Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Murphy, M. Articles by Falck-Pedersen, E. Search for Related Content PubMed PubMed Citation Articles by Murphy, M. Articles by Falck-Pedersen, E.

 Previous Article  |  Next Article 

Journal of Virology, April 2007, p. 3721-3730, Vol. 81, No. 8
0022-538X/07/$08.00+0     doi:10.1128/JVI.02693-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Adeno-Associated Virus Type 2 p5 Promoter: a Rep-Regulated DNA Switch Element Functioning in Transcription, Replication, and Site-Specific Integration

Mary Murphy, Janette Gomos-Klein,^, Marko Stankic, and Erik Falck-Pedersen^*

Weill Medical College of Cornell University, Hearst Research Foundation, Department of Microbiology and Immunology, Molecular Biology Graduate Program, New York, New York 10021

Received 6 December 2006/ Accepted 24 January 2007

Top Abstract Introduction Materials and Methods Results Discussion References

 
The large Rep proteins, p68 and p78, function as master controllers of the adeno-associated virus type 2 (AAV2) life cycle, involved in transcriptional control, in latency, in rescue, and in viral DNA replication. The p5 promoter may be the nucleic acid complement to the large Rep proteins. It drives expression of the large Rep proteins, it undergoes autoregulation by Rep, it undergoes induction by helper virus, it is a target substrate for Rep-mediated site-specific integration (RMSSI), and it can function as a replicative origin. To better understand the relationship between each of the p5 functions, we have determined the effects of p5 promoter mutations (p5 integration efficiency element, or p5IEE) on transcription, integration, and replication using RMSSI transfection protocols in HeLa cells. The data demonstrate that the organization of the p5 promoter provides a unique platform for regulated AAV2 template transcription and subsequent repression by Rep through direct and indirect mechanisms. The elements of the p5IEE that define its function as a promoter also define its function as a highly optimized substrate for Rep-mediated site-specific integration and replication. The p5 Rep binding element (RBE) is essential in RMSSI and Rep-dependent replication; however, replacement of the p5 RBE with either the AAV2 inverted terminal repeat or the AAVS1 RBE sequence elements neither enhances nor severely compromises RMSSI activity of p5IEE. The RBE by itself or in combination with the YY1+1 initiator/terminal resolution sequence element does not mediate efficient site-specific integration. We found that replication and integration were highly sensitive to sequence manipulations of the p5 TATA/RBE/YY1+1 core structure in a manner that reflects the function of these elements in transcription. The data presented support a model where, depending on the state of the cell (Rep expression and helper virus influences), the p5IEE operates as a transcription/integration switch sequence element.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Adeno-associated virus type 2 (AAV2) is a nonpathogenic single-stranded DNA parvovirus that requires coinfection with a helper virus (adenovirus [Ad] or herpes virus) to stimulate progression through the viral replicative cycle. The Ad helper virus expresses the immediate early E1A gene products which have been shown to transactivate the AAV2 p5 promoter (1, 2), resulting in expression of two alternatively spliced p5 transcripts that yield the p68 and p78 (p68/78) Rep polypeptides (8, 33). The large Rep polypeptides possess endonuclease, helicase, and ATPase enzymatic activities (reviewed in reference 21). In addition to enzymatic properties, the N-terminal domain of Rep p68/78 has sequence-specific DNA binding capabilities that recognize a GAGC sequence motif (3, 18, 24, 28). This motif is imperfectly repeated four times in the AAV2 origin element located in the hairpin inverted terminal repeat (ITR) present at both ends of the viral genome (18, 24). Both the enzymatic and DNA binding functions of p68/78 are essential for full-length replication of the AAV2 genome (17, 24). Upregulation of p5 Rep expression and coincident expression of helper virus gene products result in high levels of viral DNA replication and subsequent production of infectious virions.

In the absence of a helper virus, AAV2 infection can result in a unique form of latency featuring preferential integration into the human genome at a site termed AAVS1 at human chromosome 19q13.4qter (13, 15). A 34-bp sequence located in the first exon of the myosin binding subunit 85 of protein phosphatase 1 (31) has been shown to be the minimal AAVS1 element required to target AAV2 DNA to this chromosomal location (15). Following localization to the AAVS1 site, a poorly understood mechanism involving nonhomologous recombination mediates an integration event. However, this integration event does not occur at a precise site within the AAVS1 region (reviewed in reference 19). The AAVS1 element is similar in organization to the AAV2 ITR origin and contains an imperfect tetrameric GAGC repeat element and a terminal resolution sequence (TRS) (15). The frequency of AAV2 integration into AAVS1 is influenced by viral dose and can be as high as 50% of infected cells at multiplicities of infection (MOIs) greater than 100 (7). Studies characterizing the kinetics of Rep-dependent integration reveal that integration peaks within 24 to 48 h of infection (11, 12). Rescue of latently integrated virus occurs when cells are infected with helper virus and is thought to occur through activation of p5 Rep expression and a subsequent Rep-dependent replication rescue mechanism (39).

Under conditions that promote latency (the absence of a helper virus), the p5 promoter is transcriptionally active (1). The p5 promoter consists of several transcription factor binding sites including a YY1 initiator, a TATA domain, and upstream binding sites for USF and YY1 (2). Studies by Pereira et al. (25) indicate that each transcription element identified in the p5 promoter contributes to Rep68/78 expression following transfection into HeLa cells. Importantly, in the absence of helper virus, p5 activity is transient due to Rep-mediated autoregulation. Low levels of Rep expression repress transcription from the p5 promoter (1, 10, 14, 25). Rep-mediated repression is thought to be the result of Rep binding to a Rep binding element (RBE) located between the TATA and YY1+1 site of the p5 promoter (14, 25). Rep also interacts with cellular transcription factors such as SP1, TATA binding protein (TBP), and PC4 (9, 25, 40) and indirectly influences expression at a variety of polymerase II (Pol II) promoters. Coincident with Rep-dependent repression of p5, recent studies from our laboratory have shown that the p5 promoter functions as an important and primary target sequence for Rep-mediated site-specific integration (RMSSI) (27). In addition to functioning as an RNA Pol II promoter and as a target substrate for RMSSI, the p5 integration efficiency element (p5IEE) can also serve as a Rep-dependent origin of DNA replication (5, 23, 32, 35, 37, 38). Located downstream of the p5 RBE is a TRS-like sequence (37) positioned within the YY1+1 site of the p5 element. When combined with the RBE and the TATA element (5), the p5 TRS can undergo Rep-dependent nicking and DNA amplification.

The versatility of the p5 element in transcription, integration, and replication reflects the functional requirements of AAV2 during distinct stages of infection: primary infection in the absence of helper virus leading to latency, latency, rescue from latency, and primary infection in the presence of helper virus leading to productive infection. We have proposed a model where the p5 promoter, when undergoing Rep repression, is converted from a transcription initiation complex into a structure that facilitates efficient Rep-dependent integration (7). In this study we show that mutations that influence the transcriptional activity of the p5 promoter also influence the ability of the p5IEE to act as a substrate for site-specific integration and for DNA replication.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Plasmid constructs. p5CAT (where CAT is chloramphenicol acetyltransferase), pTRUF2, and pT7Rep78 were previously described (26). pCMVRep78 (where CMV is cytomegalovirus) was generated by PCR amplification of the Rep78 coding sequence and cloning into the pAdCMVHS cassette (26). In the p5CAT construct (Fig. 1A), the p5 promoter is flanked by a 5' NotI restriction site and an SrfI restriction site at the 3' end for cloning purposes. Oligonucleotide-directed mutations were generated by PCR amplification and inserted into p5CAT at NotI and SrfI. All clones were sequenced to confirm sequence identity and integrity. Oligonucleotide sequences for individual constructs are available upon request.

View larger version (40K): [in this window] [in a new window]

FIG. 1. The p5IEE functions as a target for Rep-mediated site-specific integration. (A) Diagrammatic representation of the p5CAT plasmid used as a target substrate for replication and integration assays. The p5 element or p5IEE indicated in black is functioning as the promoter for the CAT reporter gene. The CAT coding region used for Southern analysis is indicated by shading, and the MboI restriction sites at 691 and 1561 are shown. (B) Sequence of the p5IEE flanked by NotI and SrfI restriction sites. (C) Restriction digestion map illustrating genomic sequence in the area of AAVS1. Map depicts genomic fragments for EcoRV and BamHI digests used to characterize AAVS1 disruptions and integrants and the AAVS1 genomic region used as a probe in Southern blot analysis. Representative Southern blots of genomic DNA from individual cell lines transfected with p5CAT and T7Rep78 6 weeks posttransfection, hybridized with AAVS1 probe (D) or CAT probe (E) are shown. Arrowheads at the bottom of panel E indicate lanes where restriction fragment bands revealed by both AAVS1 and CAT probes were found to comigrate.

Plasmid transfection. Plasmid DNA was electroporated into HeLa cells as previously described (27). Briefly, 6.4 x 10⁶ HeLa cells were electroporated with 15 µg of an integration target plasmid (p5CAT) and 15 µg of a Rep-expressing plasmid (pT7Rep) that also includes a CMV green fluorescent protein (CMVGFP) expression cassette. In the absence of a T7Rep78, a pCMVGFP plasmid was cotransfected to normalize for transfection efficiency and GFP selection through flow cytometry.

Integration assay and Southern blot analysis. Transfected cells were plated out, and 36 to 48 h posttransfection, GFP-positive cells were isolated by flow cytometry. Cells were plated at 1 cell per well into 96-well plates. After 2 weeks, confirmed clonal cell lines were expanded and grown for an additional 4 weeks in Dulbecco's modified Eagle medium containing 5% calf serum and 5% fetal calf serum. At 6 weeks posttransfection, whole-cell DNA was isolated from each cell line using a standard salting-out protocol (20). DNA from each cell line was digested with EcoRV [or indicated restricted enzyme(s)] and separated on 1% agarose gels. After DNA fragments were transferred to nylon membranes, hybridization was carried out using ³²P-labeled probes in Sigma prehybridization solution, according to the manufacturer's instructions. DNA probes were ³²P-labeled using a Rediprime kit (Amersham Pharmacia Biotech) according to the manufacturer's instructions. An 800-bp CAT fragment was generated by PCR from the oligonucleotides GCTAGCTTGAGGTGTGGCAGGC and GGCATGATGAACCTGAATCGC; a 1.9-kb AAVS1 PCR product was generated using the oligonucleotides GAACTCTGCCCTCTAACGCTGC and CACCAGATAAGGAATCTGCC (13, 34). Southern blots were visualized by autoradiography.

DNA replication assay. The procedure for our DNA replication assay is modeled after the established assay recently used by Francois et al. (5) with minor modifications. Plasmid transfections were as described above; 24 h posttransfection, cells were exposed to medium containing Ad type 2 ([Ad2]1,000 particles/cell; an MOI of 30) or mock-treated medium. Infected and mock-treated cells were harvested between 60 and 72 h after Ad infection for total DNA as previously described. Purified DNA from each sample was digested with either Dpn I or MboI and separated by agarose gel electrophoresis as described above. p5CAT constructs digested with DpnI yield an 870-bp DNA fragment that hybridizes to the CAT probe described in the previous section. Digestion of pTRUF2 with DpnI results in a 542- and a 621-bp fragment when probed with a labeled SmaI-MfeI DNA fragment isolated from pTRUF2.

CAT assay. Transfected cells were harvested 48 h postelectroporation in TEN scrape buffer (40 mM Tris HCl, pH 7.4, 1 mM EDTA, 150 mM NaCl) and resuspended in 0.25 M Tris, pH 7.8. Lysates were subjected to three freeze-thaw cycles followed by a 10-min incubation at 65°C to inactivate cellular deacetylases. CAT activity assays were performed as previously described (6).

Top Abstract Introduction Materials and Methods Results Discussion References

 
Rep-mediated site-specific integration and replication of p5-containing plasmid DNA. In previous studies, we used a p5CAT plasmid as a target substrate for site-specific integration (27). The p5CAT construct (Fig. 1A) includes 103 bp of the AAV2 p5 promoter sequence (AAV2 nucleotides 189 to 292) (Fig. 1B) flanked by NotI and SrfI restriction sites for cloning purposes and drives expression of the bacterial CAT reporter gene. In the current study, for all integration assays, DNA from clonal isolates was first digested with a restriction enzyme that does not digest p5CAT (EcoRV or AVRII) and characterized by Southern analysis probing AAVS1 or CAT. An example of p5CAT integrants digested with EcoRV is depicted in Fig. 1D and E. EcoRV digestion releases a 5.4-kb genomic fragment surrounding the AAVS1 site in chromosome 19 (Fig. 1C and D). Rep-mediated AAVS1 disruptions and integrations are identified as DNA fragments migrating well above the genomic AAVS1 5.4-kb fragment (Fig. 1D). When a parallel Southern blot was probed with a ³²P-labeled CAT DNA probe, bands that comigrate with AAVS1 disruptions (Fig. 1E) are indicative of site-specific integrants. For each cell line, a follow-up digest with BamHI which digests p5CAT and the genomic region of AAVS1 (7, 27; also data not shown) are used to confirm the observations made in the EcoRV digest. These are the criteria used to designate a particular integrant as site specific.

In a typical experiment, approximately half of the cell lines that demonstrate a disruption of AAVS1 do not contain p5CAT DNA and represent unproductive disruptions. Occasionally, in cell lines containing p5CAT either there is no AAVS1 disruption or the p5CAT does not comigrate with AAVS1; these lines are identified as nonspecific integrants. With wild-type (wt) virus, up to 50% of infected cells undergo RMSSI, and the efficiency is very dependent on viral dose (7). When the plasmid transfection assay was used with low levels of Rep provided from pT7Rep78, the efficiency of RMSSI was between 10 and 20% of transfected cells. Integration assays carried out with pCMVRep78, providing a higher level of Rep expression, resulted in lower numbers of viable cell colonies (interpreted to be the result of cytotoxic effects of Rep) and no tangible enhancement of site-specific integration (data not shown). Thus, unregulated high levels of Rep expression do not translate into increased integration efficiencies or colony survival.

Since the p5IEE has been shown to function as an origin for DNA replication, we wanted to assess Rep-mediated replication under the conditions used for site-specific integration using the p5CAT plasmid. To characterize Rep-dependent replication, an assay was established by cotransfecting a Rep-expressing plasmid and an AAV origin-containing plasmid in HeLa cells, followed by helper virus infection. Replication of p5CAT was compared to replication originating from pTRUF2, which contains a rescuable ITR-flanked GFP Neo reporter cassette (42). Because pTRUF2 is a rescuable replication substrate, it undergoes high levels of active replication. Rep expression was derived from one of two plasmids: pCMVGFP-pT7Rep78, a low-level Rep-expressing construct, or pCMVRep78, a high-level Rep expression construct; pCMVGFP, a non-Rep-expressing plasmid, served as a negative control. Twenty-four hours posttransfection, cells were incubated with wt Ad2 (MOI of 30) or medium and allowed to undergo active replication for 60 to 72 h, at which time total DNA was harvested. Total DNA was digested by the restriction enzyme MboI or DpnI; both enzymes recognize a GATC sequence motif, but Dpn I specifically digests Dam-methylated DNA (generated when plasmids are grown in Escherichia coli HB101), whereas MboI digests nonmethylated DNA. Plasmid DNA that is replicated in a mammalian cell is insensitive to DpnI digestion and vulnerable to MboI digestion. As indicated in ethidium bromide-stained agarose gels (Fig. 2B and D), cellular and adenoviral DNA are not digested by DpnI but are digested by MboI. Transfected plasmid DNA is not present in high enough concentration to be consistently identified by ethidium bromide staining (each transfection was done in duplicate). Southern blot analysis was used to detect pTRUF2 or p5CAT replication products (Fig. 2A and C, respectively). In the absence of Rep (CMVGFP), no replication of pTRUF2 occurs, whereas in the presence of pT7Rep78 and Ad2, low levels of replication are revealed. No detectable replication occurs in the absence of Ad2. In contrast to the levels of pTRUF2 replication that results with pT7Rep78 as a source of Rep, pCMVRep78 results in 20- to 50-fold more replication product (Fig. 2A, compare boxed areas corresponding to pT7Rep78 and pCMVRep78). With pCMVRep78 there is no identifiable replication of pTRUF2 if helper Ad is not present. In contrast to high levels of replication occurring with pTRUF, p5CAT replication products were found at very low levels when cotransfected with pCMVRep78 and were not detected in the replication assays using pT7Rep78 (Fig. 2C). Under these assay conditions, the p5IEE functions as a modest substrate for DNA replication and requires high levels of Rep78 as well as Ad2 helper functions.

View larger version (80K): [in this window] [in a new window]

FIG. 2. Replication of p5CAT in HeLa cells. Replication assay of the ITR-containing plasmid pTRUF or p5CAT, cotransfected with a control plasmid pCMVGFP, pT7Rep, or CMVRep, in the presence of wt Ad2 or mock (medium) helper virus infection. DNA harvested from duplicate transfections was digested with MboI or DpnI to identify replication products (MboI) or transfected plasmid (DpnI). (A) pTRUF2 replication products detected by Southern analysis when probed for pTRUF2 are indicated by arrows (542 and 621 bp). Boxed areas highlight the locations of expected Rep-dependent replication products. (B) Ethidium bromide staining of gel in panel A before transfer. (C) p5CAT replication products detected by Southern analysis when probed with CAT. The expected 861-bp replication product should be present within the boxed area. (D) Ethidium bromide staining of gel in panel C before transfer.

The p5 RBEYY1+1 origin-like element is not a sufficient target substrate for RMSSI. The p5IEE contains a Rep binding site that consists of an imperfect tetrameric GAGC repeat motif and a TRS that is just upstream in the YY1+1 site (Fig. 3A). We next asked if these elements by themselves could mimic the p5IEE as a promoter, as an integration substrate, or as a substrate for Rep-dependent replication. Transfection of p5CAT-derived plasmid DNA corresponding to a p5 RBE-only construct or a p5 RBE/YY1+1 construct was carried out in the presence or the absence of pT7Rep78 as previously described. Cell lysates were harvested after 48 h and assayed for expression of the CAT reporter gene. Data are presented as a percentage of wt p5CAT expression (Fig. 3B). CAT expression from the pRBE-only construct is essentially at baseline levels and is not altered by the presence of Rep78. Expression from pRBEYY1+1 is diminished compared to p5CAT but still represents a significant level of gene expression that is sensitive to repression by coexpression of Rep78. When the RBE-only or the RBEYY1+1 construct was used as a substrate for RMSSI, neither generated site-specific integrants (Fig. 3C). Rep-dependent DNA replication assays were carried out (Fig. 3D; only the MboI and DpnI products at 866 bp are shown), and the data indicate that no MboI digestion products were generated with either construct. Therefore, RBE-only and the RBEYY1+1 constructs did not support Rep-dependent replication. Based on these assays, the p5 RBE alone cannot support transcription, integration, or the replication functions associated with p5IEE. However, when the RBE is combined with the YY1+1 element, it can function as a Rep-sensitive promoter but not as a substrate for Rep-dependent integration or replication.

View larger version (16K): [in this window] [in a new window]

FIG. 3. Characterization of p5IEE origin elements associated with the RBE and the TRS site (YY1). Plasmids containing only the p5 RBEYY1+1 sequence region of p5 or only the p5 RBE (A) were analyzed for CAT expression following transient transfection in the absence (–Rep) or presence of Rep (+Rep) (B). Constructs were characterized for site-specific integration efficiency following transfection of each construct in the presence of T7Rep (C) and by a DNA replication assay (D) as described in the text.

p5IEE RBE requirements for transcription, replication, and integration. We next wanted to determine if the RBE of the p5IEE was necessary for RMSSI. Using oligonucleotide-directed mutagenesis, a p5IEE RBE mutant (p5RBEmut) was generated that lacked a recognizable GAGC RBE binding domain (Fig. 4A). Additionally, a construct was generated that included an authentic p5IEE RBE sequence flanked upstream by an insertion of four base pairs (TTAA) between the TATA and RBE domains to generate a PacI site and downstream by a substitution of 2 bp and insertion of a single nucleotide between the RBE and YY1+1 site to generate a ClaI restriction site (p5RBEfix) (Fig. 4A). Each of these constructs was used in assays assessing function in transcription, integration, and Rep-dependent replication. The p5RBEmut was compromised compared to p5CAT in the CAT assay (Fig. 4B), and consistent with the RBE's playing an essential role in RMSSI, we found no site-specific integrants when the p5RBEmut was used in the integration assay (Fig. 4C). The RBE mutation also had a strong negative effect on replication (Fig. 4D). When the RBEmut sequence was replaced in p5RBEfix, we were surprised to find that promoter activity, Rep-dependent integration, and Rep-dependent replication functions were all compromised. To identify if either or both of the linker insertions were associated with the observed loss of p5IEE function, constructs containing only the PacI linker (p5PacRBE) or only the ClaI linker (p5ClaRBED) (Fig. 4A) were generated and characterized. Both of these plasmids partially restored promoter activity. p5PacRBE did not function as a substrate for site-specific integration or replication, whereas p5ClaRBE was able to undergo site-specific integration and serve as a template for Rep-dependent replication. Therefore, perturbing the sequence at the TATA-RBE junction caused a severe repression of p5IEE integration/replication functions, whereas the sequence substitutions at the RBE-YY1+1 junction were tolerated in both of the assays.

View larger version (31K): [in this window] [in a new window]

FIG. 4. Characterization of p5IEE plasmids containing mutations in the RBE region. (A) Diagram of p5CAT constructs. The RBE was mutated to a non-Rep binding sequence (p5RBEmut), or a wt RBE was reinserted flanked by the restriction sites PacI and ClaI (p5RBEfix) or with PacI only (p5PacRBE) or ClaI only (p5ClaRBE). Constructs were characterized for CAT expression (+Rep or –Rep) (B) site-specific integration efficiency (C), or p5 replication function (D) as previously described.

The p5RBE is interchangeable with the AAVS1 or the AAV-ITR RBEs. The p5IEE RBE sequence contains a single perfect repeat of the GAGC Rep binding element and three imperfect repeats. We next asked if the nature of the RBE sequence used in the p5IEE element would either compromise or enhance the efficiency of RMSSI. The AAV2 ITR RBE element contains three perfect repeats of the GAGC motif and one imperfect element (Fig. 5A), whereas the AAVS1 RBE element contains a different organization of three perfect and one imperfect GAGC motif. Oligonucleotide-directed mutagenesis was used to replace the p5IEE RBE sequence with sequence corresponding to AAVS1 or AAV2 ITR RBE sequence elements. Exchange of the p5 RBE with AAVS1 or AAV ITR elements had no apparent effect on promoter activity, but there was a noticeable enhancement of Rep-mediated repression with both replacement constructs (Fig. 5B). Each replacement construct was able to support site-specific integration; however, there was a slight decrease in the efficiency of integration mediated by each of the replacement RBE elements (Fig. 5C). When assayed for Rep-dependent replication, the replacement constructs were as active in the replication assay as p5RBE. Each of the RBE replacement constructs is able to complement the function of the p5RBE in transcription, integration, and replication; however, the subtle differences in our data indicate that the p5 RBE is a more desirable element for RMSSI whereas the consensus GAGC elements may be better suited for Rep-dependent replication.

View larger version (18K): [in this window] [in a new window]

FIG. 5. Characterization of RBE replacement domains from AAVS1 and AAVITR in p5IEE. The p5 RBE was replaced with the RBE sequence present in the AAV2 ITR origin domain or the human chromosome 19 AAVS1 integration site RBE (A) and characterized for CAT activity in the presence (+Rep) or absence (–Rep) of T7Rep (B), site-specific integration efficiency with T7Rep (C), or DNA replication with CMVRep (D), as previously described.

Promoter sequence elements surrounding the RBE contribute to p5IEE function. We next generated a series of p5IEE mutations to characterize how upstream transcription factor binding sites influence the biology of the p5 promoter. Mutations were generated that replaced the sequence of the USF (MLTF) binding site (yielding USFmt), the YY1-60 binding site (YY1-60mt), the TATA DNA element, and the YY1+1 initiator (YY1+1mt) (Fig. 6A). The p5RBEmut was included for comparative purposes. Compared to wt p5CAT, each mutation resulted in a three- to fivefold decrease in CAT activity (Fig. 6B), with the YY1+1 mutant having the strongest overall effect. Interestingly, the USFmt, the YY1-60mt, the RBEmt, and the YY1+1mt retained sensitivity to Rep-mediated repression whereas the TATA mutation was essentially nonresponsive to coexpression of low levels of Rep78 (Fig. 6B). When each construct was characterized for RMSSI (Fig. 6C), p5RBEmut again did not function as a target substrate for RMSSI. The YY1+1mt and the TATA mutant were severely compromised with respect to the overall number of site-specific integrants obtained, indicating the critical function these elements contribute to RMSSI. The YY1-60mt and the USFmt were able to mediate RMSSI at levels that were of intermediate efficiency, not at wt levels but consistently above the levels obtained with the TATA or YY1+1 mutations. All of the constructs were compromised when assayed for Rep-dependent DNA replication, with the USFmt showing a low level of MboI product (compared to levels of DpnI-digested material) (Fig. 5D).

View larger version (49K): [in this window] [in a new window]

FIG. 6. The role of p5IEE promoter elements in transcription, replication, and integration. The p5 promoter includes sequence elements associated with specific transcription factor binding sites as previously indicated. Constructs containing the indicated transcription factor binding site mutations (A) were constructed and characterized for promoter activity (B), for site-specific integration (C), or for Rep-dependent replication (D) carried out as previously described.

Top Abstract Introduction Materials and Methods Results Discussion References

 
AAV2 is a relatively simple single-stranded DNA virus with a genome of 4,680 nucleotides that contains two open reading frames coding for the nonstructural Rep proteins and the structural Cap proteins. The large Rep proteins, p68 and p78, function as master controllers of the AAV2 life cycle, intimately involved in transcriptional control, in RMSSI, in rescue, and in viral DNA replication. The p5IEE is the nucleic acid complement to the Rep master controller. In this study we have used mutations of the p5IEE to develop insight into the functional transitions that occur at the p5IEE through its interaction with Rep68 and Rep78 that may lead to RMSSI.

In the absence of coinfecting helper virus, the p5 promoter is transcriptionally active, and deletions of the p5 element uniformly result in reduced levels of transgene expression (1). We have found that each of the p5 promoter elements identified by Chang et al. (2) influences transcriptional activity under conditions of no helper virus and no Rep expression. Substitution mutations of the RBE, the TATA, the YY1+60, and the USF elements all resulted in an approximate two- to fivefold decrease in CAT expression (Fig. 6). These results are consistent with the studies of Pereira et al. (25), who demonstrated that base substitutions in p5, when used to drive expression of Rep, had a generally negative impact on Rep mRNA levels. The data presented in our study are also consistent with the YY1+1 element's functioning as an initiator of Pol II transcription. Mutations in this domain were severely compromised in our transient transfection CAT assays, and the YY1+1 element when combined with the RBE conferred transcriptional activity (Fig. 3). However, the presence of the upstream elements clearly contributes to the activity of the p5 promoter. Recognizing that sequence replacement mutations may have unidentified structural effects that influence transcription levels, we conclude that the overall integrity of the entire p5 element is important to expression in the absence of helper functions.

Following p5 promoter activation and transcription, the large Rep proteins are produced and bind to target sequence elements including the p5 promoter, the AAV2 ITR, and AAVS1. Rep binding to AAVS1 stimulates nicking, and limited replication of this region and causes repression of the p5 promoter. By repressing further expression from p5, the window of Rep-mediated functions is tightly controlled and predicted to occur in a narrow time frame. This is consistent with RMSSI kinetics revealed by Huser and Heilbronn, where RMSSI peaked after 24 to 48 h and was essentially complete 4 days postinfection (12).

We characterized Rep interaction with the p5 promoter by repression of CAT expression from each of the p5CAT mutants. The level of repression with pT7Rep78 was not absolute, and for the parental p5CAT, levels were reduced to approximately 50% of expression that occurred in the absence of Rep. In general, we found transcription from each mutant construct negatively affected by low levels of Rep expression. Because many of the constructs had reduced levels of CAT expression compared to the parental p5CAT, we are viewing Rep-mediated repression in a qualitative rather than quantitative manner.

We were initially surprised to find that the TATA binding element mutation rendered the p5 element relatively insensitive to Rep repression (Fig. 6B), whereas CAT assays of the pRBEYY1+1 construct (Fig. 3B) demonstrate a very high level of Rep sensitivity (in the absence of a TATA element). This apparent contradiction indicates the importance of context to the biology of the p5 promoter element and may be the result of both direct and indirect mechanisms of Rep inhibition operating on the p5IEE. Rep78 can form a complex with TBP (9), and the ability of Rep to complex with TBP negatively regulates expression from a number of promoters including the p97 promoter of human papillomavirus (29) and the major later promoter of Ad (22). In our mutant constructs, a TATA mutant was desensitized to Rep inhibition whereas an RBE mutant was still responsive to Rep inhibition. These observations are consistent with Rep inhibition of p5IEE through an inhibitory TBP-Rep78 complex acting at the p5IEE TATA site. Consistent with this model, studies by Francois et al. (5) demonstrated an essential role for TBP binding to the p5 TATA in Rep-dependent replication at the p5 ori.

In a construct that contains only the initiator and the RBE element, we observed very strong Rep-mediated repression. We also found that replacement of the p5 RBE element with the ITR-RBE sequence or the AAVS1-RBE elements may have increased the sensitivity to Rep-dependent repression (Fig. 5). These data support the possible existence of two classes of Rep interaction with the p5 RBE element (direct and indirect), where the contextual arrangement of promoter elements in the p5IEE are important to establishment of a specific type of Rep-responsive Pol II transcription initiation complex.

Based on our current knowledge of Rep interaction with the p5 promoter, the next p5IEE transition could include Rep-mediated localization to AAVS1 (30, 41) and/or Rep-mediated nicking of the p5 promoter (5, 23, 32, 35, 37, 38). In the case of RMSSI, Rep levels are below those necessary to detect extensive replication, but clearly amplification of AAVS1 and the integrating genome occurs (7). In the absence of Ad helper virus, we could not detect replication with any of the constructs including pTRUF2. In the presence of helper virus, we could not detect p5 replication with low levels of Rep78. Since pT7Rep78 can mediate low levels of replication with ITR-containing plasmid pTRUF2, our inability to detect p5CAT replication may reflect a requirement for high levels of Rep to effect replication from p5, or it may represent an insensitivity of the assay used in these studies.

All subsequent p5CAT replication assays were carried out in the presence of higher levels of Rep78, consistent with those produced during helper virus rescue and productive infection. Under these conditions, all of the mutants were compromised at the level of replication, and the USF replacement resulted in detectable replication product. In agreement with Francois (5), we found that any perturbation of the TATA/RBE sequence complex had a negative influence on replication. Notably, a relatively modest sequence insertion of TTAA between the p5 TATTTAA and the RBE had a profound influence on replication. Additionally, in a construct where the wt p5 TATA was engineered to have a single base substitution and a single upstream substitution (GTATTTATTAATTAA; substitutions are in boldface and conserved sequence is underlined) transcription, integration, and replication were all severely compromised (data not shown). In contrast to the sensitivity of the TATA region to manipulation, when p5 RBE was replaced with the ITR RBE or the AAVS1 RBE, minimal impact on replication was detected. Although assay conditions used for p5CAT replication involved high levels of Rep78, the overall results were largely consistent with the assays used to characterize p5 promoter activity, and the results indicate that the overall integrity of the p5 promoter is important to maintenance of efficient p5 Rep-dependent ori function.

Is the Rep complex forming on the p5IEE under latency conditions able to nick and facilitate DNA replication through host DNA repair mechanisms? The observations that AAVS1 and integrating substrate DNA undergo amplification during RMSSI (7) would support such an event on both target and substrate DNAs. Importantly, we anticipate that the Rep endonuclease/replication complex that functions to facilitate p5 RMSSI is not the same as that provided by helper virus infection during AAV2 replication and, specifically, not the one that forms on the AAV2 ITR ori, which is independent of a TBP-TATA interaction. Based on the data presented in this report, we find a strong correlation between a transcriptionally active p5 promoter sensitive to Rep repression with a p5 element that functions in a Rep-dependent replication assay and in RMSSI.

Taken together, each of the Rep-dependent biological activities assigned to the p5 promoter are envisioned as contributing to efficient RMSSI. We consider four Rep-dependent activities as occurring in RMSSI. (i) Rep mediates activation of AAVS1. In vitro AAVS1 activation involves Rep-dependent nicking and asymmetric replication (36), consistent with Rep-dependent amplification of the AAVS1 site independent of an integration substrate. (ii) Rep needs to form an integration complex with the target substrate DNA. We believe the p5 promoter provides a specific DNA protein structure that is a landing pad for a Rep-TBP complex, and the interaction of this complex with the p5 promoter (nicking) establishes a preferred integration/recombination substrate. (iii) Rep complex formation on the p5IEE facilitates colocalization to the Rep DNA complex formed on AAVS1 (30). (iv) Establishment of Rep-dependent nicking and replication functions on both the p5IEE and the AAVS1 facilitates a nonhomologous recombination event in the region of AAVS1.

All of the experiments carried out in this study have relied on plasmid-based transfection protocols focusing on the function of a minimal p5IEE element. With this system, we found that the function of the p5IEE can be influenced by the DNA sequence and structure surrounding the p5IEE. The function of the p5IEE as presented in the wt AAV genome may also be influenced by surrounding elements, particularly the ITR elements which are known to have enhancer function (4), and the nature of the viral genome presented as a single-stranded DNA undergoing conversion to a monomeric or dimeric duplex structure. Studies using recombinant AAV vectors in RMSSI studies will provide valuable insight into how the p5IEE functions under conditions presented during viral infections.

If the p5IEE is to be used to facilitate RMSSI of a designated transgene (16), the results presented in this study indicate that the original intact p5 or p5IEE element is the most efficient target substrate tested when Rep is expressed from a nonintegrating expression cassette. We are in the process of developing Rep expression cassettes that may offer a further enhancement of integration efficiency. Transient expression of an optimal level of Rep should allow integration efficiencies that approach those found in previous studies using high MOIs of AAV2 infection into HeLa cells (7) without causing a high level of cytotoxicity.

 
* Corresponding author. Mailing address: Weill Medical College of Cornell University, Department of Microbiology and Immunology Box 62, 1300 York Ave., New York, NY 10021. Phone: (212) 746-6514. Fax: (212) 746-8587. E-mail: efalckp{at}med.cornell.edu

Published ahead of print on 31 January 2007.

M.M. and J.G.-K. contributed equally to this work.

Present address: Department of Biological Sciences, City University of New York, Hunter College, New York, NY 10021.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Beaton, A., P. Palumbo, and K. I. Berns. 1989. Expression from the adeno-associated virus p5 and p19 promoters is negatively regulated in trans by the Rep protein. J. Virol. 63:4450-4454.[Abstract/Free Full Text]
2
2. Chang, L. S., Y. Shi, and T. Shenk. 1989. Adeno-associated virus P5 promoter contains an adenovirus E1A-inducible element and a binding site for the major late transcription factor. J. Virol. 63:3479-3488.[Abstract/Free Full Text]
3
3. Chiorini, J. A., S. M. Wiener, R. A. Owens, S. R. Kyostio, R. M. Kotin, and B. Safer. 1994. Sequence requirements for stable binding and function of Rep68 on the adeno-associated virus type 2 inverted terminal repeats. J. Virol. 68:7448-7457.[Abstract/Free Full Text]
4
4. Flotte, T. R., R. Solow, R. A. Owens, S. Afione, P. L. Zeitlin, and B. J. Carter. 1992. Gene expression from adeno-associated virus vectors in airway epithelial cells. Am. J. Respir. Cell Mol. Biol. 7:349-356.[Medline]
5
5. Francois, A., M. Guilbaud, R. Awedikian, G. Chadeuf, P. Moullier, and A. Salvetti. 2005. The cellular TATA binding protein is required for rep-dependent replication of a minimal adeno-associated virus type 2 p5 element. J. Virol. 79:11082-11094.[Abstract/Free Full Text]
6
6. Gall, J., A. Kass-Eisler, L. Leinwand, and E. Falck-Pedersen. 1996. Adenovirus type 5 and 7 capsid chimera: fiber replacement alters receptor tropism without affecting primary immune neutralization epitopes. J. Virol. 70:2116-2123.[Abstract]
7
7. Hamilton, H., J. Gomos, K. I. Berns, and E. Falck-Pedersen. 2004. Adeno-associated virus site-specific integration and AAVS1 disruption. J. Virol. 78:7874-7882.[Abstract/Free Full Text]
8
8. Hermonat, P. L., M. A. Labow, R. Wright, K. I. Berns, and N. Muzyczka. 1984. Genetics of adeno-associated virus: isolation and preliminary characterization of adeno-associated virus type 2 mutants. J. Virol. 51:329-339.[Abstract/Free Full Text]
9
9. Hermonat, P. L., A. D. Santin, R. B. Batchu, and D. Zhan. 1998. The adeno-associated virus Rep78 major regulatory protein binds the cellular TATA-binding protein in vitro and in vivo. Virology 245:120-127.[CrossRef][Medline]
10
10. Horer, M., S. Weger, K. Butz, F. Hoppe-Seyler, C. Geisen, and J. A. Kleinschmidt. 1995. Mutational analysis of adeno-associated virus Rep protein-mediated inhibition of heterologous and homologous promoters. J. Virol. 69:5485-5496.[Abstract]
11
11. Huser, D., and R. Heilbronn. 2003. Adeno-associated virus integrates site-specifically into human chromosome 19 in either orientation and with equal kinetics and frequency. J. Gen. Virol. 84:133-137.[Abstract/Free Full Text]
12
12. Huser, D., S. Weger, and R. Heilbronn. 2002. Kinetics and frequency of adeno-associated virus site-specific integration into human chromosome 19 monitored by quantitative real-time PCR. J. Virol. 76:7554-7559.[Abstract/Free Full Text]
13
13. Kotin, R. M., M. Siniscalco, R. J. Samulski, X. D. Zhu, L. Hunter, C. A. Laughlin, S. McLaughlin, N. Muzyczka, M. Rocchi, and K. I. Berns. 1990. Site-specific integration by adeno-associated virus. Proc. Natl. Acad. Sci. USA. 87:2211-2215.[Abstract/Free Full Text]
14
14. Kyostio, S. R., R. S. Wonderling, and R. A. Owens. 1995. Negative regulation of the adeno-associated virus (AAV) p5 promoter involves both the p5 Rep binding site and the consensus ATP-binding motif of the AAV Rep68 protein. J. Virol. 69:6787-6796.[Abstract]
15
15. Linden, R. M., P. Ward, C. Giraud, E. Winocour, and K. I. Berns. 1996. Site-specific integration by adeno-associated virus. Proc. Natl. Acad. Sci. USA. 93:11288-11294.[Abstract/Free Full Text]
16
16. Liu, Q., C. F. Perez, and Y. Wang. 2006. Efficient site-specific integration of large transgenes by an enhanced herpes simplex virus/adeno-associated virus hybrid amplicon vector. J. Virol. 80:1672-1679.[Abstract/Free Full Text]
17
17. McCarty, D. M., T. H. Ni, and N. Muzyczka. 1992. Analysis of mutations in adeno-associated virus Rep protein in vivo and in vitro. J. Virol. 66:4050-4057.[Abstract/Free Full Text]
18
18. McCarty, D. M., D. J. Pereira, I. Zolotukhin, X. Zhou, J. H. Ryan, and N. Muzyczka. 1994. Identification of linear DNA sequences that specifically bind the adeno-associated virus Rep protein. J. Virol. 68:4988-4997.[Abstract/Free Full Text]
19
19. McCarty, D. M., S. M. Young, Jr., and R. J. Samulski. 2004. Integration of adeno-associated virus (AAV) and recombinant AAV vectors. Annu. Rev. Genet. 38:819-845.[CrossRef][Medline]
20
20. Miller, S. A., D. D. Dykes, and H. F. Polesky. 1988. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 16:1215.[Free Full Text]
21
21. Muzyczka, N., and K. I. Berns. 2001. Parvoviridae: the viruses and their replication, p. 2327-2360. In B. N. Fields, D. M. Knipe, P. M. Howley, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman, and S. E. Straus (ed.), Fields virology, 4th ed. Lippincott Williams & Wilkins, Philadelphia, PA.
22
22. Needham, P. G., J. M. Casper, V. Kalman-Maltese, K. Verrill, J. D. Dignam, and J. P. Trempe. 2006. Adeno-associated virus Rep protein-mediated inhibition of transcription of the adenovirus major late promoter in vitro. J. Virol. 80:6207-6217.[Abstract/Free Full Text]
23
23. Nony, P., J. Tessier, G. Chadeuf, P. Ward, A. Giraud, M. Dugast, R. M. Linden, P. Moullier, and A. Salvetti. 2001. Novel cis-acting replication element in the adeno-associated virus type 2 genome is involved in amplification of integrated rep-cap sequences. J. Virol. 75:9991-9994.[Abstract/Free Full Text]
24
24. Owens, R. A., M. D. Weitzman, S. R. Kyostio, and B. J. Carter. 1993. Identification of a DNA-binding domain in the amino terminus of adeno-associated virus Rep proteins. J. Virol. 67:997-1005.[Abstract/Free Full Text]
25
25. Pereira, D. J., and N. Muzyczka. 1997. The cellular transcription factor SP1 and an unknown cellular protein are required to mediate Rep protein activation of the adeno-associated virus p19 promoter. J. Virol. 71:1747-1756.[Abstract]
26
26. Philpott, N. J., C. Giraud-Wali, C. Dupuis, J. Gomos, H. Hamilton, K. I. Berns, and E. Falck-Pedersen. 2002. Efficient integration of recombinant adeno-associated virus DNA vectors requires a p5-rep sequence in cis. J. Virol. 76:5411-5421.[Abstract/Free Full Text]
27
27. Philpott, N. J., J. Gomos, K. I. Berns, and E. Falck-Pedersen. 2002. A p5 integration efficiency element mediates Rep-dependent integration into AAVS1 at chromosome 19. Proc. Natl. Acad. Sci. USA. 99:12381-12385.[Abstract/Free Full Text]
28
28. Snyder, R. O., D. S. Im, T. Ni, X. Xiao, R. J. Samulski, and N. Muzyczka. 1993. Features of the adeno-associated virus origin involved in substrate recognition by the viral Rep protein. J. Virol. 67:6096-6104.[Abstract/Free Full Text]
29
29. Su, P. F., S. Y. Chiang, C. W. Wu, and F. Y. Wu. 2000. Adeno-associated virus major Rep78 protein disrupts binding of TATA-binding protein to the p97 promoter of human papillomavirus type 16. J. Virol. 74:2459-2465.[Abstract/Free Full Text]
30
30. Surosky, R. T., M. Urabe, S. G. Godwin, S. A. McQuiston, G. J. Kurtzman, K. Ozawa, and G. Natsoulis. 1997. Adeno-associated virus Rep proteins target DNA sequences to a unique locus in the human genome. J. Virol. 71:7951-7959.[Abstract]
31
31. Tan, I., C. H. Ng, L. Lim, and T. Leung. 2001. Phosphorylation of a novel myosin binding subunit of protein phosphatase 1 reveals a conserved mechanism in the regulation of actin cytoskeleton. J. Biol. Chem. 276:21209-21216.[Abstract/Free Full Text]
32
32. Tessier, J., G. Chadeuf, P. Nony, H. Avet-Loiseau, P. Moullier, and A. Salvetti. 2001. Characterization of adenovirus-induced inverted terminal repeat-independent amplification of integrated adeno-associated virus rep-cap sequences. J. Virol. 75:375-383.[Abstract/Free Full Text]
33
33. Tratschin, J. D., I. L. Miller, and B. J. Carter. 1984. Genetic analysis of adeno-associated virus: properties of deletion mutants constructed in vitro and evidence for an adeno-associated virus replication function. J. Virol. 51:611-619.[Abstract/Free Full Text]
34
34. Tsunoda, H., T. Hayakawa, N. Sakuragawa, and H. Koyama. 2000. Site-specific integration of adeno-associated virus-based plasmid vectors in lipofected HeLa cells. Virology 268:391-401.[CrossRef][Medline]
35
35. Tullis, G. E., and T. Shenk. 2000. Efficient replication of adeno-associated virus type 2 vectors: a cis-acting element outside of the terminal repeats and a minimal size. J. Virol. 74:11511-11521.[Abstract/Free Full Text]
36
36. Urcelay, E., P. Ward, S. M. Wiener, B. Safer, and R. M. Kotin. 1995. Asymmetric replication in vitro from a human sequence element is dependent on adeno-associated virus Rep protein. J. Virol. 69:2038-2046.[Abstract]
37
37. Wang, X. S., and A. Srivastava. 1997. A novel terminal resolution-like site in the adeno-associated virus type 2 genome. J. Virol. 71:1140-1146.[Abstract]
38
38. Wang, X. S., and A. Srivastava. 1998. Rescue and autonomous replication of adeno-associated virus type 2 genomes containing Rep-binding site mutations in the viral p5 promoter. J. Virol. 72:4811-4818.[Abstract/Free Full Text]
39
39. Ward, P., P. Elias, and R. M. Linden. 2003. Rescue of the adeno-associated virus genome from a plasmid vector: evidence for rescue by replication. J. Virol. 77:11480-11490.[Abstract/Free Full Text]
40
40. Weger, S., M. Wendland, J. A. Kleinschmidt, and R. Heilbronn. 1999. The adeno-associated virus type 2 regulatory proteins Rep78 and Rep68 interact with the transcriptional coactivator PC4. J. Virol. 73:260-269.[Abstract/Free Full Text]
41
41. Weitzman, M. D., S. R. Kyostio, R. M. Kotin, and R. A. Owens. 1994. Adeno-associated virus (AAV) Rep proteins mediate complex formation between AAV DNA and its integration site in human DNA. Proc. Natl. Acad. Sci. USA. 91:5808-5812.[Abstract/Free Full Text]
42
42. Zolotukhin, S., M. Potter, W. W. Hauswirth, J. Guy, and N. Muzyczka. 1996. A "humanized" green fluorescent protein cDNA adapted for high-level expression in mammalian cells. J. Virol. 70:4646-4654.[Abstract]

---

Journal of Virology, April 2007, p. 3721-3730, Vol. 81, No. 8
0022-538X/07/$08.00+0     doi:10.1128/JVI.02693-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Guilbaud, M., Chadeuf, G., Avolio, F., Francois, A., Moullier, P., Recchia, A., Salvetti, A. (2008). Relative Influence of the Adeno-Associated Virus (AAV) Type 2 p5 Element for Recombinant AAV Vector Site-Specific Integration. J. Virol. 82: 2590-2593 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Murphy, M. Articles by Falck-Pedersen, E. Search for Related Content PubMed PubMed Citation Articles by Murphy, M. Articles by Falck-Pedersen, E.