyd-200 µM THU were slightly less viable than the eggs in the control group (Fig. 1B). These data show that intracellular dCTP depletion following Thd addition can be substantially abrogated by the addition of dCyd.

It was previously shown that mobilization of gypsy in the progeny of MG females correlates with higher levels of full-length gypsy RNA in the ovaries (23). It is at this stage that reverse transcription and dNTP incorporation occur. As gypsy cDNA synthesis and transposition occurs in MG female germ cells, genomic DNA extraction and PCR were done on F1 adults resulting from individual crosses between the MG females (treated and untreated) and OR(P) males, which are devoid of active gypsy proviruses (1). As a result, all F1 progeny harbored MG-derived gypsy elements in all cells (Fig. 1A). In order to detect de novo-synthesized gypsy cDNA, a genetic screening was set up based on Escherichia coli ß-galactosidase complementation (31). Given the thymidine treatment protocol, uncorrected rG:dT mismatches should show up as G->A transitions. A small locus bearing tryptophan codons was amplified from the gypsy ORF1 (Fig. 2A). As tryptophan is encoded by the single codon TGG, accumulation of G->A transitions yields one of three stop codons (TGA, TAG, or TAA). When cloning in frame into the ß-galactosidase gene is performed, mutants are scored as white plaques and wild-type sequences as blue plaques.


Figure 2
View larger version (29K):
[in this window]
[in a new window]

 
FIG. 2. A tryptophan codon trap for gypsy G->A transitions in vivo. A) Sequence of the 60 bp tryptophan trap in gypsy retroelement ORF1. The 25 bp insert between primers MC1 and MC2 encodes two tryptophan codons (larger type). B) Trap sequences corresponding to white M13mp18 plaques from total DNA from two mature flies for each treatment. Flies are numbered D1 through D8. Sequence differences are indicated; dots indicate identity, while dashes indicate deletions. Plaque frequencies are shown to the right of the sequences. Four clones representing two distinct sequences harbored G->A transitions outside of the two tryptophan codons. To be sure that they did not represent some sort of false-negative white clones, their insertions were reamplified using the MC1-MC2 primer pair, re-cloned, and resequenced. Both yielded a clear white phenotype, while sequencing confirmed the initial sequence (data not shown).

 
Total DNA was extracted from two 3-day-old F1 females per regimen. As many deleted gypsy elements are present in the genome of D. melanogaster (10), a first-round PCR of nearly full-length elements was performed using primers JF1 (5'CAACCAACAATCTGAACCCACCAAT; positions 489 to 513, accession number M12927) and JF2 (5'TGGCTGCTTGCTTAGTGTTTTCCTT; positions 6691 to 6667). Nested PCR was performed with primers MC1 (5'GCGGAATTCTTACGCCTGTTGAGGCAA; positions 1644 to 1661) and MC2 (5'GCGAAGCTTACCTACCACTAATGCAA; positions 1687 to 1703). Standard PCR conditions and Pfu polymerase were used. The amplified products were cloned in frame using the lacZ {alpha} fragment of M13mp18 via EcoRI and HindIII (sites underlined). E. coli XL1-Blue was transformed and plated on 8% X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside) plus IPTG (isopropyl-ß-D-thiogalactopyranoside) indicator plates. DNAs from white plaques were purified and sequenced by a previously published method (31).

An average of 1,200 colonies were obtained from each DNA sample. For the progeny of untreated strain MG mothers (flies D1 and D2) as well as those from MG mothers treated using dCyd plus THU (flies D5 and D6), a single white plaque was found which reflected a single point mutation in a tryptophan codon (Fig. 2B). This meant that the mean background mutant and mutation frequencies were ~3.5 x 10–4 and ~1.4 x 10–5, respectively, which are not statistically different (P = 0.55; Fisher's exact test). By contrast, for both flies from MG mothers that were grown on the 1 mM Thd regimen (flies D3 and D4), a small number of white clones were identified (mean frequency, ~6.5 x 10–3). All but two clones harbored single G->A transitions, as would be expected if dTTP were incorporated opposite rG during minus-strand DNA synthesis. The mean point mutation frequency of 2.2 x 10–4 is approximately 16-fold greater than that seen with the untreated controls (P = 0.0002; Fisher's exact test). It is noteworthy that no mutants or mutations were detected for flies treated with the regimen of Thd plus dCyd plus THU (flies D7 and D8; Fig. 2B), indicating that dCyd was able to counter the mutagenic effects of Thd.

In reports going back more than 30 years it was found that the administration of thymidine to culture medium of D. melanogaster resulted in discernible traits, most notably cuts in the wing margins and wing-vein abnormalities (22). However, mutagenic effects at the nuclear level were not reported. It is probable that some mutations arising from dNTP pool imbalances must occur in chromosomal DNA and escape mismatch repair. Following Thd treatment, the gypsy mutation rate was increased 16-fold to ~2.2 x 10–4/base/cycle. It may be supposed that the treatment increased the germ line mutation rate. In keeping with this is the observation that a large fraction of eggs died on 1 mM thymidine-supplemented medium. Accordingly, it is anticipated that submillimolar concentrations of Thd will also prove to be mutagenic.

It is interesting to transpose these findings to the setting of the mammalian cell, for which there are far more data. A recurrent observation is the bias towards GC->AT transitions in comparisons of mutated cancer-associated genes or deleterious alleles to "wild-type" alleles and of pseudogenes to their cognate genes (7, 11). While a proportion of these results must be attributed to deamination of methylated deoxycytidine in the context of CpG, there remains an excess GC->AT bias even when CpG motifs are accounted for (27). The present work suggests that increases in the intracellular dTTP levels may be a viable mechanism in vivo underlying a fraction of GC->AT transitions. In conclusion, D. melanogaster gypsy elements represent a tractable model for investigation of the relationship between small molecules, dNTP pool imbalances, and mutation in vivo.


    ACKNOWLEDGMENTS
 
This work was supported by grants from the Pasteur Institute and the CNRS.

We thank Alain Bucheton (IGH, Montpellier) for help and advice.


    FOOTNOTES
 
* Corresponding author. Mailing address: Unité de Rétrovirologie Moléculaire, CNRS URA 3015, Institut Pasteur, 28 rue du Dr. Roux, F-75724 Paris cedex 15, France. Phone: 33 1 44 38 94 45. Fax: 33 1 45 68 88 74. E-mail: jpvart{at}pasteur.fr Back

{triangledown} Published ahead of print on 14 February 2007. Back

{dagger} Present address: EPHE, UMR754-Université Lyon 1, 50 avenue Tony Garnier, F69366 Lyon Cedex 07, France. Back


    REFERENCES
 Top
 ABSTRACT
 TEXT
 REFERENCES
 

  1. Chalvet, F., L. Teysset, C. Terzian, N. Prud'homme, P. Santamaria, A. Bucheton, and A. Pélisson. 1999. Proviral amplification of the Gypsy endogenous retrovirus of Drosophila melanogaster involves env-independent invasion of the female germline. EMBO J. 18:2659-2669.[CrossRef][Medline]
  2. Dahbo, Y., and S. Eriksson. 1985. On the mechanism of deoxyribonucleoside toxicity in human T-lymphoblastoid cells. Reversal of growth inhibition by addition of cytidine. Eur. J. Biochem. 150:429-434.[Medline]
  3. Drake, J. W., B. Charlesworth, D. Charlesworth, and J. F. Crow. 1998. Rates of spontaneous mutation. Genetics 148:1667-1686.[Abstract/Free Full Text]
  4. Gans, M., C. Audit, and M. Masson. 1975. Isolation and characterization of sex-linked female-sterile mutants in Drosophila melanogaster. Genetics 81:683-704.[Abstract/Free Full Text]
  5. Iyer, R. R., A. Pluciennik, V. Burdett, and P. L. Modrich. 2006. DNA mismatch repair: functions and mechanisms. Chem.Rev. 06:02-323.
  6. Kim, A., C. Terzian, P. Santamaria, A. Pélisson, N. Prud'homme, and A. Bucheton. 1994. Retroviruses in invertebrates: the gypsy retrotransposon is apparently an infectious retrovirus of Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 91:1285-1289.[Abstract/Free Full Text]
  7. Krawczak, M., B. Smith-Sorensen, J. Schmidtke, V. V. Kakkar, D. N. Cooper, and E. Hovig. 1995. Somatic spectrum of cancer-associated single basepair substitutions in the TP53 gene is determined mainly by endogenous mechanisms of mutation and by selection. Hum. Mutat. 5:48-57.[CrossRef][Medline]
  8. Kresnak, M. T., and R. L. Davidson. 1992. Thymidine-induced mutations in mammalian cells: sequence specificity and implications for mutagenesis in vivo. Proc. Natl. Acad. Sci. USA 89:2829-2833.[Abstract/Free Full Text]
  9. Kunz, B. A., and S. E. Kohalmi. 1991. Modulation of mutagenesis by deoxyribonucleotide levels. Annu. Rev. Genet. 25:339-359.[CrossRef][Medline]
  10. Lambertsson, A., S. Andersson, and T. Johansson. 1989. Cloning and characterization of variable-sized gypsy mobile elements in Drosophila melanogaster. Plasmid 22:22-31.[CrossRef][Medline]
  11. Li, W. H., C. I. Wu, and C. C. Luo. 1984. Nonrandomness of point mutation as reflected in nucleotide substitutions in pseudogenes and its evolutionary implications. J. Mol. Evol. 21:58-71.[CrossRef][Medline]
  12. Malik, H. S., S. Henikoff, and T. H. Eickbush. 2000. Poised for contagion: evolutionary origins of the infectious abilities of invertebrate retroviruses. Genome Res. 10:1307-1318.[Abstract/Free Full Text]
  13. Mansky, L. M., A. E. Krueger, and H. M. Temin. 1995. The bovine leukemia virus encapsidation signal is discontinuous and extends into the 5' end of the gag gene. J. Virol. 69:3282-3289.[Abstract]
  14. Mansky, L. M., and H. M. Temin. 1995. Lower in vivo mutation rate of human immunodeficiency virus type 1 than that predicted from the fidelity of purified reverse transcriptase. J. Virol. 69:5087-5094.[Abstract]
  15. Marlor, R. L., S. M. Parkhurst, and V. G. Corces. 1986. The Drosophila melanogaster gypsy transposable element encodes putative gene products homologous to retroviral proteins. Mol. Cell. Biol. 6:1129-1134.[Abstract/Free Full Text]
  16. Mathews, C. K. 2006. DNA precursor metabolism and genomic stability. FASEB J. 20:1300-1314.[Abstract/Free Full Text]
  17. Mathews, C. K., and J. Ji. 1992. DNA precursor asymmetries, replication fidelity, and variable genome evolution. Bioessays 14:295-301.[CrossRef][Medline]
  18. Meuth, M. 1989. The molecular basis of mutations induced by deoxyribonucleoside triphosphate pool imbalances in mammalian cells. Exp. Cell Res. 181:305-316.[CrossRef][Medline]
  19. Meyerhans, A., J. P. Vartanian, C. Hultgren, U. Plikat, A. Karlsson, L. Wang, S. Eriksson, and S. Wain-Hobson. 1994. Restriction and enhancement of human immunodeficiency virus type 1 replication by modulation of intracellular deoxynucleoside triphosphate pools. J. Virol. 68:535-540.[Abstract/Free Full Text]
  20. Modrich, P. 1987. DNA mismatch correction. Annu. Rev. Biochem. 56:435-466.[CrossRef][Medline]
  21. Nordlund, P., and P. Reichard. 2006. Ribonucleotide reductases. Annu. Rev. Biochem. 75:681-706.[CrossRef][Medline]
  22. Parkash, O. 1971. On the teratogenic effect of thymidine and its suppression by deoxycytidine in Drosophila melanogaster. Experientia 27:1089-1090.[CrossRef][Medline]
  23. Pélisson, A., S. U. Song, N. Prud'homme, P. A. Smith, A. Bucheton, and V. G. Corces. 1994. Gypsy transposition correlates with the production of a retroviral envelope-like protein under the tissue-specific control of the Drosophila flamenco gene. EMBO J. 13:4401-4411.[Medline]
  24. Prud'homme, N., M. Gans, M. Masson, C. Terzian, and A. Bucheton. 1995. Flamenco, a gene controlling the gypsy retrovirus of Drosophila melanogaster. Genetics 139:697-711.[Abstract]
  25. Reichard, P. 1993. From RNA to DNA, why so many ribonucleotide reductases? Science 260:1773-1777.[Abstract/Free Full Text]
  26. Rohrmann, G. F., and P. A. Karplus. 2001. Relatedness of baculovirus and gypsy retrotransposon envelope proteins. BMC Evol. Biol. 1:1.[Medline]
  27. Sjöblom, T., S. Jones, L. D. Wood, D. W. Parsons, J. Lin, T. D. Barber, D. Mandelker, R. J. Leary, J. Ptak, N. Silliman, S. Szabo, P. Buckhaults, C. Farrell, P. Meeh, S. D. Markowitz, J. Willis, D. Dawson, J. K. Willson, A. F. Gazdar, J. Hartigan, L. Wu, C. Liu, G. Parmigiani, B. H. Park, K. E. Bachman, N. Papadopoulos, B. Vogelstein, K. W. Kinzler, and V. E. Velculescu. 2006. The consensus coding sequences of human breast and colorectal cancers. Science 314:268-274.[Abstract/Free Full Text]
  28. Slabaugh, M. B., M. L. Howell, Y. Wang, and C. K. Mathews. 1991. Deoxyadenosine reverses hydroxyurea inhibition of vaccinia virus growth. J. Virol. 65:2290-2298.[Abstract/Free Full Text]
  29. Song, S., Z. F. Pursell, W. C. Copeland, M. J. Longley, T. A. Kunkel, and C. K. Mathews. 2005. DNA precursor asymmetries in mammalian tissue mitochondria and possible contribution to mutagenesis through reduced replication fidelity. Proc. Natl. Acad. Sci. USA 102:4990-4995.[Abstract/Free Full Text]
  30. Song, S. U., T. Gerasimova, M. Kurkulos, J. D. Boeke, and V. G. Corces. 1994. An env-like protein encoded by a Drosophila retroelement: evidence that gypsy is an infectious retrovirus. Genes Dev. 8:2046-2057.[Abstract/Free Full Text]
  31. Vartanian, J. P., U. Plikat, M. Henry, R. Mahieux, L. Guillemot, A. Meyerhans, and S. Wain-Hobson. 1997. HIV genetic variation is directed and restricted by DNA precursor availability. J. Mol. Biol. 270:139-151.[CrossRef][Medline]


Journal of Virology, May 2007, p. 4900-4903, Vol. 81, No. 9
0022-538X/07/$08.00+0     doi:10.1128/JVI.02558-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
JVI.02558-06v1
81/9/4900    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Terzian, C.
Right arrow Articles by Vartanian, J.-P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Terzian, C.
Right arrow Articles by Vartanian, J.-P.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. Mol. Cell. Biol. Microbiol. Mol. Biol. Rev.
Clin. Vaccine Immunol. ALL ASM JOURNALS