This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kelley-Clarke, B.
Right arrow Articles by Kaye, K. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kelley-Clarke, B.
Right arrow Articles by Kaye, K. M.

 Previous Article  |  Next Article 

Journal of Virology, April 2007, p. 4348-4356, Vol. 81, No. 8
0022-538X/07/$08.00+0     doi:10.1128/JVI.01289-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Determination of Kaposi's Sarcoma-Associated Herpesvirus C-Terminal Latency-Associated Nuclear Antigen Residues Mediating Chromosome Association and DNA Binding{triangledown}

Brenna Kelley-Clarke, Mary E. Ballestas,{dagger} Viswanathan Srinivasan, Andrew J. Barbera, Takashi Komatsu,{ddagger} Te-Ana Harris, Mia Kazanjian, and Kenneth M. Kaye*

Channing Laboratory, Departments of Medicine, Brigham and Women's Hospital, Harvard Medical School, 181 Longwood Ave., Boston, Massachusetts 02115

Received 19 June 2006/ Accepted 29 December 2006


arrow
ABSTRACT
 
Kaposi's sarcoma-associated herpesvirus latency-associated nuclear antigen (LANA) tethers viral terminal repeat (TR) DNA to mitotic chromosomes to mediate episome persistence. The 1,162-amino-acid LANA protein contains both N- and C-terminal chromosome attachment regions. The LANA C-terminal domain self-associates to specifically bind TR DNA and mitotic chromosomes. Here, we used alanine scanning substitutions spanning residues 1023 to 1145 to investigate LANA self-association, DNA binding, and C-terminal chromosome association. No residues were essential for LANA oligomerization, as assayed by coimmunoprecipitation experiments, consistent with redundant roles for amino acids in self-association. Different subsets of amino acids were important for DNA binding, as assayed by electrophoretic mobility shift assay, and mitotic chromosome association, indicating that distinct C-terminal LANA subdomains effect DNA and chromosome binding. The DNA binding domains of LANA and EBNA1 are predicted to be structurally homologous; certain LANA residues important for DNA binding correspond to those with roles in EBNA1 DNA binding, providing genetic support for at least partial structural homology. In contrast to the essential role of N-terminal LANA chromosome targeting residues in DNA replication, deficient C-terminal chromosome association did not reduce LANA-mediated DNA replication.


arrow
TEXT
 
Kaposi's sarcoma-associated herpesvirus (KSHV), or human herpesvirus 8, is a gammaherpesvirus associated with Kaposi's sarcoma, multicentric Castleman's disease, and primary effusion lymphoma (10, 11, 17, 18). KSHV infection is predominantly latent, and the virus persists in the nuclei of latently infected cells as a multiple-copy, covalently closed, extrachromosomal episome (16).

The KSHV latency-associated nuclear antigen (LANA) mediates the replication and episome persistence of DNA containing the KSHV terminal repeat (TR) sequence (2, 13, 24, 27, 29, 39, 54). LANA tethers episomes to mitotic chromosomes to efficiently segregate KSHV DNA to progeny nuclei. A similar tethering mechanism is used by the EBNA1 and E2 proteins to mediate the persistence of Epstein-Barr virus and papillomavirus episomes, respectively (6, 30, 31, 36, 44, 52, 53).

C-terminal LANA specifically binds a 20-bp sequence within TR DNA with high affinity. C-terminal LANA oligomerizes to bind TR DNA, and the oligomerization is critical for DNA binding (3, 14, 24, 25, 33, 39, 43). In the absence of TR DNA binding, LANA cannot mediate DNA replication or episome persistence.

LANA contains two independent chromosome association regions; one is in the N-terminal region (requiring amino acids 5 to 13) (4, 37, 40, 51), and another is in the C-terminal domain (amino acids 996 to 1139) (32, 34). N-terminal LANA is diffusely distributed across mitotic chromosomes by direct binding to core histones H2A and H2B (5). This N-terminal chromosome binding is required for both replication and persistence of TR DNA (4, 37). C-terminal LANA also binds chromatin (8, 34, 40, 43, 46, 48) and preferentially concentrates to paired dots at pericentromeric and peritelomeric regions of a subset of mitotic chromosomes (32).

Scanning alanine mutagenesis of C-terminal LANA. We investigated LANA C-terminal TR DNA binding, oligomerization, and chromosome association by using alanine scanning substitutions. We previously localized LANA oligomerization, C-terminal chromosome attachment, and DNA binding to amino acids 996 to 1139; within this region, the function of amino acids 1007 to 1021 was determined to be unimportant for self-association and chromosome attachment but essential for DNA binding (32, 33). Thus, amino acids 1023 to 1145 were targeted for alanine substitutions. Predominantly triple-alanine substitutions were used. Alanines were substituted for LANA residues in green fluorescent protein (GFP) fused with LANA 933-1162 (thirty-six mutants) or LANA 982-1162 (four mutants) (Fig. 1A). GFP does not interfere with LANA chromosome association or its ability to mediate episome persistence (4, 5, 47). Alanine substitution mutations in GFP LANA 933-1162 were generated by QuikChange PCR mutagenesis (Stratagene) with the oligonucleotides listed in Table 1. Each mutation was amplified with the indicated forward (F) and reverse (R) primer pair, with GFP LANA 933-1162 as the template. Alanine substitutions of 1044KDGRRD1049, 1050PKCQWK1055, 1058VI1059, and 1060FW1061 were generated in GFP LANA 982-1162 by an alternate method of PCR mutagenesis; for each, the reverse primer (Table 1) was used with EF primer ATCTCGCGAATACCGCTATGTACTCAG and the forward primer (Table 1) was used with EE primer ACAGATATCTTATGTCATTTCCTG to amplify initial PCR products from the full-length LANA sequence. These products were combined for a second round of PCR with the EE and EF oligonucleotides. The subsequent PCR product was cloned into GFP NLS, which contains the enhanced GFP fused to a nuclear localization signal (NLS) in EGFP-C1 (Clontech) (30). All PCR-generated clones were confirmed by sequencing. In each mutant, the indicated residues are mutated to alanines (Table 2). For instance, GFP LANA 933-1162 1023QID1025 has LANA residues 1023QID1025 replaced with alanines. Native alanine residues were left unchanged.


Figure 1
View larger version (63K):
[in this window]
[in a new window]

  		FIG. 1. Identification of amino acids critical for C-terminal LANA chromosome binding. (A) LANA contains an N-terminal chromosome binding region (shaded), NLSs (*), a central acidic and glutamine-rich repeat region, a putative leucine zipper (LZ), and a C-terminal domain. C-terminal residues 996 to 1139 mediate TR DNA binding, chromosome association, and LANA self-association. Alanine substitution mutagenesis targeted short stretches of amino acids (primarily triplets) from residues 1023 to 1145. (B) GFP fusion proteins (green) were expressed in BJAB cells. Confocal microscopy was performed following arrest in metaphase with Colcemid and counterstaining of the DNA (red) with propidium iodide (overlay of green and red generates yellow). GFP NLS, GFP; GFP LANA 933-1162, LANA 933-1162; GFP LANA 933-1162 1062GND1064; GFP LANA 933-1162 1065PYG1067; GFP LANA 933-1162 1077FGG1079; GFP LANA 982-1162 1060FW1061; GFP LANA 933-1162 1068LKK1070; GFP LANA 933-1162 1119RL1120; GFP LANA 933-1162 1125SHP1127. Magnification, x630.


View this table:
[in this window]
[in a new window]

  		TABLE 1. Oligonucleotides used to generate LANA mutants


View this table:
[in this window]
[in a new window]

  		TABLE 2. Summary of LANA residues critical for TR DNA binding and C-terminal chromosome association

No specific residues are essential for LANA oligomerization. We assayed each mutant for the ability to oligomerize with wild-type LANA in coimmunoprecipitation experiments. Lipofectamine 2000 (Invitrogen) was used to cotransfect COS cells (~4 x 106) with 12 µg of FLAG epitope-tagged LANA (F-LANA) (2) and 8 µg of GFP fused with LANA 933-1162, LANA 982-1162 1060FW1061, LANA 933-1162 1119RL1120, LANA 933-1162 1122WE1123, LANA 933-1162 1116QM1117, or GFP NLS. Approximately 24 h posttransfection, cells were harvested by scraping into lysis buffer (50 mM HEPES [pH 7.2], 250 mM NaCl, 3 mM CaCl2, 7 mM MgSO4, 10% glycerol, 2 mM EDTA, 1% NP-40, 1 mM phenylmethylsulfonyl fluoride, 1 µg/ml leupeptin, 1 µg/ml aprotinin, 0.7 µg/ml pepstatin). Lysed cells were sonicated briefly, and cellular debris was removed by centrifugation. Lysates were precleared with protein G-agarose beads (Invitrogen) and incubated overnight with protein G-agarose beads and anti-GFP serum (generous gift of William Wickner, Dartmouth Medical School). After immune precipitation with anti-GFP antibody, coprecipitating F-LANA was detected with an antibody that detects full-length F-LANA but not GFP LANA 933-1162. As expected, GFP LANA 933-1162 coprecipitated F-LANA (Fig. 2A, lane 4) but GFP NLS did not (Fig. 2A, lane 2). GFP fused to LANA 982-1162 1060FW1061 (Fig. 2A, lane 6), LANA 933-1162 1119RL1120 (Fig. 2A, lane 8), LANA 933-1162 1122WE1123 (Fig. 2A, lane 10), or LANA 933-1162 1116QM1117 (Fig. 2A, lane 12) coprecipitated F-LANA. Similar results were obtained with all other alanine substitution mutants (Table 2), demonstrating that none of the replaced residues was essential for LANA oligomerization; instead, amino acids involved in self-association appear to have redundant functions. Further, the finding that the mutants retained the ability to associate with F-LANA is consistent with preservation of the structural integrity of C-terminal LANA in these mutants.


Figure 2
View larger version (38K):
[in this window]
[in a new window]

  		FIG. 2. Identification of LANA residues critical for DNA binding. (A) GFP fusion proteins with alanine substitution mutations were assayed for the ability to associate with F-LANA in coimmunoprecipitation (Co-IP) experiments after expression in COS cells. After cotransfection of F-LANA with GFP NLS (lanes 1 and 2), GFP LANA 933-1162 (lanes 3 and 4), GFP LANA 933-1162 1060FW1061 (FW; lanes 5 and 6), GFP LANA 933-1162 1119RL1120 (RL; lanes 7 and 8), GFP LANA 933-1162 1122WE1123 (WE; lanes 9 and 10), or GFP LANA 933-1162 1116QM1117 (QM; lanes 11 and 12), immune precipitation with anti-GFP antibody was performed. Proteins were resolved by 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and coprecipitated F-LANA was detected with human anti-LANA antibody. The left lane of each pair (lanes 1, 3, 5, 7, 9, and 11) contains 10% of the input, and the right lane of each pair (lanes 2, 4, 6, 8, 10, and 12) contains immunoprecipitates (IP). Immune precipitations of GFP LANA 933-1162 mutants were confirmed by anti-GFP immunoblotting. (B) LANA alanine substitution mutants were assayed by EMSA for the ability to bind TR DNA. The TR probe was incubated with rabbit reticulocyte lysate (RRL; lane 1) or in vitro-translated F-LANA (lanes 2 to 4 and 16), F-LANA 1026DCP1028 (DCP; lane 5), F-LANA 1062GND1064 (GND; lane 6), F-LANA 1065PYG1067 (PYG; lane 7), F-LANA 1068LKK1070 (LKK; lane 8), F-LANA 1075FQ1076 (FQ; lane 9), F-LANA 1077FGG1079 (FGG; lane10), F-LANA 1080VK1081 (VK; lane 11), F-LANA 1083GPV1085 (GPV; lane 12), F-LANA 1119RL1120 (RL; lane 13), F-LANA 1122WE1123 (WE; lane 14), F-LANA 1125SHP1127 (SHP; lane 15), F-LANA 1128LAG1130 (LAG; lane 17), or F-LANA 1131NLQ1133 (NLQ; lane 18), and an EMSA was performed. Addition of 75-fold excess unlabeled wild-type (lane 3) or mutant (M; lane 4) competitor TR probe is indicated. Arrows indicate specific complexes. Free probe is shown. Results from multiple experiments are summarized in Table 2. (C) Alignment of the C-terminal sequences of LANA and EBNA1 as predicted by 3D-PSSM software (adapted from reference 27). LANA amino acid residues 1023 to 1144 are aligned with EBNA1 residues 474 to 607. Helical (h) and ß-strand (ß) regions of EBNA1 and the corresponding LANA sequences are indicated (27). Color coding indicates residues involved in DNA binding as follows: red, important for DNA binding (mutation of red LANA residues results in ≤10% of LANA DNA binding [Table 2]; deletion of red EBNA1 residues results in loss of DNA binding), as demonstrated by EMSA; green, EBNA1 residues that contact DNA and have been shown to be critical for DNA binding by EMSA; blue, EBNA1 residues that contact DNA but have not been assayed (NT) for roles in DNA binding, with the exception of residue 477K, which has a role in, but is not essential for, DNA binding (7, 9, 12, 15). Large EBNA1 deletions or mutations that abolished dimerization, which is essential for EBNA1 to bind DNA, were not included. Boxed residues in the LANA sequence indicate residues critical for C-terminal chromosome association.

Definition of residues critical for C-terminal LANA chromosome binding. To identify residues critical for C-terminal LANA chromosome association, we assayed C-terminal LANA with alanine substitution mutations for the ability to bind mitotic chromosomes. BJAB (uninfected) B-lymphoma cells were transfected with 30 µg of C-terminal LANA expression vectors in 400 µl of RPMI containing 10% bovine growth serum at 200 V and 960 µF with a Bio-Rad electroporator (2). At 18 to 24 h posttransfection, 0.5 x 106 cells/ml were metaphase arrested with 1 µg/ml Colcemid (Calbiochem). Colcemid-arrested cells were swollen in hypotonic buffer (1% Na citrate, 10 mM CaCl2, 10 mM MgCl2), streaked or cytospun (Thermoshandon) onto slides, and fixed for 10 min in 4% paraformaldehyde (Polysciences). DNA was counterstained with propidium iodide (1 µg/ml; Molecular Probes), and coverslips were applied with aqua-poly mount (Polysciences). Microscopy was performed with a Zeiss Axioskop, PCM2000 hardware, and C-imaging software (Compix, Inc.). As expected, GFP NLS (green) was distributed diffusely throughout the cell and did not associate with chromosomes (red, Fig. 1B). In contrast, GFP LANA 933-1162 (green) was concentrated in paired dots on a subset of mitotic chromosomes (red, overlay generates yellow, Fig. 1B), consistent with previous results (32). Similar to GFP LANA 933-1162, GFP fused with LANA 933-1162 1062GND1064, LANA 933-1162 1065PYG1067, or LANA 933-1162 1077FGG1079 was concentrated in paired dots on a subset of chromosomes, indicating that the mutated residues did not have a role in chromosome association. In addition, 30 other mutants also associated with chromosomes in paired dots similarly to GFP LANA 933-1162 (Table 2). Therefore, a total of 33 out of 40 mutants associated with chromosomes in paired dots similarly to GFP LANA 933-1162, indicating that the replaced residues in these mutants are not critical for C-terminal LANA chromosome attachment (Fig. 1B; Table 2).

The remaining seven alanine substitution mutants, GFP fused to LANA 982-1162 1060FW1061 (Fig. 1B), LANA 933-1162 1068LKK1070 (Fig. 1B), LANA 933-1162 1119RL1120 (Fig. 1B), LANA 933-1162 1125SHP1127 (Fig. 1B), LANA 933-1162 1026DCP1028 (Table 2), LANA 933-1162 1104VYC1106 (Table 2), and LANA 933-1162 1122WE1123 (Table 2), were each severely compromised for chromosome binding. These mutants (green) were distributed both diffusely and in dots. The diffuse localization occurred both on and between chromosomes (red; overlay of green and red generates yellow); this distribution differed somewhat from that of GFP NLS, which exclusively localized to the interchromosome space (Fig. 1B). The dots formed by these mutants were similarly located both on and off chromosomes, and the total number of dots varied from cell to cell. In contrast to the dots formed by GFP LANA 933-1162, those formed by these mutants lacked a defined distribution pattern. Of note, there were isolated examples of paired dots on mitotic chromosomes for the mutants with substitutions at 1060FW1061, 1068LKK1070, and 1104VYC1106, demonstrating that these mutants could very rarely associate with chromosomes similarly to GFP LANA 933-1162. In contrast, C-terminal LANA with substitutions at 1119RL1120, 1125SHP1127, 1026DCP1028, and 1122WE1123 were never observed to associate as paired dots on chromosomes. Compromised chromosome association was not the result of temperature-sensitive mutations, since culture of mutants with substitutions at 1068LKK1070, 1104VYC1106, and 1125SHP1127 at 30°C rather than 37°C did not affect their ability to associate with chromosomes.

The seven mutants with severely compromised chromosome association were detected in mitotic cells approximately 10-fold less frequently than GFP LANA 933-1162 or mutants that associated with chromosomes in a wild-type pattern. Further, the chromosome association-deficient mutants were generally detected only when expressed at high levels (Fig. 1B). The low frequency of detection in mitotic cells, and only when the mutants were expressed at high levels, was similar to the observations with GFP NLS (Fig. 1B), which does not associate with chromosomes. In contrast, among interphase cells, the frequency of GFP fusion protein detection and expression levels were similar between the wild-type pattern and that of chromosome binding-deficient mutants, indicating that the mutants were expressed at similar levels. This observation was further supported by immunoblot analyses demonstrating that the mutants were expressed at levels similar to that of wild-type C-terminal LANA and GFP NLS (Fig. 2A and data not shown). Thus, LANA residues 1026DCP1028, 1060FW1061, 1068LKK1070, 1104VYC1106, 1119RL1120, 1122WE1123, and 1125SHP1127 are critical for C-terminal LANA chromosome binding.

Identification of LANA residues critical for TR DNA binding. We investigated the importance of specific residues for binding to LANA's high-affinity TR binding site. The alanine substitution mutations were each cloned into full-length F-LANA, in vitro translated (TNT reticulocyte lysate system [Promega]), and assayed by electrophoretic mobility shift assay (EMSA) for the ability to bind TR DNA. Similar amounts of F-LANA and F-LANA with alanine substitutions, as determined by Western analysis, were incubated in DNA binding buffer [20 mM Tris (pH 7.5), 10% glycerol, 50 mM KCl, 0.1 mM dithiothreitol, 10 mM MgCl2, 1 mM EDTA, 18 µg/ml poly(dI-dC)] for 15 min with or without excess unlabeled TR or Ti7 oligonucleotide. TR oligonucleotide consists of a 20-nucleotide LANA binding sequence (3); Ti7 differs from TR by a single C->T base transition that abrogates LANA binding (45). Fifty thousand counts per minute of 32P-labeled TR probe was added to each reaction mixture and incubated for 30 min. Bound complexes were resolved in 4% nondenaturing polyacrylamide gels, which were then exposed to Kodak film. Signal intensities of shifted complexes were measured with a Kodak densitometer (Image Station 4000R) and analysis software, and the intensity relative to that of F-LANA was determined (Table 2). As expected (3), F-LANA formed two predominant complexes (Fig. 2B, arrows, lanes 2 and 16) that were competed by incubation with 75-fold excess nonradiolabeled TR DNA (Fig. 2B, lane 3) but not DNA containing a mutated TR sequence (Ti7) (Fig. 2B, lane 4). Unprogrammed reticulocyte lysate did not complex with the TR probe (Fig. 2B, lane 1).

F-LANA mutants containing C-terminal alanine substitutions were investigated for the ability to bind the TR probe. F-LANA 1068LKK1070 (Fig. 2B, lane 8), F-LANA 1077FGG1079 (Fig. 2B, lane 10), F-LANA 1125SHP1127 (Fig. 2B, lane 15), and F-LANA 1131NLQ1133 (Fig. 2B, lane 18) each complexed with the probe at levels similar to that of F-LANA (Fig. 2B, lanes 2 and 16). F-LANA 1075FQ1076 (Fig. 2B, lane 9) and F-LANA 1080VK1081 (Fig. 2B, lane 11) formed complexes at modestly reduced levels compared to F-LANA, while F-LANA 1026DCP1028 (Fig. 2B, lane 5), F-LANA 1062GND1064 (Fig. 2B, lane 6), F-LANA 1065PYG1067 (Fig. 2B, lane 7), F-LANA 1083GPV1085 (Fig. 2B, lane 12), F-LANA 1119RL1120 (Fig. 2B, lane 13), F-LANA 1022WE1023 (Fig. 2B, lane 14), and F-LANA 1128LAG1130 (Fig. 2B, lane 17) were further reduced with no or barely visible complexes. The relative DNA binding compared to that of F-LANA is summarized for each mutant in Table 2. Twenty-five of 40 alanine substitution mutants had modest or no reduction in DNA binding and bound at levels at least 40% of that of F-LANA, while 7 mutants bound at levels 12 to 26% of that of F-LANA. The eight mutants with substitutions at 1026DCP1028 (Fig. 2B, lane 5), 1030K (Table 2), 1065PYG1067 (Fig. 2B, lane 7), 1071LSQ1073 (Table 2), 1086SCL1088 (Table 2), 1098ITY1100 (Table 2), 1104VYC1106 (Table 2), and 1119RL1120 (Fig. 2B, lane 13) were most significantly affected and bound at levels ≤10% of that of F-LANA.

Deficient C-terminal chromosome binding does not reduce LANA-mediated DNA replication. We investigated whether C-terminal chromosome binding has a role in LANA-mediated TR DNA replication. LANA specifically binds to its TR recognition sequence to mediate efficient KSHV DNA replication (24, 27, 29, 33, 39). In addition, LANA residues involved in N-terminal chromosome attachment are required for replication of TR DNA (4, 37). A plasmid containing eight copies of the KSHV TR element (p8TR) (3) was purified from Escherichia coli containing Dam methylase, resulting in DNA susceptible to DpnI digestion since DpnI requires Dam methylation for digestion. Following the transfection of p8TR into mammalian cells (which lack Dam methylase), the presence of DpnI-resistant p8TR digestion indicates that DNA replication occurred.

We cotransfected 2 µg of p8TR and 2 µg of pSG5 (Stratagene), pSG5 expressing F-LANA, LANA 5GMR7 (4), F-LANA 1062GND1064, F-LANA 1065PYG1067, F-LANA 1068LKK1070, F-LANA 1077FGG1079, F-LANA 1116QM1117, or F-LANA 1125SHP1127, into ~106 293 cells in six-well plates with Lipofectamine 2000 (Invitrogen). Approximately 16 h posttransfection, cells were expanded to 10-cm dishes. At 80 h posttransfection, low-molecular-weight DNA was extracted by the Hirt method (28). Ten micrograms of DNA was digested overnight with 30 U of BglII, which linearizes p8TR (Fig. 3, lanes 1 to 10), or 40 µg of DNA was digested overnight with 100 U each of DpnI and BglII (Fig. 3, lanes 11 to 20). Digested DNA was resolved on a 0.8% agarose gel and analyzed by Southern blotting with a 32P-labeled TR probe. As expected, p8TR DNA replicated in the presence (Fig. 3, lane 13), but not in the absence (Fig. 3, lane 12), of F-LANA. F-LANA 1065PYG1067, which is severely compromised for TR DNA binding (4% of LANA binding) (Fig. 2B, lane 7, and Table 2), was highly impaired for the ability to mediate DNA replication (Fig. 3, lane 16), consistent with LANA's requirement to bind TR DNA to mediate replication (33). In contrast, F-LANA 1062GND1064, which bound TR DNA at a reduced level of 26% of LANA binding (Fig. 2B, lane 6) (Table 2), replicated DNA at a level similar to that of F-LANA. It is likely that the lower level of binding, which was assayed by using a single LANA binding site (Fig. 2B, lane 6, and Table 2), is compensated for in the replication assay by F-LANA 1062GND1064 cooperatively binding to the two adjacent LANA binding sites located in each TR (24).


Figure 3
View larger version (36K):
[in this window]
[in a new window]

  		FIG. 3. DNA replication mediated by LANA alanine substitution mutants. 293 cells were cotransfected with p8TR and pSG5 or pSG5 expressing LANA or LANA containing alanine substitutions. After ~80 h, low-molecular-weight DNA was digested with BglII (lanes 1 to 10) or BglII and DpnI (lanes 11 to 20), resolved in a 0.8% agarose gel, blotted onto a nylon membrane, and detected with a TR probe. 293 cell extract, lanes 1 and 11; pSG5, lanes 2 and 12; F-LANA, lanes 3 and 13; F-LANA 5GMR7, lanes 4 and 14; F-LANA 1062GND1064, lanes 5 and 15; F-LANA 1065PYG1067, lanes 6 and 16; F-LANA 1068LKK1070, lanes 7 and 17; F-LANA 1077FGG1079, lanes 8 and 18; F-LANA 1116QM1117, lanes 9 and 19; F-LANA 1125SHP1127, lanes 10 and 20. Immunoblot analyses demonstrated similar expression levels for F-LANA and LANA mutants. The arrow indicates linearized p8TR.

F-LANA 1068LKK1070 and F-LANA 1125SHP1127 are each severely impaired for C-terminal chromosome binding (Fig. 1B) but bind TR DNA similarly to F-LANA (Fig. 2B, lanes 10 and 15) (Table 2). In contrast, other mutants impaired for C-terminal chromosome association were also deficient for TR DNA binding. Since TR DNA binding is required for DNA replication, only F-LANA 1068LKK1070 and F-LANA 1125SHP1127 were assayed for DNA replication. Both of these mutants mediated DNA replication (Fig. 3, lanes 17 and 20) at levels similar to those of F-LANA (Fig. 3, lane 13), F-LANA 1077FGG1079, and F-LANA 1116QM1117 (Fig. 3, lanes 18 and 19), the latter two of which contain alanine substitutions that do not affect C-terminal chromosome or DNA binding (Fig. 1B and 2B, lane 10, and Table 2). In contrast, and as expected, the N-terminal LANA chromosome binding mutant LANA 5GMR7 (Fig. 3, lane 14) (4) did not replicate DNA. Therefore, LANA C-terminal chromosome binding deficiency does not diminish DNA replication.

These results provide genetic separation of the DNA binding and chromosome association functions of C-terminal LANA. Although three mutants, 1026DCP1028, 1104VYC1106, and 1119RL1120, contained residues critical for both functions, other amino acids were important for only DNA or chromosome binding. Five of eight deficient DNA binding mutants which bound DNA at ≤10% of the level of LANA (1030K, 1065PYG1067, 1071LSQ1073, 1086SCL1088, and 1098ITY1100) had substitutions that did not affect C-terminal LANA chromosome attachment (Table 2). Further, residues 1068LKK1070 and 1125SHP1127 were critical for chromosome attachment but had no effect on TR DNA binding. Thus, DNA binding and chromosome association are mediated by overlapping but distinct C-terminal LANA subdomains.

None of the 40 C-terminal scanning alanine substitution mutants abolished LANA oligomerization. Previously, deletions of ~10 to 15 amino acids within LANA amino acids 1025 to 1112 (but not 1007 to 1021) each abolished C-terminal self-association, defining this sequence as critical for oligomerization (33, 43). Although the alanine substitutions assayed here included residues 1023 to 1145, completely encompassing the self-association region, all retained the ability to oligomerize with LANA (Fig. 2A, data not shown). Since no mutation abolished self-association, these data indicate that no specific amino acids are essential for this function. Instead, these results indicate redundancy of function among residues at the oligomerization interface.

This work provides genetic support for the predicted structural similarity between the LANA and EBNA1 DNA binding domains. 3D-PSSM software previously predicted that the structure of the LANA DNA binding domain has homology with the solved structure of the EBNA1 DNA binding domain, despite the absence of primary amino acid homology (27). Similar to LANA, the EBNA1 DNA binding domain must self-associate to bind its recognition sequence (12). Further, deletion of LANA residues 1007 to 1021, which correspond to EBNA1 residues that contact DNA, abolished LANA DNA binding (33). An alignment of the LANA residues mutated in this work and EBNA1 residues is shown in Fig. 2C. LANA amino acid substitutions that decreased DNA binding to ≤10% of that of LANA are shaded red. Residues with roles in EBNA1 binding to DNA are shown in Fig. 2C in red, green, and blue shading. LANA residues important for DNA binding clustering between positions 1026 and 1030, 1065 and 1073, and 1086 and 1088 correspond to clusters of EBNA1 residues critical for binding to cognate DNA (Fig. 2C). Other residues with roles in LANA DNA binding clustering between positions 1098 and 1106 and positions 1119 and 1120 do not obviously correspond to EBNA1 amino acids critical for DNA recognition. These LANA residues may represent key differences between the DNA binding domains of LANA and EBNA1.

Unlike EBNA1, C-terminal LANA contains a chromosome association function. C-terminal LANA concentrates at pericentromeric and peritelomeric regions of a subset of mitotic chromosomes (32). C-terminal LANA chromosome association does not occur by binding its recognition sequence in chromosomal DNA and instead is likely mediated through binding to a chromosomal protein. We now identify LANA residues critical for chromosome targeting. Seven alanine substitution mutants were severely compromised for chromosome attachment, indicating that the 18 residues (Fig. 2C, boxed residues) replaced in these mutants are critical for targeting C-terminal LANA to chromosomes. These amino acids lie within, or in close proximity to, predicted helices (Fig. 2C). These helices may form an interaction surface through which LANA binds to its C-terminal chromosome receptor protein(s).

C-terminal LANA mutants deficient for chromosome association were detected in mitotic cells at about a 10-fold lower frequency than C-terminal LANA or mutants which associated with chromosomes. This infrequent detection was not due to poor expression or unstable protein since C-terminal LANA or mutants that associated with chromosomes and those that were deficient in chromosome association were expressed at similar levels, as detected by immunoblotting, and expression in interphase cells was similar, as detected by microscopy. Further, infrequent detection in mitotic cells also occurred with GFP NLS, which does not associate with chromosomes. A likely possibility is that LANA mutants deficient for mitotic chromosome association are lost from cells during slide preparation. Potentially, during hypotonic swelling of cells, plasma membrane integrity is disrupted, allowing proteins unassociated with chromosomes to leak from the cell. Such leakage could also explain the observed detection of deficient mutants primarily when they are highly expressed.

Although the N-terminal LANA chromosome binding region is essential for mediating TR DNA replication (4, 37, 39), these data do not support a similar role for C-terminal LANA chromosome attachment. F-LANA with substitutions at 1068LKK1070 and 1125SHP1127 were each highly deficient for chromosome association (Fig. 1B) but mediated replication of TR DNA at wild-type levels (Fig. 3). This finding contrasts with results obtained after triple-alanine substitution of LANA N-terminal residues between positions 5 and 13, which abolished both chromosome association and DNA replication. Further, replacement of N-terminal LANA residues 14TG15 results in reduced chromosome association and DNA replication (4, 5). In contrast, deficient C-terminal chromosome targeting did not reduce LANA-mediated DNA replication.

As one of only a few viral proteins expressed during KSHV latency, LANA has evolved to perform multiple critical functions during latent infection. Among the viral proteins, LANA is necessary and sufficient for both replication and segregation of episomes, ensuring viral persistence (2, 13, 54). In addition, LANA has effects on transcription, growth control, and apoptosis (1, 19, 20-23, 25, 26, 35, 38, 39, 41-43, 48-51). Multiple cellular factors bind to LANA, and to the C-terminal domain in particular, and these interactions likely have a critical role in modulating the effect of LANA on both viral persistence and normal cellular processes. Further investigation of LANA should yield insight into the molecular mechanisms underlying its multiple effects.


arrow
ACKNOWLEDGMENTS
 
We thank Elliott Kieff for helpful discussions and William Wickner of Dartmouth Medical School for the generous gift of anti-GFP serum.

This work was supported by grants CA82036 (to K.M.K.) and CA85751 (to M.E.B.) from the National Cancer Institute.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: 181 Longwood Avenue, Boston, MA 02115. Phone: (617) 525-4256. Fax: (617) 525-4251. E-mail: kkaye{at}rics.bwh.harvard.edu Back

{triangledown} Published ahead of print on 7 February 2007. Back

{dagger} Present address: Department of Pediatrics, University of Alabama School of Medicine, Birmingham, AL 35233. Back

{ddagger} Present address: PTC Therapeutics, South Plainfield, NJ 07080. Back


arrow
REFERENCES
 
    1
  1. An, F. Q., N. Compitello, E. Horwitz, M. Sramkoski, E. S. Knudsen, and R. Renne. 2005. The latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus modulates cellular gene expression and protects lymphoid cells from p16 INK4A-induced cell cycle arrest. J. Biol. Chem. 280:3862-3874.[Abstract/Free Full Text]
    2. 2
  2. Ballestas, M. E., P. A. Chatis, and K. M. Kaye. 1999. Efficient persistence of extrachromosomal KSHV DNA mediated by latency-associated nuclear antigen. Science 284:641-644.[Abstract/Free Full Text]
    3. 3
  3. Ballestas, M. E., and K. M. Kaye. 2001. Kaposi's sarcoma-associated herpesvirus latency-associated nuclear antigen 1 mediates episome persistence through cis-acting terminal repeat (TR) sequence and specifically binds TR DNA. J. Virol. 75:3250-3258.[Abstract/Free Full Text]
    4. 4
  4. Barbera, A. J., M. E. Ballestas, and K. M. Kaye. 2004. The Kaposi's sarcoma-associated herpesvirus latency-associated nuclear antigen 1 N terminus is essential for chromosome association, DNA replication, and episome persistence. J. Virol. 78:294-301.[Abstract/Free Full Text]
    5. 5
  5. Barbera, A. J., J. V. Chodaparambil, B. Kelley-Clarke, V. Joukov, J. C. Walter, K. Luger, and K. M. Kaye. 2006. The nucleosomal surface as a docking station for Kaposi's sarcoma herpesvirus LANA. Science 311:856-861.[Abstract/Free Full Text]
    6. 6
  6. Bastien, N., and A. A. McBride. 2000. Interaction of the papillomavirus E2 protein with mitotic chromosomes. Virology 270:124-134.[CrossRef][Medline]
    7. 7
  7. Bochkarev, A., J. A. Barwell, R. A. Pfuetzner, E. Bochkareva, L. Frappier, and A. M. Edwards. 1996. Crystal structure of the DNA-binding domain of the Epstein-Barr virus origin-binding protein, EBNA1, bound to DNA. Cell 84:791-800.[CrossRef][Medline]
    8. 8
  8. Canham, M., and S. J. Talbot. 2004. A naturally occurring C-terminal truncated isoform of the latent nuclear antigen of Kaposi's sarcoma-associated herpesvirus does not associate with viral episomal DNA. J. Gen. Virol. 85:1363-1369.[Abstract/Free Full Text]
    9. 9
  9. Ceccarelli, D. F., and L. Frappier. 2000. Functional analyses of the EBNA1 origin DNA binding protein of Epstein-Barr virus. J. Virol. 74:4939-4948.[Abstract/Free Full Text]
    10. 10
  10. Cesarman, E., Y. Chang, P. S. Moore, J. W. Said, and D. M. Knowles. 1995. Kaposi's Sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas. N. Engl. J. Med. 332:1186-1191.[Abstract/Free Full Text]
    11. 11
  11. Chang, Y., E. Cesarman, M. S. Pessin, F. Lee, J. Culpepper, D. M. Knowles, and P. S. Moore. 1994. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 266:1865-1869.[Abstract/Free Full Text]
    12. 12
  12. Chen, M. R., J. M. Middeldorp, and S. D. Hayward. 1993. Separation of the complex DNA binding domain of EBNA-1 into DNA recognition and dimerization subdomains of novel structure. J. Virol. 67:4875-4885.[Abstract/Free Full Text]
    13. 13
  13. Cotter, M. A., II, and E. S. Robertson. 1999. The latency-associated nuclear antigen tethers the Kaposi's sarcoma-associated herpesvirus genome to host chromosomes in body cavity-based lymphoma cells. Virology 264:254-264.[CrossRef][Medline]
    14. 14
  14. Cotter, M. A., II, C. Subramanian, and E. S. Robertson. 2001. The Kaposi's sarcoma-associated herpesvirus latency-associated nuclear antigen binds to specific sequences at the left end of the viral genome through its carboxy-terminus. Virology 291:241-259.[CrossRef][Medline]
    15. 15
  15. Cruickshank, J., K. Shire, A. R. Davidson, A. M. Edwards, and L. Frappier. 2000. Two domains of the Epstein Barr virus origin DNA-binding protein, EBNA1, orchestrate sequence-specific DNA binding. J. Biol. Chem. 275:22273-22277.[Abstract/Free Full Text]
    16. 16
  16. Decker, L. L., P. Shankar, G. Khan, R. B. Freeman, B. J. Dezube, J. Lieberman, and D. A. Thorley-Lawson. 1996. The Kaposi sarcoma-associated herpesvirus (KSHV) is present as an intact latent genome in KS tissue but replicates in the peripheral blood mononuclear cells of KS patients. J. Exp. Med. 184:283-288.[Abstract/Free Full Text]
    17. 17
  17. Dupin, N., T. L. Diss, P. Kellam, M. Tulliez, M. Q. Du, D. Sicard, R. A. Weiss, P. G. Isaacson, and C. Boshoff. 2000. HHV-8 is associated with a plasmablastic variant of Castleman disease that is linked to HHV-8-positive plasmablastic lymphoma. Blood 95:1406-1412.[Abstract/Free Full Text]
    18. 18
  18. Dupin, N., C. Fisher, P. Kellam, S. Ariad, M. Tulliez, N. Franck, E. van Marck, D. Salmon, I. Gorin, J. P. Escande, R. A. Weiss, K. Alitalo, and C. Boshoff. 1999. Distribution of human herpesvirus-8 latently infected cells in Kaposi's sarcoma, multicentric Castleman's disease, and primary effusion lymphoma. Proc. Natl. Acad. Sci. USA 96:4546-4551.[Abstract/Free Full Text]
    19. 19
  19. Fakhari, F. D., J. H. Jeong, Y. Kanan, and D. P. Dittmer. 2006. The latency-associated nuclear antigen of Kaposi sarcoma-associated herpesvirus induces B cell hyperplasia and lymphoma. J. Clin. Investig. 116:735-742.[CrossRef][Medline]
    20. 20
  20. Friborg, J., Jr., W. Kong, M. O. Hottiger, and G. J. Nabel. 1999. p53 inhibition by the LANA protein of KSHV protects against cell death. Nature 402:889-894.[Medline]
    21. 21
  21. Fujimuro, M., and S. D. Hayward. 2003. The latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus manipulates the activity of glycogen synthase kinase-3ß. J. Virol. 77:8019-8030.[Abstract/Free Full Text]
    22. 22
  22. Fujimuro, M., J. Liu, J. Zhu, H. Yokosawa, and S. D. Hayward. 2005. Regulation of the interaction between glycogen synthase kinase 3 and the Kaposi's sarcoma-associated herpesvirus latency-associated nuclear antigen. J. Virol. 79:10429-10441.[Abstract/Free Full Text]
    23. 23
  23. Fujimuro, M., F. Y. Wu, C. ApRhys, H. Kajumbula, D. B. Young, G. S. Hayward, and S. D. Hayward. 2003. A novel viral mechanism for dysregulation of beta-catenin in Kaposi's sarcoma-associated herpesvirus latency. Nat. Med. 9:300-306.[CrossRef][Medline]
    24. 24
  24. Garber, A. C., J. Hu, and R. Renne. 2002. Latency-associated nuclear antigen (LANA) cooperatively binds to two sites within the terminal repeat, and both sites contribute to the ability of LANA to suppress transcription and to facilitate DNA replication. J. Biol. Chem. 277:27401-27411.[Abstract/Free Full Text]
    25. 25
  25. Garber, A. C., M. A. Shu, J. Hu, and R. Renne. 2001. DNA binding and modulation of gene expression by the latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus. J. Virol. 75:7882-7892.[Abstract/Free Full Text]
    26. 26
  26. Groves, A. K., M. A. Cotter, C. Subramanian, and E. S. Robertson. 2001. The latency-associated nuclear antigen encoded by Kaposi's sarcoma-associated herpesvirus activates two major essential Epstein-Barr virus latent promoters. J. Virol. 75:9446-9457.[Abstract/Free Full Text]
    27. 27
  27. Grundhoff, A., and D. Ganem. 2003. The latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus permits replication of terminal repeat-containing plasmids. J. Virol. 77:2779-2783.[Abstract/Free Full Text]
    28. 28
  28. Hirt, B. 1967. Selective extraction of polyoma DNA from infected mouse cell cultures. J. Mol. Biol. 26:365-369.[CrossRef][Medline]
    29. 29
  29. Hu, J., A. C. Garber, and R. Renne. 2002. The latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus supports latent DNA replication in dividing cells. J. Virol. 76:11677-11687.[Abstract/Free Full Text]
    30. 30
  30. Hung, S. C., M. S. Kang, and E. Kieff. 2001. Maintenance of Epstein-Barr virus (EBV) oriP-based episomes requires EBV-encoded nuclear antigen-1 chromosome-binding domains, which can be replaced by high-mobility group-I or histone H1. Proc. Natl. Acad. Sci. USA 98:1865-1870.[Abstract/Free Full Text]
    31. 31
  31. Ilves, I., S. Kivi, and M. Ustav. 1999. Long-term episomal maintenance of bovine papillomavirus type 1 plasmids is determined by attachment to host chromosomes, which is mediated by the viral E2 protein and its binding sites. J. Virol. 73:4404-4412.[Abstract/Free Full Text]
    32. 32
  32. Kelley-Clarke, B., M. E. Ballestas, T. Komatsu, and K. M. Kaye. 2007. Kaposi's sarcoma herpesvirus C-terminal LANA concentrates at pericentromeric and peritelomeric regions of a subset of mitotic chromosomes. Virology 357:149-157.[CrossRef][Medline]
    33. 33
  33. Komatsu, T., M. E. Ballestas, A. J. Barbera, B. Kelley-Clarke, and K. M. Kaye. 2004. KSHV LANA1 binds DNA as an oligomer and residues N-terminal to the oligomerization domain are essential for DNA binding, replication, and episome persistence. Virology 319:225-236.[CrossRef][Medline]
    34. 34
  34. Krithivas, A., M. Fujimuro, M. Weidner, D. B. Young, and S. D. Hayward. 2002. Protein interactions targeting the latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus to cell chromosomes. J. Virol. 76:11596-11604.[Abstract/Free Full Text]
    35. 35
  35. Krithivas, A., D. B. Young, G. Liao, D. Greene, and S. D. Hayward. 2000. Human herpesvirus 8 LANA interacts with proteins of the mSin3 corepressor complex and negatively regulates Epstein-Barr virus gene expression in dually infected PEL cells. J. Virol. 74:9637-9645.[Abstract/Free Full Text]
    36. 36
  36. Lehman, C. W., and M. R. Botchan. 1998. Segregation of viral plasmids depends on tethering to chromosomes and is regulated by phosphorylation. Proc. Natl. Acad. Sci. USA 95:4338-4343.[Abstract/Free Full Text]
    37. 37
  37. Lim, C., C. Choi, and J. Choe. 2004. Mitotic chromosome-binding activity of latency-associated nuclear antigen 1 is required for DNA replication from terminal repeat sequence of Kaposi's sarcoma-associated herpesvirus. J. Virol. 78:7248-7256.[Abstract/Free Full Text]
    38. 38
  38. Lim, C., D. Lee, T. Seo, C. Choi, and J. Choe. 2003. Latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus functionally interacts with heterochromatin protein 1. J. Biol. Chem. 278:7397-7405.[Abstract/Free Full Text]
    39. 39
  39. Lim, C., H. Sohn, D. Lee, Y. Gwack, and J. Choe. 2002. Functional dissection of latency-associated nuclear antigen 1 of Kaposi's sarcoma-associated herpesvirus involved in latent DNA replication and transcription of terminal repeats of the viral genome. J. Virol. 76:10320-10331.[Abstract/Free Full Text]
    40. 40
  40. Piolot, T., M. Tramier, M. Coppey, J. C. Nicolas, and V. Marechal. 2001. Close but distinct regions of human herpesvirus 8 latency-associated nuclear antigen 1 are responsible for nuclear targeting and binding to human mitotic chromosomes. J. Virol. 75:3948-3959.[Abstract/Free Full Text]
    41. 41
  41. Radkov, S. A., P. Kellam, and C. Boshoff. 2000. The latent nuclear antigen of Kaposi sarcoma-associated herpesvirus targets the retinoblastoma-E2F pathway and with the oncogene Hras transforms primary rat cells. Nat. Med. 6:1121-1127.[CrossRef][Medline]
    42. 42
  42. Renne, R., C. Barry, D. Dittmer, N. Compitello, P. O. Brown, and D. Ganem. 2001. Modulation of cellular and viral gene expression by the latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus. J. Virol. 75:458-468.[Abstract/Free Full Text]
    43. 43
  43. Schwam, D. R., R. L. Luciano, S. S. Mahajan, L. Wong, and A. C. Wilson. 2000. Carboxy terminus of human herpesvirus 8 latency-associated nuclear antigen mediates dimerization, transcriptional repression, and targeting to nuclear bodies. J. Virol. 74:8532-8540.[Abstract/Free Full Text]
    44. 44
  44. Skiadopoulos, M. H., and A. A. McBride. 1998. Bovine papillomavirus type 1 genomes and the E2 transactivator protein are closely associated with mitotic chromatin. J. Virol. 72:2079-2088.[Abstract/Free Full Text]
    45. 45
  45. Srinivasan, V., T. Komatsu, M. E. Ballestas, and K. M. Kaye. 2004. Definition of sequence requirements for latency-associated nuclear antigen 1 binding to Kaposi's sarcoma-associated herpesvirus DNA. J. Virol. 78:14033-14038.[Abstract/Free Full Text]
    46. 46
  46. Szekely, L., C. Kiss, K. Mattsson, E. Kashuba, K. Pokrovskaja, A. Juhasz, P. Holmvall, and G. Klein. 1999. Human herpesvirus-8-encoded LNA-1 accumulates in heterochromatin-associated nuclear bodies. J. Gen. Virol. 80:2889-2900.[Abstract/Free Full Text]
    47. 47
  47. Tetsuka, T., M. Higuchi, M. Fukushi, A. Watanabe, S. Takizawa, M. Oie, F. Gejyo, and M. Fujii. 2004. Visualization of a functional KSHV episome-maintenance protein LANA in living cells. Virus Genes 29:175-182.[CrossRef][Medline]
    48. 48
  48. Viejo-Borbolla, A., E. Kati, J. A. Sheldon, K. Nathan, K. Mattsson, L. Szekely, and T. F. Schulz. 2003. A domain in the C-terminal region of latency-associated nuclear antigen 1 of Kaposi's sarcoma-associated herpesvirus affects transcriptional activation and binding to nuclear heterochromatin. J. Virol. 77:7093-7100.[Abstract/Free Full Text]
    49. 49
  49. Viejo-Borbolla, A., M. Ottinger, E. Bruning, A. Burger, R. Konig, E. Kati, J. A. Sheldon, and T. F. Schulz. 2005. Brd2/RING3 interacts with a chromatin-binding domain in the Kaposi's sarcoma-associated herpesvirus latency-associated nuclear antigen 1 (LANA-1) that is required for multiple functions of LANA-1. J. Virol. 79:13618-13629.[Abstract/Free Full Text]
    50. 50
  50. Watanabe, T., M. Sugaya, A. M. Atkins, E. A. Aquilino, A. Yang, D. L. Borris, J. Brady, and A. Blauvelt. 2003. Kaposi's sarcoma-associated herpesvirus latency-associated nuclear antigen prolongs the life span of primary human umbilical vein endothelial cells. J. Virol. 77:6188-6196.[Abstract/Free Full Text]
    51. 51
  51. Wong, L. Y., G. A. Matchett, and A. C. Wilson. 2004. Transcriptional activation by the Kaposi's sarcoma-associated herpesvirus latency-associated nuclear antigen is facilitated by an N-terminal chromatin-binding motif. J. Virol. 78:10074-10085.[Abstract/Free Full Text]
    52. 52
  52. Yates, J., N. Warren, D. Reisman, and B. Sugden. 1984. A cis-acting element from the Epstein-Barr viral genome that permits stable replication of recombinant plasmids in latently infected cells. Proc. Natl. Acad. Sci. USA 81:3806-3810.[Abstract/Free Full Text]
    53. 53
  53. Yates, J. L., N. Warren, and B. Sugden. 1985. Stable replication of plasmids derived from Epstein-Barr virus in various mammalian cells. Nature 313:812-815.[CrossRef][Medline]
    54. 54
  54. Ye, F. C., F. C. Zhou, S. M. Yoo, J. P. Xie, P. J. Browning, and S. J. Gao. 2004. Disruption of Kaposi's sarcoma-associated herpesvirus latent nuclear antigen leads to abortive episome persistence. J. Virol. 78:11121-11129.[Abstract/Free Full Text]

Journal of Virology, April 2007, p. 4348-4356, Vol. 81, No. 8
0022-538X/07/$08.00+0     doi:10.1128/JVI.01289-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Wen, K. W., Dittmer, D. P., Damania, B. (2009). Disruption of LANA in Rhesus Rhadinovirus Generates a Highly Lytic Recombinant Virus. J. Virol. 83: 9786-9802 [Abstract] [Full Text]  
  • Feeney, K. M, Parish, J. L (2009). Targeting mitotic chromosomes: a conserved mechanism to ensure viral genome persistence. Proc R Soc B 276: 1535-1544 [Abstract] [Full Text]  
  • Kelley-Clarke, B., De Leon-Vazquez, E., Slain, K., Barbera, A. J., Kaye, K. M. (2009). Role of Kaposi's Sarcoma-Associated Herpesvirus C-Terminal LANA Chromosome Binding in Episome Persistence. J. Virol. 83: 4326-4337 [Abstract] [Full Text]  
  • Si, H., Verma, S. C., Lampson, M. A., Cai, Q., Robertson, E. S. (2008). Kaposi's Sarcoma-Associated Herpesvirus-Encoded LANA Can Interact with the Nuclear Mitotic Apparatus Protein To Regulate Genome Maintenance and Segregation. J. Virol. 82: 6734-6746 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kelley-Clarke, B.
Right arrow Articles by Kaye, K. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kelley-Clarke, B.
Right arrow Articles by Kaye, K. M.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»