This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Larrea, E.
Right arrow Articles by Prieto, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Larrea, E.
Right arrow Articles by Prieto, J.

 Previous Article  |  Next Article 

Journal of Virology, April 2007, p. 3662-3666, Vol. 81, No. 7
0022-538X/07/$08.00+0     doi:10.1128/JVI.02248-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Upregulation of Indoleamine 2,3-Dioxygenase in Hepatitis C Virus Infection{triangledown}

Esther Larrea,1,{dagger} José I. Riezu-Boj,1,{dagger} Lucía Gil-Guerrero,1,{dagger} Noelia Casares,1 Rafael Aldabe,1 Pablo Sarobe,1 María P. Civeira,2 Jonathan L. Heeney,3 Christine Rollier,3 Babs Verstrepen,3 Takaji Wakita,4 Francisco Borrás-Cuesta,1 Juan J. Lasarte,1,{ddagger}* and Jesús Prieto1,2,{ddagger}*

Division of Hepatology and Gene Therapy, Center for Applied Medical Research (CIMA), University of Navarra,1 Liver Unit, University Clinic, University of Navarra, CIBERedh, Pamplona, Spain,2 Department of Virology, Biomedical Primate Research Centre, Rijswijk, The Netherlands,3 Department of Virology II, National Institute of Infectious Diseases, Tokyo, Japan4

Received 13 October 2006/ Accepted 3 January 2007


arrow
ABSTRACT
 
Indoleamine 2,3-dioxygenase (IDO) is induced by proinflammatory cytokines and by CTLA-4-expressing T cells and constitutes an important mediator of peripheral immune tolerance. In chronic hepatitis C, we found upregulation of IDO expression in the liver and an increased serum kynurenine/tryptophan ratio (a reflection of IDO activity). Huh7 cells supporting hepatitis C virus (HCV) replication expressed higher levels of IDO mRNA than noninfected cells when stimulated with gamma interferon or when cocultured with activated T cells. In infected chimpanzees, hepatic IDO expression decreased in animals that cured the infection, while it remained high in those that progressed to chronicity. For both patients and chimpanzees, hepatic expression of IDO and CTLA-4 correlated directly. Induction of IDO may dampen T-cell reactivity to viral antigens in chronic HCV infection.


arrow
TEXT
 
Indoleamine 2,3-dioxygenase (IDO) mediates conversion of tryptophan to catabolites collectively known as kynurenines (22). This enzyme is expressed by both epithelial and dendritic cells induced by proinflammatory cytokines, including gamma interferon (IFN-{gamma}) and tumor necrosis factor alpha (20, 25). Also, engagement of CTLA-4 with CD80/CD86 on the membrane of dendritic cells stimulates IDO transcriptional expression and activity (4, 9, 19). Increased IDO activity provokes tolerogenicity of antigen-presenting cells and deprives T cells of tryptophan, leading to proliferation arrest and T-cell apoptosis (15). Kynurenine, on the other hand, has been shown to act as an immunoregulatory molecule that mediates immunosuppressive effects in the tissue microenvironment (7, 22, 26). IDO activity contributes to maternal tolerance in pregnancy (21), control of allograft rejection (9), and protection against autoimmunity (8).

Chronic infection caused by hepatitis C virus (HCV) is characterized by weak T-cell responses, recognizing very few epitopes. In contrast, viral clearance after acute infection or after interferon therapy is associated with the presence of a robust and polyclonal T-cell reaction (2, 3, 6, 10, 14, 18, 23, 24). Thus, HCV has developed efficient means to escape T-cell immunity, thus causing a high rate of chronic infections. The molecular mechanisms that are responsible for immune tolerance to HCV antigens remains ill understood. Since IDO activity may dampen T-cell reactivity and can contribute to tolerogenicity of dendritic cells (17), we have analyzed IDO expression by quantitative real-time PCR using ß-actin gene expression as an endogenous control (12, 13) (IDO sense primer, TGGCACACGCTATGGAAAAC; antisense, ATGCATCCCAGAACTAGACG; ß-actin sense primer, AGCCTCGCCTTTGCCGA; antisense, CTGGTGCCTGGGGCG) in liver samples from patients with chronic hepatitis C (CHC), subjects with sustained virological response (SVR) after interferon therapy, and patients with other forms of chronic liver inflammation (chronic hepatitis B and steatohepatitis) and in normal liver samples (Table 1, cohort 1). IDO mRNA levels were significantly higher in the CHC group than in the other groups. Patients with other forms of liver disease had values higher than those for normal livers but lower than the CHC values (Fig. 1A). Subjects with SVR showed values similar to those for controls.


View this table:
[in this window]
[in a new window]

  		TABLE 1. Characteristics of patient cohorts


Figure 1
View larger version (12K):
[in this window]
[in a new window]

  		FIG. 1. IDO and HCV infection. (A) Real-time PCR quantitation of IDO mRNA in liver samples from normal livers, from patients with chronic hepatitis C (CHC), from patients with CHC who cleared the virus after interferon therapy (SVR), or from a miscellaneous group of patients with liver disorders unrelated to HCV. Results are normalized with ß-actin. (B) Kynurenine/tryptophan ratio in serum samples from individuals belonging to groups equivalent to those shown in panel A. Statistical analyses were performed using nonparametric Kruskal-Wallis and Mann-Whitney U tests. ns, not significant.

As an index of IDO activity, we measured the serum kynurenine/tryptophan ratio (KTR) for equivalent groups of patients and for healthy controls (Table 1, cohort 2). KTR was determined by high-performance liquid chromatography (27). We found that KTR was significantly higher for the CHC group than for the other groups, which did not show significant differences among them (Fig. 1B). Since both IDO mRNA levels and serum KTRs are significantly higher for CHC than in other forms of liver disease (see Fig. 1A and B), it seems possible that HCV might be especially efficient at facilitating IDO overexpression in an inflamed milieu.

To determine whether HCV replication may enhance IDO expression in response to proinflammatory cytokines, we stimulated with IFN-{gamma} (100 U/ml; R&D Systems, Minneapolis, MN), for 16, 24, and 40 h, Huh7 cells containing the full-length HCV replicon (Huh7-Core-3') (12, 16), Huh7 cells producing JFH1-HCV viral particles (28), and control cells. JFH1-Huh7 cells were used at 30 to 35 days postinfection, when about 50 to 60% of cells were positive for the HCV core protein, as determined by immunofluorescence. As shown in Fig. 2A and B, both Huh7-Core-3' cells and Huh7 cells producing JFH1 generated increased amounts of IDO mRNA in response to IFN-{gamma} at all time points compared to control Huh7 cells. These findings indicate that HCV replication sensitizes the cells to produce IDO at high levels in response to IFN-{gamma}, a proinflammatory cytokine that is upregulated in the livers of patients with CHC (1). IDO upregulation in response to IFN-{gamma} does not affect the replicative activity of HCV in the infected cells, since treatment of the cells with IFN-{gamma} plus an IDO inhibitor (1-methyl tryptophan) or plus kynurenine did not provoke changes in HCV-RNA levels in the infected cells with respect to those observed with treatment of the cells with IFN-{gamma} alone (data not shown). It seems, therefore, that IDO upregulation may represent a strategy of HCV to escape T-cell immunity rather than a mechanism directly influencing HCV replication.


Figure 2
View larger version (25K):
[in this window]
[in a new window]

  		FIG. 2. Induction of IDO mRNA expression by HCV replication. Quantitation of IDO mRNA levels by real-time PCR in Huh7 cells with or without HCV replicon (Huh7-Core-3') (A) or JFH1 virus (B), treated with 100 U/ml of IFN-{gamma} for 0, 16, 24, or 40 h. Results are expressed as the mean ± standard deviations of one representative experiment out of three experiments performed in sextuplicate. (C and D) IDO and IFN-{gamma} mRNA levels measured by real-time PCR in CD4+ CD25– cells cocultured for 1 day with Huh7 cells with or without HCV-JFH1 in the presence of Dynabeads CD3/CD28 T-cell expander. All results are normalized with ß-actin. Statistical analyses were performed using the nonparametric Mann-Whitney U test. (*, P < 0.01; Huh7-core 3' versus Huh7 or Huh7 plus JFH1 versus Huh7). ns, not significant.

Our data suggest that one of the strategies used by HCV to resist immune attack is by promoting IDO expression when infected hepatocytes interact with effector T cells producing IFN-{gamma}. To test this hypothesis, Huh7 cells infected with JFH1 and control Huh7 cells were cocultured with 1.2 x 105 CD4+ CD25– cells from a healthy subject (using the negative fraction of the CD4+CD25+ Regulatory T Cell Isolation kit; Miltenyi Biotec, Bergisch Gladbach, Germany) in the presence of the Dynabeads CD3/CD28 T-cell expander (Dynal biotech, Oslo, Norway) to activate T cells. After 1 day, the coculture was collected and both IFN-{gamma} mRNA and IDO mRNA were determined by quantitative real-time PCR (IFN-{gamma} sense primer, CTCTGCATCGTTTTGGGTTC; antisense, GCGTTGGACATTCAAGTCAG). As shown in Fig. 2C and D, the induction of IFN-{gamma} was similar in cocultures containing control and infected Huh7 cells, but the expression of IDO was significantly higher in HCV-infected cultures. Since IDO levels were about 100-fold higher in coculture experiments than in experiments using exogenous IFN-{gamma}, whether other factors apart from IFN-{gamma}, such as cell contact, might be involved in this high IDO upregulation was studied. Thus, when supernatant from activated CD4+ CD25– T cells was added to infected or noninfected Huh7 cells, differences in IDO upregulation were not observed (data not shown). It appears, therefore, that IDO induction is mainly facilitated by cell contact between infected cells and activated T lymphocytes. Whether IDO induction in livers with CHC takes place in infected hepatocytes and/or in inflammatory mononuclear cells has not been analyzed in the present work. However, our data for HCV-infected hepatoma cells suggest that hepatocytes are at least partially responsible for the elevated hepatic levels of IDO found in CHC.

There is an intricate cross talk between IDO and CTLA-4 (17). It has been shown that tryptophan depletion together with the presence of kynurenines promotes the expression of inhibitory molecules, such as CTLA-4 and Foxp3, in T cells (5). On the other hand, CTLA-4 stimulates IDO expression and IDO activity in antigen-presenting cells, inducing tolerogenic dendritic cells (17). Thus, we investigated whether IDO expression in the liver might correlate with the abundance of CTLA-4 mRNA in this organ. By using quantitative real-time PCR (CTLA-4 sense primer, TCATGTACCCACCGCCATAC; antisense, TAGACCCCTGTTGTAAGAGG), we found that CTLA-4 mRNA levels were increased in liver biopsy samples from HCV-infected patients over those in normal hepatic tissue or in samples from patients with SVR or other forms of liver disease (Fig. 3A). A significant direct correlation was found between IDO mRNA levels and CTLA-4 mRNA levels in liver tissue from HCV-infected patients (r = 0.52; P < 0.01) (Fig. 3B).


Figure 3
View larger version (24K):
[in this window]
[in a new window]

  		FIG. 3. CTLA-4 and HCV infection. (A) Real-time PCR quantitation of CTLA-4 mRNA in samples from normal livers or from livers from patients with CHC, from patients with CHC who cleared the virus after interferon therapy (SVR), or from a miscellaneous group of patients with liver disorders unrelated to HCV. Statistical analyses were performed using nonparametric Kruskal-Wallis and Mann-Whitney U tests. ns, not significant. (B) Correlation between mRNA levels of IDO and CTLA-4 in liver samples from CHC patients. (C and D) Real-time PCR quantitation of IDO and CTLA-4 mRNA levels in liver samples from chimpanzees obtained at different time points before and after infection with infective HCV inocula, with 0 being the week of infection. Solid lines, chimpanzees who cleared HCV infection; dotted lines, chimpanzees who did not clear HCV infection. (E) Correlation between mRNA levels of IDO and CTLA-4 in liver samples from the chimpanzees described above. Results in panels A, C, and D are normalized with ß-actin.

Liver biopsies are not routinely performed for patients with acute hepatitis C. Thus, in order to investigate the role of hepatic IDO expression in the evolution of HCV infection, we analyzed serial liver biopsy samples obtained from six chimpanzees after they were infected with 25 50% chimpanzee infectious doses of the HCV 1b J4 virus stock (Robert H. Purcell, NIAID, NIH, Bethesda, MD). This study was approved by independent ethical committees in accordance with international regulations (International Animal Care and Use Committee). As shown in Fig. 3C, hepatic IDO mRNA declined after an initial peak and remained low during evolution in animals that cleared the virus, while in the chimpanzees that evolved to chronicity, the initial peak of IDO expression was lower but the levels remained elevated during evolution. Thus, both in chimpanzees and in humans, chronic HCV infection is associated with persistently high IDO expression in the liver. An initial short-lived upregulation of IDO in the animals that cleared the virus might be secondary to the induction of a potent and efficient immune response. In fact, an early and transient upsurge of IDO might take place in association with activation of dendritic cells and T-cell immunity (11), while persistent IDO overexpression may favor tolerance (17). Our findings for acute infection in chimpanzees lend support to this contention.

In parallel to IDO results, for chimps that cured the infection, CTLA-4 expression in the liver showed an initial peak and then remained stable at very low levels during the evolution of the disease (Fig. 3D). In contrast, for chimps that became chronic carriers, expression of CTLA-4 showed little change during the early phase of infection but tended to persist above basal values along the course of the infection (Fig. 3D). As with humans, we found a significant direct correlation between IDO and CTLA-4 mRNA values in the liver (Fig. 3E).

In summary, we show upregulation of IDO in the livers of patients and chimpanzees with chronic hepatitis C. This finding is associated, and correlates, with overexpression of CTLA-4 in liver tissue. Our data indicate that HCV infection facilitates the induction of IDO in response to proinflammatory cytokines and activated T cells. This may constitute an efficient strategy of the virus to escape T-cell immunity. Our findings point to novel targets for therapeutic intervention.


arrow
ACKNOWLEDGMENTS
 
We thank E. Elizalde, S. Jusué, M. Corres, V. Villar, and M. Gorraiz for their technical support and R. Bartenschlager for kindly providing the HCV replicon.

This work was supported by grants from Instituto de Salud Carlos III, Ref PI060149, PI051098, and 03/0566, from Ministerio de Educación y Ciencia (SAF2004-01680), from Fundación de Investigación Médica Mutua Madrileña, and from the European Union (QLK2-CT-1999-00356). T. Wakita is supported by a grant-in-aid for Scientific Research from the Japan Society for the Promotion of Science, from the Ministry of Health, Labor and Welfare of Japan, and from the Ministry of Education, Culture, Sports, Science and Technology. This project was also funded by "UTE project CIMA."


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Division of Gene Therapy and Hepatology, Center for Applied Medical Research, CIMA, Avenida Pío XII, 55, 31008 Pamplona, Spain. Phone: 34 948 194700. Fax: 34 948 194717. E-mail for Juan José Lasarte: jjlasarte{at}unav.es. E-mail for Jesús Prieto: jprieto{at}unav.es. Back

{triangledown} Published ahead of print on 17 January 2007. Back

{dagger} E.L., J.I.R.-B., and L.G.-G. contributed equally to this work. Back

{ddagger} J. J. Lasarte and J. Prieto are senior authors of this article. Back


arrow
REFERENCES
 
    1
  1. Abbate, I., M. Romano, R. Longo, G. Cappiello, O. Lo Iacono, V. Di Marco, C. Paparella, A. Spano, and M. R. Capobianchi. 2003. Endogenous levels of mRNA for IFNs and IFN-related genes in hepatic biopsies of chronic HCV-infected and non-alcoholic steatohepatitis patients. J. Med. Virol. 70:581-587.[CrossRef][Medline]
    2. 2
  2. Botarelli, P., M. R. Brunetto, M. A. Minutello, P. Calvo, D. Unutmaz, A. J. Weiner, Q. L. Choo, J. R. Shuster, G. Kuo, F. Bonino, M. Houghton, and S. Abrignani. 1993. T-lymphocyte response to hepatitis C virus in different clinical courses of infection. Gastroenterology 104:580-587.[Medline]
    3. 3
  3. Diepolder, H. M., R. Zachoval, R. M. Hoffmann, E. A. Wierenga, T. Santantonio, M. C. Jung, D. Eichenlaub, and G. R. Pape. 1995. Possible mechanism involving T-lymphocyte response to non-structural protein 3 in viral clearance in acute hepatitis C virus infection. Lancet 346:1006-1007.[CrossRef][Medline]
    4. 4
  4. Fallarino, F., U. Grohmann, K. W. Hwang, C. Orabona, C. Vacca, R. Bianchi, M. L. Belladonna, M. C. Fioretti, M. L. Alegre, and P. Puccetti. 2003. Modulation of tryptophan catabolism by regulatory T cells. Nat. Immunol. 4:1206-1212.[CrossRef][Medline]
    5. 5
  5. Fallarino, F., U. Grohmann, S. You, B. C. McGrath, D. R. Cavener, C. Vacca, C. Orabona, R. Bianchi, M. L. Belladonna, C. Volpi, P. Santamaria, M. C. Fioretti, and P. Puccetti. 2006. The combined effects of tryptophan starvation and tryptophan catabolites down-regulate T cell receptor zeta-chain and induce a regulatory phenotype in naive T cells. J. Immunol. 176:6752-6761.[Abstract/Free Full Text]
    6. 6
  6. Ferrari, C., A. Valli, L. Galati, A. Penna, P. Scaccaglia, T. Giuberti, C. Schianchi, G. Missale, M. G. Marin, and F. Fiaccadori. 1994. T-cell response to structural and nonstructural hepatitis C virus antigens in persistent and self-limited hepatitis C virus infections. Hepatology 19:286-295.[CrossRef]
    7. 7
  7. Frumento, G., R. Rotondo, M. Tonetti, G. Damonte, U. Benatti, and G. B. Ferrara. 2002. Tryptophan-derived catabolites are responsible for inhibition of T and natural killer cell proliferation induced by indoleamine 2,3-dioxygenase. J. Exp. Med. 196:459-468.[Abstract/Free Full Text]
    8. 8
  8. Grohmann, U., F. Fallarino, R. Bianchi, C. Orabona, C. Vacca, M. C. Fioretti, and P. Puccetti. 2003. A defect in tryptophan catabolism impairs tolerance in nonobese diabetic mice. J. Exp. Med. 198:153-160.[Abstract/Free Full Text]
    9. 9
  9. Grohmann, U., C. Orabona, F. Fallarino, C. Vacca, F. Calcinaro, A. Falorni, P. Candeloro, M. L. Belladonna, R. Bianchi, M. C. Fioretti, and P. Puccetti. 2002. CTLA-4-Ig regulates tryptophan catabolism in vivo. Nat. Immunol. 3:1097-1101.[CrossRef][Medline]
    10. 10
  10. Hoffmann, R. M., H. M. Diepolder, R. Zachoval, F. M. Zwiebel, M. C. Jung, S. Scholz, H. Nitschko, G. Riethmuller, and G. R. Pape. 1995. Mapping of immunodominant CD4+ T lymphocyte epitopes of hepatitis C virus antigens and their relevance during the course of chronic infection. Hepatology 21:632-638.[CrossRef]
    11. 11
  11. Hwang, S. L., N. P. Chung, J. K. Chan, and C. L. Lin. 2005. Indoleamine 2,3-dioxygenase (IDO) is essential for dendritic cell activation and chemotactic responsiveness to chemokines. Cell Res. 15:167-175.[CrossRef][Medline]
    12. 12
  12. Larrea, E., R. Aldabe, E. Molano, C. M. Fernandez-Rodriguez, A. Ametzazurra, M. P. Civeira, and J. Prieto. 2006. Altered expression and activation of STATs (signal transduction and activator of transcription) in HCV infection: in vivo and in vitro studies. Gut 55:1179-1187.
    13. 13
  13. Larrea, E., R. Aldabe, J. I. Riezu-Boj, A. Guitart, M. P. Civeira, J. Prieto, and E. Baixeras. 2004. IFN-alpha5 mediates stronger Tyk2-stat-dependent activation and higher expression of 2',5'-oligoadenylate synthetase than IFN-alpha2 in liver cells. J. Interferon Cytokine Res. 24:497-503.[CrossRef][Medline]
    14. 14
  14. Lasarte, J. J., M. Garcia Granero, A. Lopez, N. Casares, N. Garcia, M. P. Civeira, F. Borras Cuesta, and J. Prieto. 1998. Cellular immunity to hepatitis C virus core protein and the response to interferon in patients with chronic hepatitis C. Hepatology 28:815-822.[CrossRef]
    15. 15
  15. Lee, G. K., H. J. Park, M. Macleod, P. Chandler, D. H. Munn, and A. L. Mellor. 2002. Tryptophan deprivation sensitizes activated T cells to apoptosis prior to cell division. Immunology 107:452-460.[CrossRef][Medline]
    16. 16
  16. Lohmann, V., F. Korner, J. Koch, U. Herian, L. Theilmann, and R. Bartenschlager. 1999. Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell line. Science 285:110-113.[Abstract/Free Full Text]
    17. 17
  17. Mellor, A. L., and D. H. Munn. 2004. IDO expression by dendritic cells: tolerance and tryptophan catabolism. Nat. Rev. Immunol. 4:762-774.[CrossRef][Medline]
    18. 18
  18. Missale, G., R. Bertoni, V. Lamonaca, A. Valli, M. Massari, C. Mori, M. G. Rumi, M. Houghton, F. Fiaccadori, and C. Ferrari. 1996. Different clinical behaviors of acute hepatitis C virus infection are associated with different vigor of the anti-viral cell-mediated immune response. J. Clin. Investig. 98:706-714.[Medline]
    19. 19
  19. Miwa, N., S. Hayakawa, S. Miyazaki, S. Myojo, Y. Sasaki, M. Sakai, O. Takikawa, and S. Saito. 2005. IDO expression on decidual and peripheral blood dendritic cells and monocytes/macrophages after treatment with CTLA-4 or interferon-{gamma} increase in normal pregnancy but decrease in spontaneous abortion. Mol. Hum. Reprod. 11:865-870.[Abstract/Free Full Text]
    20. 20
  20. Munn, D. H. 2006. Indoleamine 2,3-dioxygenase, tumor-induced tolerance and counter-regulation. Curr. Opin. Immunol. 18:220-225.[CrossRef][Medline]
    21. 21
  21. Munn, D. H., M. Zhou, J. T. Attwood, I. Bondarev, S. J. Conway, B. Marshall, C. Brown, and A. L. Mellor. 1998. Prevention of allogeneic fetal rejection by tryptophan catabolism. Science 281:1191-1193.[Abstract/Free Full Text]
    22. 22
  22. Platten, M., P. P. Ho, S. Youssef, P. Fontoura, H. Garren, E. M. Hur, R. Gupta, L. Y. Lee, B. A. Kidd, W. H. Robinson, R. A. Sobel, M. L. Selley, and L. Steinman. 2005. Treatment of autoimmune neuroinflammation with a synthetic tryptophan metabolite. Science 310:850-855.[Abstract/Free Full Text]
    23. 23
  23. Rehermann, B., K. M. Chang, J. G. McHutchison, R. Kokka, M. Houghton, and F. V. Chisari. 1996. Quantitative analysis of the peripheral blood cytotoxic T lymphocyte response in patients with chronic hepatitis C virus infection. J. Clin. Investig. 98:1432-1440.[Medline]
    24. 24
  24. Sarobe, P., J. I. Jauregui, J. J. Lasarte, N. Garcia, M. P. Civeira, F. Borras-Cuesta, and J. Prieto. 1996. Production of interleukin-2 in response to synthetic peptides from hepatitis C virus E1 protein in patients with chronic hepatitis C: relationship with the response to interferon treatment. J. Hepatol. 25:1-9.[CrossRef][Medline]
    25. 25
  25. Taylor, M. W., and G. S. Feng. 1991. Relationship between interferon-gamma, indoleamine 2,3-dioxygenase, and tryptophan catabolism. FASEB J. 5:2516-2522.[Abstract]
    26. 26
  26. Terness, P., T. M. Bauer, L. Rose, C. Dufter, A. Watzlik, H. Simon, and G. Opelz. 2002. Inhibition of allogeneic T cell proliferation by indoleamine 2,3-dioxygenase-expressing dendritic cells: mediation of suppression by tryptophan metabolites. J. Exp. Med. 196:447-457.[Abstract/Free Full Text]
    27. 27
  27. Widner, B., E. R. Werner, H. Schennach, H. Wachter, and D. Fuchs. 1997. Simultaneous measurement of serum tryptophan and kynurenine by HPLC. Clin. Chem. 43:2424-2426.[Free Full Text]
    28. 28
  28. Zhong, J., P. Gastaminza, G. Cheng, S. Kapadia, T. Kato, D. R. Burton, S. F. Wieland, S. L. Uprichard, T. Wakita, and F. V. Chisari. 2005. Robust hepatitis C virus infection in vitro. Proc. Natl. Acad. Sci. USA 102:9294-9299.[Abstract/Free Full Text]

Journal of Virology, April 2007, p. 3662-3666, Vol. 81, No. 7
0022-538X/07/$08.00+0     doi:10.1128/JVI.02248-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Dolganiuc, A., Szabo, G. (2008). T cells with regulatory activity in hepatitis C virus infection: what we know and what we don't. J. Leukoc. Biol. 84: 614-622 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Larrea, E.
Right arrow Articles by Prieto, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Larrea, E.
Right arrow Articles by Prieto, J.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»