This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McCann, K. L.
Right arrow Articles by Imani, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McCann, K. L.
Right arrow Articles by Imani, F.

 Previous Article  |  Next Article 

Journal of Virology, March 2007, p. 2880-2886, Vol. 81, No. 6
0022-538X/07/$08.00+0     doi:10.1128/JVI.02583-06

Transforming Growth Factor ß Enhances Respiratory Syncytial Virus Replication and Tumor Necrosis Factor Alpha Induction in Human Epithelial Cells{triangledown}

Kelly L. McCann and Farhad Imani*

Laboratory of Respiratory Biology, National Institutes of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, North Carolina 27709

Received 22 November 2006/ Accepted 20 December 2006


arrow
ABSTRACT
 
Asthma is characterized as a chronic inflammatory disease associated with significant tissue remodeling. Patients with asthma are more susceptible to virus-induced exacerbation, which subsequently can lead to increased rates of hospitalization and mortality. While the most common cause of asthma-related deaths is respiratory viral infections, the underlying factors in the lung environment which render asthmatic subjects more susceptible to viral exacerbation are not yet identified. Since transforming growth factor ß (TGF-ß) is a critical cytokine for lung tissue remodeling and asthma phenotype, we have focused on the effects of TGF-ß on viral replication and virus-induced inflammation. Treatment of human epithelial cells with TGF-ß increased respiratory syncytial virus (RSV) replication by approximately fourfold. Tumor necrosis factor alpha (TNF-{alpha}) mRNA and protein expression were also significantly increased above levels with RSV infection alone. The increase in RSV replication and TNF-{alpha} expression after TGF-ß treatment was concomitant with an increase in virus-induced p38 mitogen-activated protein kinase activation. Our data reveal a novel effect for TGF-ß on RSV replication and provide a potential mechanism for the exaggerated inflammatory response observed in asthmatic subjects during respiratory viral infections.


arrow
INTRODUCTION
 
Infection with many different viruses, such as human rhinovirus, adenovirus, parainfluenza virus, influenza virus, and respiratory syncytial virus (RSV), can trigger severe asthma exacerbation and hospitalization, but these infections are generally well tolerated in normal subjects (22, 23). The exact reason for this difference between normal and asthmatic responses to respiratory virus infections is not yet clear. Recent evidence by Wark et al. and Contoli et al. (13, 46) suggests that the lack of an efficient innate immune response, as detected by lower levels of beta interferon (IFN-ß) and lambda interferon (IFN-{lambda}) produced by asthmatic epithelial cells, may be responsible for higher levels of viral replication, which can lead to an exaggerated asthmatic response.

A cytokine that is pivotal in acute and chronic inflammation is tumor necrosis factor alpha (TNF-{alpha}). This pleiotropic cytokine has been implicated in many inflammatory diseases, such as rheumatoid arthritis, ankylosing spondylitis, Crohn's disease, and psoriasis (6, 7, 18). In addition to proinflammatory and immunomodulatory functions, deleterious effects of TNF-{alpha} are associated with the proapoptotic consequences of this cytokine, which contribute to tissue damage (9, 14). TNF-{alpha} is also increased in asthmatic bronchoalveolar fluid, with higher levels detected in severe asthmatics (16, 38). In fact, recent evidence from clinical trials and animal studies showed that anti-TNF-{alpha} therapy was beneficial for asthma patients (3, 20, 25). Although it is accepted that respiratory viral infections induce TNF-{alpha}, it is not yet known if the level of this cytokine is differentially modulated by any factor in the asthmatic lung environment compared to the lung environment of normal subjects.

In addition to the immunoregulatory functions, transforming growth factor ß (TGF-ß) has diverse effects in the lung environment, such as inhibition and induction of cell proliferation, induction of mucus secretion, and increasing cell migration (4, 11, 12, 21, 24, 32, 37, 42). It is also well accepted that TGF-ß expression is increased in asthmatic lungs, and it directly correlates with chronic asthma phenotype and severity (2, 5, 36). TGF-ß is a critical regulatory cytokine for chronic lung fibrosis and tissue remodeling through myofibroblast differentiation and fibroblast activation, which is a hallmark of chronic asthma (12). Therefore, TGF-ß is considered a key mediator of asthmatic phenotype; however, the role of this cytokine in virus-induced lung inflammation is not well studied.

Based on the accumulated evidence, it is reasonable to hypothesize that a factor in the asthmatic lung environment affects epithelial cells in such a way as to render them more susceptible to viral replication and the virus-induced inflammation. To identify the underlying causes of exaggerated inflammatory responses by asthmatic subjects during viral infections, we have tested the role of TGF-ß in RSV replication and virus-induced epithelial inflammatory responses. For these experiments, we used primary human bronchial epithelial (PHBE) cells from normal donors and the human alveolar epithelial cell line A549. We investigated the effect of TGF-ß treatment on replication of a common respiratory virus, RSV, and expression of TNF-{alpha} in these cells. We further examined the effects of TGF-ß on the virus-induced activation of a key signaling pathway, namely, the p38 mitogen-activated protein kinase (MAPK).


arrow
MATERIALS AND METHODS
 
Cell culture conditions, viral infections, and reagents. PHBE cells were purchased from Cambrex Bioscience (Walkersville, MD) and were grown as a monolayer in serum-free medium BEBM-2 (Cambrex Bioscience). The human epithelial cell line A549 was grown as a monolayer in Dulbecco's modified Eagle's medium and Ham's F-12 medium supplemented with 5% fetal calf serum and 10 µg/ml penicillin-streptomycin at 37°C in a 5%-CO2 humidified chamber.

The recombinant human TGF-ß was purchased from RDI-Fitzgerald (Concord, MA) and was diluted in phosphate-buffered saline (PBS) with 2% bovine serum albumin. PHBE and A549 cells were plated at 8 x 105 cells and allowed to grow overnight. At 70% confluence, the cells were treated with TGF-ß at various concentrations. The cells were then incubated for 2 h prior to infection with RSV (human A2 strain) at various multiplicities of infection (MOIs). To determine the presence of contaminating cytokines and the necessity for virus replication in the induction of proinflammatory cytokines, the RSV stocks were tested by UV light inactivation using a Stratagene (Cedar Creek, TX) Stratalinker 1800 UV crosslinker.

RNA extraction and RT-PCR. RNA was isolated using the TRIzol total RNA isolation reagent (Invitrogen, Carlsbad, CA). First-strand cDNA was synthesized using 0.5 µg purified RNA and SuperScript reverse transcriptase (Invitrogen, Carlsbad, CA). The cDNA was then amplified by reverse transcription-PCR (RT-PCR) in the presence of 2 µg/ml primers and iQ Sybr Green supermix (Bio-Rad, Hercules, CA).

The sequences of primers used in RT-PCRs were as follows: glyceraldehyde-3-phosphate dehydrogenase (GAPDH) sense, GGACCTGACCTGCCGTCTAG; GAPDH antisense, TAGCCCAGGATGCCCTTGAG; h-TNF-{alpha} sense, CGTCTCCTACCAGACCAAGG; h-TNF-{alpha} antisense, GGAAGACCCCTCCCAGATAG; h-IFN-ß sense, AGCCAGTGCTCGATGAATCT; h-IFN-ß antisense, CAGCAGTTCCAGAAGGAGGA.

Western blot and enzyme-linked immunosorbent assay (ELISA) analysis. For isolation of cellular proteins, after each treatment, cells were washed two times in PBS, and equal numbers of cells were lysed using 1x sodium dodecyl sulfate (SDS) sample buffer containing 2.5% ß-mercaptoethanol. The proteins were denatured and reduced by heating the samples at 95°C for 3 min. The chromosomal DNA was then sheared by passing the samples through a 26-gauge needle several times. The proteins were resolved by 12% SDS-polyacrylamide gel electrophoresis (PAGE) and were electrotransferred onto nitrocellulose membranes. Polyclonal rabbit anti-p38 MAPK and anti-phospho-p38 MAPK (Cell Signaling, Beverly, MA) were used according to the manufacturer's instructions. Polyclonal goat anti-RSV was purchased from Chemicon International (Temecula, CA). The concentration of antibody used to probe blots was optimized relative to protein concentrations. The immunoblotted proteins were then visualized using the ECL Western blot detection system (GE Healthcare Bio-Sciences, Piscataway, NJ).

Secreted TNF-{alpha} was measured by ELISA (Biosource, Carlsbad, CA) according to the manufacturer's protocol. PHBE cells were first treated with 5 ng/ml TGF-ß and then infected with RSV at 1 PFU/cell. After 24 h of infection, the supernatants were collected and were assayed for TNF-{alpha} protein levels.

Actinomycin D treatment. Actinomycin D was purchased from Sigma-Aldrich (St. Louis, MO). A549 cells were plated at 70% confluence and were first treated with TGF-ß at 5 ng/ml. After 2 h, the cells were infected with RSV at a MOI of 2.5 PFU/cell. After 24 h of incubation, Actinomycin D was added at 1 µg/ml and the cells were allowed to incubate for additional times as indicated in the figure legend. Total RNA was then extracted, and the induction of TNF-{alpha} mRNA was determined by RT-PCR.

WST-1 cell viability and BrdU cell proliferation assay. To determine the mitochondrial metabolic rate and cell viability, we used a WST-1 rapid cell proliferation kit (Calbiochem, San Diego, CA). A549 cells were plated in 96-well plates at a concentration of 1 x 104 cells/well in a volume of 100 µl and were allowed to incubate overnight. TGF-ß was then added to the cells at various concentrations, and the cells were then allowed to incubate for an additional 24 or 72 h. WST-1 labeling was performed for 2 h, and the optical density was then determined by using an ELISA plate reader. For cell proliferation measurements, incorporation of BrdU into cellular DNA was determined using a BrdU cell proliferation kit (Calbiochem, San Diego, CA). A549 cells were plated in 96-well plates at a concentration of 1 x 104 cells/well in a volume of 100 µl. After 24 h, TGF-ß was added to the cells at various concentrations and the mixture was allowed to incubate for additional 2 h. BrdU incorporation was determined after 24 h according to manufacturer's protocol. Staurosporin (EMD Biosciences, San Diego, CA) was used at 2 µM as a positive control for both WST-1 and BrdU assays.


arrow
RESULTS
 
TGF-ß treatment enhances RSV replication. To address our hypothesis that TGF-ß plays a role in exaggerated responses in asthmatics during viral infections, we used PHBE cells and the human epithelial cells line A549. Initially, we investigated the effect of TGF-ß on viral replication. PHBE and A549 cells (Fig. 1A and B) were treated with TGF-ß, and after 2 h, the cells were infected with RSV at a MOI of 0.5 PFU/cell. The low MOI was chosen to allow a detectable change in the accumulation of viral proteins. Total cellular proteins were extracted after 16 h of infection, and RSV proteins were visualized by SDS-PAGE followed by Western blot analysis using anti-RSV goat serum (Fig. 1A and B). The viral proteins were identified by molecular weight mobility patterns as described by Teng and Collins (43). The data showed that viral protein accumulation increased with TGF-ß treatment.


Figure 1
View larger version (11K):
[in this window]
[in a new window]

 
FIG. 1. RSV replication is enhanced by TGF-ß treatment. To determine the effects of TGF-ß on RSV replication, we first measured virus protein levels by Western blot analysis. PHBE cells (panel A) or A549 cells (panel B) were left untreated or were treated with TGF-ß, as indicated. After 2 h, cells were infected with RSV at a MOI of 0.5 PFU/cell and the cells were allowed to incubate for an additional 18 h. Total cellular protein was isolated and used in Western blot analysis using anti-RSV antibody. Two different exposures were made for a PHBE cell Western blot to detect the increase in all RSV proteins. The data are representative of four different experiments. Panel C. Effect of TGF-ß on viral replication was determined by viral titration by using plaque assays. PHBE cells (1.6 x 106 cells) were infected with RSV at a MOI of 0.5 PFU/cell (initial inoculum) (A) and were then harvested at 24 h (B) or were treated with 5 ng/ml of TGF-ß (C) prior to infection with RSV. After 24 h, the cells were lysed by 3 freeze-thaw cycles and the cleared lysates were then used in plaque assays in duplicate dishes. The data represent the average for three separate experiments; error bars are standard errors of the mean; *, P = 0.02.

Since viral protein accumulation may not reflect an increase in infectious viral particles, we assessed the role of TGF-ß in viral replication by titration using plaque assays (Fig. 1C). PHBEs were treated with TGF-ß at 5 ng/ml, and after 2 h, the cells were infected with RSV at a MOI of 0.5 PFU/cell (total initial inoculum, 8 x 105 PFU). The cells were harvested after 24 h and were lysed, and the cleared lysates were used in standard plaque assays (Fig. 1C). The titer of virus in the untreated cells increased by approximately 11-fold after 24 h (9.85 x 106 PFU). TGF-ß treatment enhanced RSV titers by an additional 3.9-fold, which is a total of an approximately 40-fold increase over the initial inoculum. Collectively, our data obtained by Western blots and titration assays showed that TGF-ß caused a significant increase in viral replication.

TGF-ß enhances RSV-induced TNF-{alpha} expression. Since exaggerated inflammation is associated with viral exacerbation of asthma, we tested whether TGF-ß treatment increased RSV induction of TNF-{alpha} expression in epithelial cells.

First, to determine the dose-response curve of RSV induction of TNF-{alpha}, we infected A549 cells with RSV at increasing MOIs (Fig. 2A). After 24 h, the level of TNF-{alpha} mRNA was determined by RT-PCR. The data showed that a MOI of 1 PFU/cell was sufficient to cause a detectable increase in TNF-{alpha} mRNA. Therefore, we used this MOI as a starting point in our experiments examining the effect of TGF-ß on cytokine expression.


Figure 2
View larger version (13K):
[in this window]
[in a new window]

 
FIG. 2. RSV-induced TNF-{alpha} but not IFN-ß expression is enhanced by TGF-ß. Panel A. A549 cells were infected with RSV at increasing concentration, as indicated. After 24 h, TNF-{alpha} mRNA expression was determined by real-time RT-PCR (n = 2); error bars indicate standard errors of the means. A549 (panel B) or PHEC (panel C) cells were first treated with TGF-ß (5 ng/ml), and after 2 h, the cells were infected with RSV at a MOI of 1 PFU/cell. After an additional 18 h, total RNA was extracted and used in real-time RT-PCR using primers specific to TNF-{alpha} and IFN-ß (n = 3); error bars indicate standard errors of the means; *, P < 0.01. The n-fold increase is relative to GAPDH levels. Panel D. PHBE cells were left untreated, were infected with RSV at a MOI of 1 PFU/cell, or were first treated with TGF-ß at 5 ng/ml, and after 2 h, the cells were then infected with RSV at a MOI of 1 PFU/cell. After 24 h, culture supernatants were collected and were used in ELISA assays (n = 3); error bars represent standard errors of the means; *, P < 0.01.

A549 (Fig. 2B) and PHBE (Fig. 2C) cells were treated with increasing concentrations of TGF-ß, and after 2 h, cells were infected with RSV at a MOI of 1.0 PFU/cell. Culture supernatants and cells were harvested at 24 h postinfection. Total RNA was isolated from the cells and was used in RT-PCR to determine TNF-{alpha} and IFN-ß levels. TGF-ß increased the RSV-induced TNF-{alpha} mRNA by 3.2-fold above the level with RSV alone in A549 cells (Fig. 1B) and by 4.3-fold in PHBE cells (Fig. 2B and C). On the other hand, there was a decrease, albeit not significant, in IFN-ß expression (Fig. 2B).

To measure cytokine protein release, we performed a specific ELISA with the culture supernatants. Since in our experience cell lines do not produce significant TNF-{alpha} protein, we focused on culture supernatants obtained from PHBE cells (Fig. 2D). TGF-ß treatment enhanced TNF-{alpha} release by 1.9-fold over levels with RSV alone (Fig. 2D).

TGF-ß enhancement of TNF-{alpha} is not due to enhanced RNA stability. It is known that a regulatory step in TNF-{alpha} expression is at the level of RNA stability (8). To test the possibility that the enhancement of RSV-induced TNF-{alpha} expression with TGF-ß was due to enhanced RNA stability, we used actinomycin D to inhibit de novo transcription (Fig. 3). Cells were treated with TGF-ß at 5 ng/ml for 2 h and were then infected with RSV at a MOI of 5 PFU/cell. After 24 h of incubation, Actinomycin D was added at 1 µg/ml, total cellular RNA was harvested at various time points, and TNF-{alpha} mRNA was measured by real-time RT-PCR. The data showed that TGF-ß treatment did not alter the stability of TNF-{alpha} mRNA compared to results with untreated cells, suggesting that the increase in TNF-{alpha} mRNA was due to a transcriptional activation (Fig. 3).


Figure 3
View larger version (7K):
[in this window]
[in a new window]

 
FIG. 3. RNA stability is not affected by TGF-ß treatment. A549 cells were left untreated (circles) or were treated with TGF-ß at 5 ng/ml for 2 h (squares) and were then infected with RSV at a MOI 2.5 PFU/cell. After 18 h, the cells were treated with actinomycin D at 1 µg/ml. Total cellular RNA was extracted at indicated times and was used in RT-PCR for detection of TNF-{alpha} mRNA. The n-fold increase is relative to GAPDH levels.

TGF-ß enhances RSV activation of p38 MAPK. A key signaling molecule for inflammatory responses and virus-induced TNF-{alpha} expression is p38 MAPK. We therefore tested the effect of TGF-ß on RSV activation of p38 MAPK by Western blot analysis. First, we determined the dose-response effect of RSV infection on p38 activation (Fig. 4A). A549 cells were infected with increasing concentrations of RSV, and after 24 h, total cellular protein was extracted and used in Western blot assays. RSV activated p38 MAPK in a dose-response manner.


Figure 4
View larger version (13K):
[in this window]
[in a new window]

 
FIG. 4. MAPK activation is enhanced by TGF-ß treatment. To determine the effect of TGF-ß on MAPK activation, we performed Western blot analysis. Initially, we determined the dose response of MAPK in epithelial cells after RSV infection (panel A). A549 cells were infected with increasing concentrations of RSV. Total cellular protein was extracted after 24 h and was subjected to SDS-PAGE, followed by Western blot analysis using specific anti-phospo-p38 antibody. As an internal control, anti-p38 antibody was used to determine total protein levels. Panel B, A549 cells were treated with TGF-ß at increasing concentrations. After 2 h, cells were infected with RSV at a low MOI of 1 PFU/cell. After 18 h, total cellular protein was extracted and subjected to SDS-PAGE and Western blot analysis as for panel A. Panel C, PHBE cells were treated with TGF-ß at 5 ng/ml, and after 2 h, the cells were infected with RSV at a MOI of 1 PFU/cell. After 18 h, total cellular protein was extracted and subjected to SDS-PAGE and Western blotting as for panel A.

Next, to test if TGF-ß enhanced RSV activation of p38 MAPK, A549 cells were treated with increasing concentrations of TGF-ß and were then infected with RSV at a MOI of 1.0 PFU/cell (Fig. 4B). After 24 h, cells were harvested, total cellular proteins were isolated, and the phosphorylation state of p38 MAPK was determined by using a specific antibody. TGF-ß enhanced RSV activation of p38 MAPK in a dose-response manner.

To verify these data with primary cells, we treated PHBE cells with TGF-ß at 5 ng/ml for 2 h prior to infection with RSV at a MOI of 1.0 PFU/cell (Fig. 4C). After an additional 24 h, total cellular proteins were harvested and used in Western blot analysis. Similar to results with A549 cells, TGF-ß enhanced RSV activation of p38 MAPK in PHBE cells. Collectively, these data suggest that an increase of p38 MAPK activation is a potential mechanism of TGF-ß enhancement of TNF-{alpha} expression.

TGF-ß reduces cellular metabolism but not cellular replication. Viruses are intracellular parasites; therefore, they rely on cellular machinery for replication. To test the possibility that TGF-ß affected viral replication and TNF-{alpha} expression through a change in cellular metabolism or replication, we used two different colorimetric assays (Fig. 5). First, to test cellular replication, cells were treated with increasing concentrations of TGF-ß for 24 h, and then a BrdU DNA labeling reagent was added. After 24 h, BrdU incorporation was colorimetrically measured on an ELISA plate reader. TGF-ß did not have any significant effect on epithelial cell replication. Under identical conditions, staurosporin, which is a known inducer of apoptosis, caused a dramatic decrease in cell proliferation.


Figure 5
View larger version (26K):
[in this window]
[in a new window]

 
FIG. 5. TGF-ß caused a reduction in the cellular metabolic rate. The effect of TGF-ß on cell proliferation and the metabolic rate was determined by BrdU and WST-1 assays, respectively. A549 cells were treated with vehicle control (PBS [mock]) or TGF-ß at the indicated concentrations. After 24 h, cell proliferation and metabolic rates were determined (n = 3). The error bars indicate the standard errors of the means; *, P < 0.01. Staur, staurosporin.

Next, to examine the effect of TGF-ß on the metabolic rate of epithelial cells, we used a WST-1 cell viability assay. A549 cells were treated with various concentrations of TGF-ß for 24 h, and cell viability was then assessed by using a WST-1 assay. There was a significant decrease in the metabolic rate of the cells after TGF-ß treatment (Fig. 5).


arrow
DISCUSSION
 
To examine the mechanisms of viral induction of asthma exacerbation, we have investigated the role of TGF-ß as the basis for the enhanced virus-induced inflammatory effects in human bronchial epithelial cells. In this report we showed that TGF-ß enhanced RSV replication and viral induction of TNF-{alpha} expression in human epithelial cells. This suggests that by increasing the viral load and TNF-{alpha} levels, the presence of TGF-ß in asthmatic lungs may contribute to the exaggerated responses observed during respiratory infections in these patients.

While exaggerated lung inflammation is a frequent occurrence during common respiratory viral infections in asthmatic lungs, the underlying events leading to these responses have remained largely unknown. To study these events, we examined the role of TGF-ß in RSV replication and inflammatory cytokine expression. TGF-ß is a pleiotropic cytokine which possesses both pro- and antiproliferative effects and has been clearly linked with asthma phenotype (5). TGF-ß enhances fibrosis and remodeling, cell migration, and mucus secretion (4, 11, 12, 21, 24, 32, 37, 42).

Bronchial biopsy samples from asthmatics show a higher level of TGF-ß immunoreactivity than samples from normal subjects (2, 36). There is also significant correlation between basement membrane thickness and TGF-ß expression in epithelial and submucosal cells (26, 45). Alveolar macrophages and eosinophils from asthmatics also show higher levels of TGF-ß than macrophages from normal subjects (29, 45).

Interestingly, a polymorphism within the TGF-ß gene promoter (position –509 C/T) is associated with asthma phenotype(17, 40). Further evidence for the TGF-ß gene polymorphism in asthma was reported by Pulleyn et al., showing that homozygosity of this allele (–509 C/T) was positively correlated with the severe asthma phenotype (35).

Recently, Wark et al. and Contoli et al. reported that bronchial epithelial cells from asthmatic subjects had a defect in innate immune responses and in IFN-ß and IFN-{lambda} expression, and therefore, rhinovirus replication was more robust in asthmatics (13, 46). It is not clear, however, whether asthmatic subjects have any other deficiency in antiviral responses in other organs. Therefore, their data suggest that underlying events of asthmatic exacerbation during viral infections must be an organ-specific effect. Also, Wark et al. showed that epithelial cells from asthmatics had a delayed apoptotic response which may be a part of virus-induced exacerbation in these patients. In our experiments, TGF-ß did not have any effect on cellular apoptosis in infected or noninfected cells (data not shown). At this point, we cannot account for this discrepancy, but it could be due to usage of different experimental conditions.

It is clearly established that the presence of TGF-ß in the respiratory system is significantly associated with the asthmatic condition; therefore, our data provide an alternative explanation for the organ-specific events during viral infections of the asthmatic respiratory system. It is also possible that TGF-ß, which is an anti-inflammatory cytokine, could reduce IFN-ß levels in the lungs and allow more-efficient viral replication. Since treatment of cells with TGF-ß alone enhanced IFN-ß levels, albeit not significantly, at this point we favor a direct effect of TGF-ß on cells and viral replication.

This assertion is strengthened by our data from cell viability and DNA replication assays showing that TGF-ß treatment did not affect DNA replication but did significantly reduce cellular metabolic activity (Fig. 5). Since viral replication machinery is in competition with cellular machinery for availability of substrates, it is plausible that a reduction in cellular metabolic substrate competition would allow more-efficient virus replication. Alternatively, TGF-ß may induce an as yet unknown factor that can be advantageous to RSV replication.

Current research has identified TGF-ß as a critical molecule for immunoregulation and Th1/Th2 differentiation, but the role of TGF-ß in viral replication is not well studied. Previous work by Subauste and Proud showed that TGF-{alpha} did not affect rhinovirus replication in the epithelial cell line BEAS-2B (41). However, TGF-ß has been reported to either enhance or suppress replication of human immunodeficiency virus depending on the experimental conditions (27, 34), although the exact mechanisms are not yet clear. TGF-ß can also suppress replication of hepatitis C and the human T-cell leukemia virus type I (31, 33).

Surprisingly, our data showed that TGF-ß enhancement of RSV replication was concomitant with a significant increase in RSV-induced TNF-{alpha} mRNA and protein expression. TNF-{alpha} is a pivotal regulatory cytokine in innate and adaptive immune responses. Furthermore, TNF-{alpha} has been clearly associated with asthma (3, 30, 44). At a genetic level, two different polymorphisms in the TNF-{alpha} promoter were reported to correlate with asthma phenotype (1, 10, 39). Importantly, TNF-{alpha} is correlated with severe refractory asthma, and treatments aimed at neutralizing TNF-{alpha} are gaining acceptant as a novel therapeutic regimen. This is interesting because during respiratory viral infections, asthmatic exacerbation is also refractory to glucocorticoid anti-inflammatory therapies (15, 19). Our data showing that TGF-ß enhanced RSV induction of TNF-{alpha} are in agreement with these clinical data in that exaggerated production of TNF-{alpha} in asthmatic subjects during viral infections may be the underlying event leading to refractory inflammation, exacerbation, and hospitalization.

Our signal transduction data showed that TGF-ß enhanced RSV activation of p38 MAPK, a critical molecule in the inflammatory response pathway. We previously reported that viral induction of TNF-{alpha} in epithelial cells was mediated by the activation of p38 MAPK (28). It is possible that an increase in viral titers can lead to an upregulation of p38 MAPK activation and hence an increase in TNF-{alpha} expression.

Although our data were generated using human epithelial cells from normal subjects, we believe that our observations are pertinent to asthmatic conditions. TGF-ß is known to be significantly associated with an asthmatic lung environment. Further experiments are needed to more clearly delineate the effects of TGF-ß on epithelial cells which render them more capable of supporting viral replication and TNF-{alpha} expression. Our future experiments will be aimed at addressing these questions.


arrow
ACKNOWLEDGMENTS
 
This research was supported by the Intramural Research Program of the NIH, National Institute of Environmental Health Sciences.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: NIH/NIEHS, MD 2-01, 111 T.W. Alexander Dr., Research Triangle Park, NC 27709. Phone: (919) 541-5058. Fax: (919) 541-4133. E-mail: imani{at}niehs.nih.gov. Back

{triangledown} Published ahead of print on 3 January 2007. Back


arrow
REFERENCES
 
  1. 1 Albuquerque, R. V., C. M. Hayden, L. J. Palmer, I. A. Laing, P. J. Rye, N. A. Gibson, P. R. Burton, J. Goldblatt, and P. N. Lesouef. 1998. Association of polymorphisms within the tumour necrosis factor (TNF) genes and childhood asthma. Clin. Exp. Allergy 28:578-584.[CrossRef][Medline]
  2. 2 Batra, V., A. I. Musani, A. T. Hastie, S. Khurana, K. A. Carpenter, J. G. Zangrilli, and S. P. Peters. 2004. Bronchoalveolar lavage fluid concentrations of transforming growth factor (TGF)-beta1, TGF-beta2, interleukin (IL)-4 and IL-13 after segmental allergen challenge and their effects on alpha-smooth muscle actin and collagen III synthesis by primary human lung fibroblasts. Clin. Exp. Allergy 34:437-444.[CrossRef][Medline]
  3. 3 Berry, M. A., B. Hargadon, M. Shelley, D. Parker, D. E. Shaw, R. H. Green, P. Bradding, C. E. Brightling, A. J. Wardlaw, and I. D. Pavord. 2006. Evidence of a role of tumor necrosis factor alpha in refractory asthma. N. Engl. J. Med. 354:697-708.[Abstract/Free Full Text]
  4. 4 Boland, S., E. Boisvieux-Ulrich, O. Houcine, A. Baeza-Squiban, M. Pouchelet, D. Schoevaert, and F. Marano. 1996. TGF beta 1 promotes actin cytoskeleton reorganization and migratory phenotype in epithelial tracheal cells in primary culture. J. Cell Sci. 109:2207-2219.[Abstract]
  5. 5 Boxall, C., S. T. Holgate, and D. E. Davies. 2006. The contribution of transforming growth factor-beta and epidermal growth factor signalling to airway remodelling in chronic asthma. Eur. Respir. J. 27:208-229.[Abstract/Free Full Text]
  6. 6 Brandt, J., H. Haibel, D. Cornely, W. Golder, J. Gonzalez, J. Reddig, W. Thriene, J. Sieper, and J. Braun. 2000. Successful treatment of active ankylosing spondylitis with the anti-tumor necrosis factor alpha monoclonal antibody infliximab. Arthritis Rheum. 43:1346-1352.[CrossRef][Medline]
  7. 7 Brennan, F. M., D. Chantry, A. Jackson, R. Maini, and M. Feldmann. 1989. Inhibitory effect of TNF alpha antibodies on synovial cell interleukin-1 production in rheumatoid arthritis. Lancet ii:244-247.
  8. 8 Cao, H., J. S. Tuttle, and P. J. Blackshear. 2004. Immunological characterization of tristetraprolin as a low abundance, inducible, stable cytosolic protein. J. Biol. Chem. 279:21489-21499.[Abstract/Free Full Text]
  9. 9 Casale, T. B., J. J. Costa, and S. J. Galli. 1996. TNF alpha is important in human lung allergic reactions. Am. J. Respir. Cell Mol. Biol. 15:35-44.[Medline]
  10. 10 Chagani, T., P. D. Pare, S. Zhu, T. D. Weir, T. R. Bai, N. A. Behbehani, J. M. Fitzgerald, and A. J. Sandford. 1999. Prevalence of tumor necrosis factor-alpha and angiotensin converting enzyme polymorphisms in mild/moderate and fatal/near-fatal asthma. Am. J. Respir. Crit. Care Med. 160:278-282.[Abstract/Free Full Text]
  11. 11 Chu, H. W., S. Balzar, G. J. Seedorf, J. Y. Westcott, J. B. Trudeau, P. Silkoff, and S. E. Wenzel. 2004. Transforming growth factor-beta2 induces bronchial epithelial mucin expression in asthma. Am. J. Pathol. 165:1097-1106.[Abstract/Free Full Text]
  12. 12 Cohn, L., J. A. Elias, and G. L. Chupp. 2004. Asthma: mechanisms of disease persistence and progression. Annu. Rev. Immunol. 22:789-815.[CrossRef][Medline]
  13. 13 Contoli, M., S. D. Message, V. Laza-Stanca, M. R. Edwards, P. A. Wark, N. W. Bartlett, T. Kebadze, P. Mallia, L. A. Stanciu, H. L. Parker, L. Slater, A. Lewis-Antes, O. M. Kon, S. T. Holgate, D. E. Davies, S. V. Kotenko, A. Papi, and S. L. Johnston. 2006. Role of deficient type III interferon-lambda production in asthma exacerbations. Nat. Med. 12:1023-1026.[CrossRef][Medline]
  14. 14 Cretney, E., A. Shanker, H. Yagita, M. J. Smyth, and T. J. Sayers. 2006. TNF-related apoptosis-inducing ligand as a therapeutic agent in autoimmunity and cancer. Immunol. Cell Biol. 84:87-98.[CrossRef][Medline]
  15. 15 FitzGerald, J. M., A. Becker, M. R. Sears, S. Mink, K. Chung, and J. Lee. 2004. Doubling the dose of budesonide versus maintenance treatment in asthma exacerbations. Thorax 59:550-556.[Abstract/Free Full Text]
  16. 16 Gosset, P., A. Tsicopoulos, B. Wallaert, M. Joseph, A. Capron, and A. B. Tonnel. 1992. Tumor necrosis factor alpha and interleukin-6 production by human mononuclear phagocytes from allergic asthmatics after IgE-dependent stimulation. Am. Rev. Respir. Dis. 146:768-774.[Medline]
  17. 17 Grainger, D. J., K. Heathcote, M. Chiano, H. Snieder, P. R. Kemp, J. C. Metcalfe, N. D. Carter, and T. D. Spector. 1999. Genetic control of the circulating concentration of transforming growth factor type beta1. Hum. Mol. Genet. 8:93-97.[Abstract/Free Full Text]
  18. 18 Gross, V., T. Andus, H. G. Leser, M. Roth, and J. Scholmerich. 1991. Inflammatory mediators in chronic inflammatory bowel diseases. Klin. Wochenschr. 69:981-987.[CrossRef][Medline]
  19. 19 Harrison, T. W., J. Oborne, S. Newton, and A. E. Tattersfield. 2004. Doubling the dose of inhaled corticosteroid to prevent asthma exacerbations: randomised controlled trial. Lancet 363:271-275.[CrossRef][Medline]
  20. 20 Howarth, P. H., K. S. Babu, H. S. Arshad, L. Lau, M. Buckley, W. McConnell, P. Beckett, M. Al Ali, A. Chauhan, S. J. Wilson, A. Reynolds, D. E. Davies, and S. T. Holgate. 2005. Tumour necrosis factor (TNFalpha) as a novel therapeutic target in symptomatic corticosteroid dependent asthma. Thorax 60:1012-1018.[Abstract/Free Full Text]
  21. 21 Howat, W. J., S. T. Holgate, and P. M. Lackie. 2002. TGF-beta isoform release and activation during in vitro bronchial epithelial wound repair. Am. J. Physiol. Lung Cell Mol. Physiol. 282:L115-L123.[Abstract/Free Full Text]
  22. 22 Jacoby, D. B. 2004. Virus-induced asthma attacks. J. Aerosol Med. 17:169-173.[CrossRef][Medline]
  23. 23 Johnston, S. L., P. K. Pattemore, G. Sanderson, S. Smith, F. Lampe, L. Josephs, P. Symington, S. O'Toole, S. H. Myint, D. A. Tyrrell, et al. 1995. Community study of role of viral infections in exacerbations of asthma in 9-11 year old children. BMJ 310:1225-1229.[Abstract/Free Full Text]
  24. 24 Kelly, M., M. Kolb, P. Bonniaud, and J. Gauldie. 2003. Re-evaluation of fibrogenic cytokines in lung fibrosis. Curr. Pharm. Des. 9:39-49.[CrossRef][Medline]
  25. 25 Kim, J., L. McKinley, S. Natarajan, G. L. Bolgos, J. Siddiqui, S. Copeland, and D. G. Remick. 2006. Anti-tumor necrosis factor-alpha antibody treatment reduces pulmonary inflammation and methacholine hyper-responsiveness in a murine asthma model induced by house dust. Clin. Exp. Allergy 36:122-132.[CrossRef][Medline]
  26. 26 Kokturk, N., T. Tatlicioglu, L. Memis, N. Akyurek, and G. Akyol. 2003. Expression of transforming growth factor beta1 in bronchial biopsies in asthma and COPD. J. Asthma 40:887-893.[CrossRef][Medline]
  27. 27 Lazdins, J. K., T. Klimkait, E. Alteri, M. Walker, K. Woods-Cook, D. Cox, G. Bilbe, R. Shipman, N. Cerletti, and G. McMaster. 1991. TGF-beta: upregulator of HIV replication in macrophages. Res. Virol. 142:239-242.[CrossRef][Medline]
  28. 28 Meusel, T. R., and F. Imani. 2003. Viral induction of inflammatory cytokines in human epithelial cells follows a p38 mitogen-activated protein kinase-dependent but NF-kappaB-independent pathway. J. Immunol. 171:3768-3774.[Abstract/Free Full Text]
  29. 29 Minshall, E. M., D. Y. Leung, R. J. Martin, Y. L. Song, L. Cameron, P. Ernst, and Q. Hamid. 1997. Eosinophil-associated TGF-beta1 mRNA expression and airways fibrosis in bronchial asthma. Am. J. Respir. Cell Mol. Biol. 17:326-333.[Abstract/Free Full Text]
  30. 30 Moffatt, M. F., and W. O. Cookson. 1997. Tumour necrosis factor haplotypes and asthma. Hum. Mol. Genet. 6:551-554.[Abstract/Free Full Text]
  31. 31 Moriuchi, M., and H. Moriuchi. 2002. Transforming growth factor-beta enhances human T-cell leukemia virus type I infection. J. Med. Virol. 67:427-430.[CrossRef][Medline]
  32. 32 Moses, H. L., E. Y. Yang, and J. A. Pietenpol. 1990. TGF-beta stimulation and inhibition of cell proliferation: new mechanistic insights. Cell 63:245-247.[CrossRef][Medline]
  33. 33 Murata, T., T. Ohshima, M. Yamaji, M. Hosaka, Y. Miyanari, M. Hijikata, and K. Shimotohno. 2005. Suppression of hepatitis C virus replicon by TGF-beta. Virology 331:407-417.[CrossRef][Medline]
  34. 34 Poli, G., A. L. Kinter, J. S. Justement, P. Bressler, J. H. Kehrl, and A. S. Fauci. 1991. Transforming growth factor beta suppresses human immunodeficiency virus expression and replication in infected cells of the monocyte/macrophage lineage. J. Exp. Med. 173:589-597.[Abstract/Free Full Text]
  35. 35 Pulleyn, L. J., R. Newton, I. M. Adcock, and P. J. Barnes. 2001. TGFbeta1 allele association with asthma severity. Hum. Genet. 109:623-627.[CrossRef][Medline]
  36. 36 Redington, A. E., J. Madden, A. J. Frew, R. Djukanovic, W. R. Roche, S. T. Holgate, and P. H. Howarth. 1997. Transforming growth factor-beta 1 in asthma. Measurement in bronchoalveolar lavage fluid. Am. J. Respir. Crit. Care Med. 156:642-647.[Abstract/Free Full Text]
  37. 37 Roberts, A. B., M. B. Sporn, R. K. Assoian, J. M. Smith, N. S. Roche, L. M. Wakefield, U. I. Heine, L. A. Liotta, V. Falanga, J. H. Kehrl, et al. 1986. Transforming growth factor type beta: rapid induction of fibrosis and angiogenesis in vivo and stimulation of collagen formation in vitro. Proc. Natl. Acad. Sci. USA 83:4167-4171.[Abstract/Free Full Text]
  38. 38 Shah, A., M. K. Church, and S. T. Holgate. 1995. Tumour necrosis factor alpha: a potential mediator of asthma. Clin. Exp. Allergy 25:1038-1044.[CrossRef][Medline]
  39. 39 Sharma, S., A. Sharma, S. Kumar, S. K. Sharma, and B. Ghosh. 2006. Association of TNF haplotypes with asthma, serum IgE levels and correlation with serum TNF-{alpha} levels. Am. J. Respir. Cell Mol. Biol. 35:488-495.[Abstract/Free Full Text]
  40. 40 Silverman, E. S., L. J. Palmer, V. Subramaniam, A. Hallock, S. Mathew, J. Vallone, D. S. Faffe, T. Shikanai, B. A. Raby, S. T. Weiss, and S. A. Shore. 2004. Transforming growth factor-beta1 promoter polymorphism C-509T is associated with asthma. Am. J. Respir. Crit. Care Med. 169:214-219.[Abstract/Free Full Text]
  41. 41 Subauste, M. C., and D. Proud. 2001. Effects of tumor necrosis factor-alpha, epidermal growth factor and transforming growth factor-alpha on interleukin-8 production by, and human rhinovirus replication in, bronchial epithelial cells. Int. Immunopharmacol. 1:1229-1234.[CrossRef][Medline]
  42. 42 Ten Dijke, P., M. J. Goumans, F. Itoh, and S. Itoh. 2002. Regulation of cell proliferation by Smad proteins. J. Cell Physiol. 191:1-16.[CrossRef][Medline]
  43. 43 Teng, M. N., and P. L. Collins. 1999. Altered growth characteristics of recombinant respiratory syncytial viruses which do not produce NS2 protein. J. Virol. 73:466-473.[Abstract/Free Full Text]
  44. 44 Thomas, P. S. 2001. Tumour necrosis factor-alpha: the role of this multifunctional cytokine in asthma. Immunol. Cell Biol. 79:132-140.[CrossRef][Medline]
  45. 45 Vignola, A. M., P. Chanez, G. Chiappara, A. Merendino, E. Pace, A. Rizzo, A. M. la Rocca, V. Bellia, G. Bonsignore, and J. Bousquet. 1997. Transforming growth factor-beta expression in mucosal biopsies in asthma and chronic bronchitis. Am. J. Respir. Crit. Care Med. 156:591-599.[Abstract/Free Full Text]
  46. 46 Wark, P. A., S. L. Johnston, F. Bucchieri, R. Powell, S. Puddicombe, V. Laza-Stanca, S. T. Holgate, and D. E. Davies. 2005. Asthmatic bronchial epithelial cells have a deficient innate immune response to infection with rhinovirus. J. Exp. Med. 201:937-947.[Abstract/Free Full Text]


Journal of Virology, March 2007, p. 2880-2886, Vol. 81, No. 6
0022-538X/07/$08.00+0     doi:10.1128/JVI.02583-06




This article has been cited by other articles:

  • Gibbs, J. D., Ornoff, D. M., Igo, H. A., Zeng, J. Y., Imani, F. (2009). Cell Cycle Arrest by Transforming Growth Factor {beta}1 Enhances Replication of Respiratory Syncytial Virus in Lung Epithelial Cells. J. Virol. 83: 12424-12431 [Abstract] [Full Text]  
  • Thomas, B. J., Lindsay, M., Dagher, H., Freezer, N. J., Li, D., Ghildyal, R., Bardin, P. G. (2009). Transforming Growth Factor-{beta} Enhances Rhinovirus Infection by Diminishing Early Innate Responses. Am. J. Respir. Cell Mol. Bio. 41: 339-347 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McCann, K. L.
Right arrow Articles by Imani, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McCann, K. L.
Right arrow Articles by Imani, F.