This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boggiano, C.
Right arrow Articles by Littman, D. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boggiano, C.
Right arrow Articles by Littman, D. R.

 Previous Article  |  Next Article 

Journal of Virology, March 2007, p. 2519-2523, Vol. 81, No. 5
0022-538X/07/$08.00+0     doi:10.1128/JVI.01661-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Dendritic Cell-Mediated trans-Enhancement of Human Immunodeficiency Virus Type 1 Infectivity Is Independent of DC-SIGN{triangledown}

Cesar Boggiano,1,{dagger} Nicolas Manel,1,{dagger} and Dan R. Littman1,2*

Molecular Pathogenesis Program, Skirball Institute of Biomolecular Medicine, New York University School of Medicine, New York, New York 10016,1 The Howard Hughes Medical Institute, Skirball Institute of Biomolecular Medicine, New York University School of Medicine, New York, New York 100162

Received 2 August 2006/ Accepted 8 December 2006


arrow
ABSTRACT
 
Dendritic cells (DCs) enhance human immunodeficiency virus type 1 (HIV-1) infection of CD4+ T lymphocytes in trans. The C-type lectin DC-SIGN, expressed on DCs, binds to the HIV-1 envelope glycoprotein gp120 and confers upon some cell lines the capacity to enhance trans-infection. Using a short hairpin RNA approach, we demonstrate that DC-SIGN is not required for efficient trans-enhancement by DCs. In addition, the DC-SIGN ligand mannan and an anti-DC-SIGN antibody did not inhibit DC-mediated enhancement. HIV-1 particles were internalized and were protected from protease treatment following binding to DCs, but not from binding to DC-SIGN-expressing Raji cells. Thus, DC-SIGN is not required for DC-mediated trans-enhancement of HIV infectivity.


arrow
TEXT
 
Dendritic cells (DCs) facilitate infection of cocultured CD4+ T cells with human immunodeficiency virus type 1 (HIV-1). This process, known as trans-enhancement of infectivity (5, 7, 17), requires the internalization of HIV-1 particles into a DC compartment reminiscent of the multivesicular body (1, 12, 21), and transmission has been proposed to occur in the vicinity of a DC-T-cell contact referred to as an infectious synapse (15).

The surface subunit of the HIV-1 envelope glycoprotein gp120 binds to the mannose-binding C-type lectin DC-SIGN (CD209), which is expressed on DCs in mucosal tissues and in vitro on monocyte-derived dendritic cells (MDDCs) (6, 7). Expression of DC-SIGN in the B-lymphoblastoid cell line Raji allows for trans-enhancement of infection of T cells with HIV-1 (7, 22), and it has been proposed that DC-SIGN is similarly involved in the enhancement of HIV-1 infection by DCs (2, 7). In addition, DCs can also be productively infected to some extent with HIV-1 (8, 16, 18, 20). As a consequence, it is thought that transmission of HIV-1 from DCs to T cells occurs by a combination of both recycling of endocytosed particles and release of de novo viral particles from infected DCs. Recently, a number of reports have challenged the relevance of DC-SIGN in transmission of HIV-1 to T cells in various cell-based models (9, 11, 16).

To determine the potential relevance of DC-SIGN in HIV infection, we initially sought to evaluate the effect of down-regulating its expression on the trans-enhancement capacity of Raji cells expressing DC-SIGN (Raji DC-SIGN cells) and in vitro differentiated human DCs. One short hairpin RNA (shRNA) sequence specific for DC-SIGN was designed (GCAGTGGGTGAGCTCTCAGAGAAAT), and for a control, we used an shRNA specific for green fluorescent protein (GFP) (GGCTACGTCCAGGAGCGCACC). Both were introduced in a lentiviral transduction vector (19). DC-SIGN was partially down-modulated from the surfaces of Raji DC-SIGN cells transduced with the DC-SIGN-specific shRNA but was unaltered in cells expressing the control shRNA (Fig. 1A). To reduce DC-SIGN in human dendritic cells, cord blood-derived CD34+ cells were transduced after expansion in serum-free medium supplemented with stem cell factor, thrombopoietin, Flt3 ligand, and interleukin 6 (IL-6). Following selection in puromycin and differentiation of cord blood-derived dendritic cells (CBDCs) in the presence of granulocyte-macrophage colony-stimulating factor (GM-CSF) and IL-4, DC-SIGN was expressed in more than 43% of the cells transduced with the GFP shRNA vector, but in only 2% of the cells transduced with the DC-SIGN shRNA (Fig. 1A). Cells were otherwise similar for DC markers (CD14–, CD16+, and HLA-DR+) (data not shown). We further evaluated the ability of these cells to enhance HIV-1 infectivity. Cells were preincubated for 4 h with HIV-1 FF (pHIV-SVluc encoding firefly luciferase) (4) pseudotyped with the JRFL envelope before the addition of preactivated CD4+ target T cells. Luciferase activity was measured 2 days later. Direct infection of T cells alone or in the presence of Raji cells was not detectable (Fig. 1B). Raji DC-SIGN cells transduced with the GFP shRNA vector enhanced HIV-1 infectivity by more than 18-fold, but this was significantly reduced in cells transduced with the DC-SIGN shRNA vector (Fig. 1B). Strikingly, this reduction of infectivity was observed despite a moderate down-modulation of DC-SIGN, suggesting that enhancement by Raji DC-SIGN cells requires a critical amount of DC-SIGN at their surface. However, CBDCs transduced with either GFP or DC-SIGN shRNA were equally efficient in enhancing HIV-1 infectivity and showed an increase of luciferase activity of 49- to 80-fold over the luciferase activity of control Raji cells (Fig. 1B). Activation of the DCs by pretreatment with lipopolysaccharide (as shown by up-regulation of CD86 [data not shown]) gave similar results. We sought to down-regulate DC-SIGN with another shRNA system expressing GFP instead of the puromycin resistance gene used by Arrighi et al. (2, 3). Two shRNA expression vectors were used: LV-si-SIGN11, which effectively down-regulates DC-SIGN and LV-si-SIGN26, which is ineffective. Following culture in GM-CSF and IL-4, GFP-positive (GFP+) cells were sorted and DC-SIGN expression was evaluated. With LV-si-SIGN26, 64.6% of the cells expressed DC-SIGN compared to 4.6% with LV-si-SIGN11 (Fig. 1C). Again, both cell populations were equally efficient at enhancing HIV-1 infectivity more than 21-fold compared with Raji cells (Fig. 1D). This is in contrast to the initial reports that described shRNA-mediated down-regulation of DC-SIGN in DCs (2, 3) but is in agreement with a subsequent report (9). However, in those experiments, replication-competent virus was used, and viral production was not evaluated in the absence of target T cells; hence, productive infection of the DCs could not be ruled out (13). In our trans-enhancement assay, direct infection of donor DCs in the absence of T cells was minimal, if detectable, and because we used replication-defective viruses, all the enhancement of HIV-1 infectivity that we measured was generated by the initial viral inoculum.


Figure 1
View larger version (20K):
[in this window]
[in a new window]

  		FIG. 1. Enhancement of HIV-1 infection by Raji DC-SIGN cells and cord blood-derived dendritic cells (CBDCs) following transduction of DC-SIGN shRNA. (A) Raji DC-SIGN cells were transduced with lentiviruses expressing shRNA directed against DC-SIGN or a control lentivirus targeting GFP and selected with puromycin. Cord blood CD34+ cells were expanded in vitro, transduced with the lentiviral vectors, and incubated the next day in GM-CSF and IL-4 to induce differentiation into DCs, and after another 24 h, puromycin was added to select transduced cells. Analysis was performed 5 days later. Cell surface expression of DC-SIGN was evaluated by flow cytometry following staining with a phycoerythrin-conjugated anti-DC-SIGN antibody. Thin line, unstained control; thick line, GFP shRNA; dotted line, DC-SIGN shRNA. (B) Replication-deficient HIV-1 FF (JRFL) was incubated at a low multiplicity of infection for 4 h alone or with either 104 Raji DC-SIGN cells or CBDCs expressing control or DC-SIGN shRNA. A total of 104 preactivated CD4+ peripheral blood mononuclear cells were added, and luciferase activity was measured 2 days later. Infectivity was also evaluated in the presence of Raji cells as well as with target T cells alone. Values are shown as means plus standard errors (error bars) from triplicate wells. (C) CBDCs were transduced with a lentivirus expressing either a control or DC-SIGN shRNA and encoding GFP instead of the puromycin resistance gene. Six days after initiation of differentiation, GFP+ cells were sorted and further stained to evaluate surface expression of DC-SIGN. (D) Enhancement assay was performed as described above for panel B using either 103 Raji cells, Raji DC-SIGN cells, or GFP+, transduced CD34+ CBDCs.

We next performed enhancement assays in the presence of compounds known to specifically block gp120 interaction with DC-SIGN. Preincubation of Raji DC-SIGN cells with mannan, a strong inhibitor of gp120 binding to DC-SIGN (6), at 0.2 µg/µl or 2 µg/µl completely inhibited enhancement of HIV-1 infectivity. In contrast, there was no effect of mannan at 0.2 µg/µl and only a slight inhibition at 2 µg/µl on the enhancement by CBDCs (Fig. 2A). In the presence of an anti-DC-SIGN antibody (monoclonal antibody 120612 from R&D), enhancement of HIV-1 infectivity by Raji DC-SIGN cells was similarly abolished, but it was not significantly altered with CBDCs. Similar results were obtained with HIV-1 pseudotyped with the HXB2 envelope and with MDDCs (data not shown). This indicated that enhancement by DCs does not appear to require DC-SIGN or mannan-binding C-type lectins. Early experiments using replication-competent virus indicated that, in DC-T-cell cocultures, productive replication of HIV-1 could be inhibited by treatment with an anti-DC-SIGN antibody (7, 12). However, DC-SIGN is also implicated in cis for efficient productive infection (13), suggesting that the anti-DC-SIGN was blocking cis infection of the DCs and not trans-enhancement.


Figure 2
View larger version (13K):
[in this window]
[in a new window]

  		FIG. 2. Sensitivity of enhancement of HIV-1 infection and gp120 capture to DC-SIGN inhibitors. (A) A total of 104 Raji DC-SIGN cells or CBDCs were preincubated with medium alone or with medium containing either mannan (0.2 and 2 µg/µl) or anti-DC-SIGN antibody (25 µg/ml). Replication-incompetent HIV-1 FF (JRFL) was added at a low multiplicity of infection. Four hours later, either medium or 104 preactivated CD4+ T cells were added. Luciferase activity was measured 2 days later. Incubation of the virus with no donor cells or Raji cells followed by the addition of T cells is also shown. Histograms show the means plus standard deviations (error bars) from triplicate wells. (B) Raji cells, Raji DC-SIGN cells, or CBDCs were preincubated with either 0.2 µg/µl (dashed line) or 2 µg/µl (dotted line) mannan or medium (left panels) or an anti-DC-SIGN antibody at 25 µg/ml or medium (right panels), and gp120-FITC was added. PBS, phosphate-buffered saline.

The interaction of gp120 with DC-SIGN in Raji DC-SIGN cells was previously shown to be associated with an internalization event (12). Since DC-SIGN appeared to be differentially involved in the enhancement of HIV-1 infection in Raji DC-SIGN cells and DCs, we evaluated the sensitivity of Raji DC-SIGN cells and DCs to the aforementioned inhibitors of gp120 capture. As expected, gp120 labeled with fluorescein isothiocyanate (gp120-FITC) (Trinity Biotech) was readily captured by both Raji DC-SIGN cells and CBDCs and only minimally by Raji cells (Fig. 2B). In Raji DC-SIGN cells and CBDCs, preincubation with mannan or with an anti-DC-SIGN antibody reduced gp120 capture (Fig. 2B). Similar results were obtained with MDDCs (data not shown). This suggested that most gp120 internalization occurred through interaction with DC-SIGN or other C-type lectins in DCs and Raji DC-SIGN cells. We concluded that the capture of gp120 by DCs does not correlate with the trans-enhancement of infectivity. These findings are consistent with data from Gummuluru et al., describing that HIV-1 capture and transmission by DCs are independent of mannose-binding C-type lectins, while gp120 capture can be inhibited by mannan (10, 11). These results prompted us to investigate the cellular localization of gp120 and bona fide viral particles within DCs and Raji DC-SIGN cells.

Raji DC-SIGN cells and CBDCs were incubated with either gp120-FITC or HIV-1 particles labeled with GFP-Vpr (14). gp120-FITC showed a clear intracellular localization in both Raji DC-SIGN cells and CBDCs (Fig. 3A). In order to specifically determine whether viral particles were extracellular or intracellular, cells were treated with pronase in order to strip off any extracellular virus. The efficiency of the pronase treatment was confirmed by a decrease in DC-SIGN surface expression (Fig. 3B). Following pronase treatment, gp120-FITC localization remained identically intracellular in both Raji DC-SIGN cells and CBDCs. The GFP-Vpr signal was protected from pronase treatment in CBDCs, demonstrating that the particles visualized were internalized. Identical observations were made with MDDCs (data not shown). In contrast, after pronase treatment of Raji DC-SIGN cells, the GFP-Vpr signal was no longer visible (Fig. 3A). Thus, viral particles were located on the outside of the plasma membrane in Raji DC-SIGN cells.


Figure 3
View larger version (53K):
[in this window]
[in a new window]

  		FIG. 3. Localization of gp120 and GFP-Vpr-labeled HIV-1 particles in Raji DC-SIGN cells and CBDCs. (A) Raji DC-SIGN cells and CBDCs were incubated with either gp120-FITC or a GFP-Vpr HIV-1 preparation for 30 min at 37°C. Cells were then treated with either phosphate-buffered saline (PBS) or 0.1% pronase. Maximum projections of deconvolved Z-stacks acquired in the middle of the cell body are shown overlaid on differential interference contrast pictures. (B) Raji cells, Raji DC-SIGN cells, and CBDCs were incubated with or without gp120-FITC for 30 min at 37°C and subsequently treated with either PBS or pronase, and cell surface expression of DC-SIGN was evaluated by incubating the cells with an anti-DC-SIGN antibody. We have obtained similar GFP-Vpr HIV binding data using lower concentrations of pronase, down to 0.005%.

We wished to determine whether these findings could be extended to the trans-enhancement of infectivity. Raji DC-SIGN cells and CBDCs were incubated with HIV-1 RL (pHIV-SVluc encoding Renilla luciferase) JRFL (R5) for 2 h at 37°C. Unbound virus was washed away, and cells were treated with pronase. To normalize for any cell damage due to the pronase treatment, donor cells were infected with vesicular stomatitis virus G (VSV-G)-pseudotyped HIV-1 FF during capture of HIV-1 RL JRFL. In this setting, VSV-G-pseudotyped particles efficiently infect donor cells and can thus be used as an indicator of cell viability. Donor cells were incubated with CD4+ T cells, and luciferase activities were measured 48 h later. Direct infection of Raji DC-SIGN cells and CBDCs by the VSV-G pseudotypes was readily detected but was minimal with HIV-1 RL JRFL. DC-SIGN surface expression was significantly reduced in Raji DC-SIGN cells and CBDCs, demonstrating that the pronase treatment was efficient (Fig. 4A). trans-Enhancement of HIV-1 infectivity by CBDCs was not altered by the pronase treatment (Fig. 4B). Similar results were obtained with MDDCs (data not shown). On the other hand, trans-enhancement by Raji DC-SIGN cells was clearly abolished. These results demonstrate that in DCs, but not in Raji DC-SIGN cells, a mechanism protects viral particles. Together, these data show that during trans-enhancement of infectivity, HIV-1 particles are internalized by DCs, but not by Raji DC-SIGN cells.


Figure 4
View larger version (15K):
[in this window]
[in a new window]

  		FIG. 4. trans-Enhancement of HIV-1 infectivity by Raji DC-SIGN cells and CBDCs following pronase treatment. A total of 5 x 105 Raji DC-SIGN cells or CBDCs were incubated with 4 x 105 IU of HIV-1 RL (JRFL) and HIV-1 FF (VSV-G) for 2 h at 37°C. After two washes with RPMI, cells were treated with phosphate-buffered saline alone or with 0.006% pronase and incubated for 5 min at 37°C. (A) After pronase digestion, a subset of donor cells were stained with a FITC-conjugated anti-DC-SIGN antibody and analyzed by flow cytometry. (B) In parallel, cells were transferred in triplicates to 96-well plates. A total of 2.5 x 104 preactivated CD4+ T cells or medium was added to each well, and Renilla and firefly luciferase was measured 48 h later. Bars represent the average trans-enhancement of HIV-1 infectivity by Raji DC-SIGN cells or CBDCs normalized to the VSV-G pseudotype infectivity, untreated (–) or treated with pronase (+). In other experiments, with similar pronase treatment, reduction of surface CD4 expression was substantially greater than that of surface DC-SIGN, consistent with effective stripping of cell surface proteins and removal of the virus from CBDCs.

Our findings indicate that the mechanisms by which Raji DC-SIGN cells and DCs enhance HIV-1 infectivity are fundamentally different. In DCs, DC-SIGN is involved in the internalization of recombinant gp120, but this does not appear to correspond to a physiological function in enhancement of HIV-1 infection. DCs internalize infectious viral particles, leading to their protection from protease treatment and to trans-enhancement of infectivity, but neither is dependent on DC-SIGN.


arrow
ACKNOWLEDGMENTS
 
This work was supported by National Institute of Health grants to D.R.L. C.B. was supported by an NIH Institutional AIDS training grant. N.M. was supported by an EMBO fellowship.

We are grateful to Pamela Hoar, Fred Valentine, and the delivery staff at the NYU Medical Center for providing cord blood samples. We thank Vincent Piguet for providing shRNA constructs, John Hirst for assistance with fluorescence-activated cell sorting, Gretchen Diehl for critical reading of the manuscript, and Lara Vojnov for technical assistance.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Skirball Institute of Biomolecular Medicine, 540 First Avenue, New York, NY 10016. Phone: (212) 263-7520. Fax: (212) 263-1498. E-mail: littman{at}saturn.mail.nyu.edu. Back

{triangledown} Published ahead of print on 20 December 2006. Back

{dagger} These authors contributed equally to this work. Back


arrow
REFERENCES
 
    1
  1. Amara, A., and D. R. Littman. 2003. After Hrs with HIV. J. Cell Biol. 162:371-375.[Abstract/Free Full Text]
    2. 2
  2. Arrighi, J. F., M. Pion, E. Garcia, J. M. Escola, Y. van Kooyk, T. B. Geijtenbeek, and V. Piguet. 2004. DC-SIGN-mediated infectious synapse formation enhances X4 HIV-1 transmission from dendritic cells to T cells. J. Exp. Med. 200:1279-1288.[Abstract/Free Full Text]
    3. 3
  3. Arrighi, J. F., M. Pion, M. Wiznerowicz, T. B. Geijtenbeek, E. Garcia, S. Abraham, F. Leuba, V. Dutoit, O. Ducrey-Rundquist, Y. van Kooyk, D. Trono, and V. Piguet. 2004. Lentivirus-mediated RNA interference of DC-SIGN expression inhibits human immunodeficiency virus transmission from dendritic cells to T cells. J. Virol. 78:10848-10855.[Abstract/Free Full Text]
    4. 4
  4. Baumann, J. G., D. Unutmaz, M. D. Miller, S. K. Breun, S. M. Grill, J. Mirro, D. R. Littman, A. Rein, and V. N. KewalRamani. 2004. Murine T cells potently restrict human immunodeficiency virus infection. J. Virol. 78:12537-12547.[Abstract/Free Full Text]
    5. 5
  5. Cameron, P. U., P. S. Freudenthal, J. M. Barker, S. Gezelter, K. Inaba, and R. M. Steinman. 1992. Dendritic cells exposed to human immunodeficiency virus type-1 transmit a vigorous cytopathic infection to CD4+ T cells. Science 257:383-387.[Abstract/Free Full Text]
    6. 6
  6. Curtis, B. M., S. Scharnowske, and A. J. Watson. 1992. Sequence and expression of a membrane-associated C-type lectin that exhibits CD4-independent binding of human immunodeficiency virus envelope glycoprotein gp120. Proc. Natl. Acad. Sci. USA 89:8356-8360.[Abstract/Free Full Text]
    7. 7
  7. Geijtenbeek, T. B., D. S. Kwon, R. Torensma, S. J. van Vliet, G. C. van Duijnhoven, J. Middel, I. L. Cornelissen, H. S. Nottet, V. N. KewalRamani, D. R. Littman, C. G. Figdor, and Y. van Kooyk. 2000. DC-SIGN, a dendritic cell-specific HIV-1-binding protein that enhances trans-infection of T cells. Cell 100:587-597.[CrossRef][Medline]
    8. 8
  8. Granelli-Piperno, A., E. Delgado, V. Finkel, W. Paxton, and R. M. Steinman. 1998. Immature dendritic cells selectively replicate macrophagetropic (M-tropic) human immunodeficiency virus type 1, while mature cells efficiently transmit both M- and T-tropic virus to T cells. J. Virol. 72:2733-2737.[Abstract/Free Full Text]
    9. 9
  9. Granelli-Piperno, A., A. Pritsker, M. Pack, I. Shimeliovich, J. F. Arrighi, C. G. Park, C. Trumpfheller, V. Piguet, T. M. Moran, and R. M. Steinman. 2005. Dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin/CD209 is abundant on macrophages in the normal human lymph node and is not required for dendritic cell stimulation of the mixed leukocyte reaction. J. Immunol. 175:4265-4273.[Abstract/Free Full Text]
    10. 10
  10. Gummuluru, S., V. N. KewalRamani, and M. Emerman. 2002. Dendritic cell-mediated viral transfer to T cells is required for human immunodeficiency virus type 1 persistence in the face of rapid cell turnover. J. Virol. 76:10692-10701.[Abstract/Free Full Text]
    11. 11
  11. Gummuluru, S., M. Rogel, L. Stamatatos, and M. Emerman. 2003. Binding of human immunodeficiency virus type 1 to immature dendritic cells can occur independently of DC-SIGN and mannose binding C-type lectin receptors via a cholesterol-dependent pathway. J. Virol. 77:12865-12874.[Abstract/Free Full Text]
    12. 12
  12. Kwon, D. S., G. Gregorio, N. Bitton, W. A. Hendrickson, and D. R. Littman. 2002. DC-SIGN-mediated internalization of HIV is required for trans-enhancement of T cell infection. Immunity 16:135-144.[CrossRef][Medline]
    13. 13
  13. Lee, B., G. Leslie, E. Soilleux, U. O'Doherty, S. Baik, E. Levroney, K. Flummerfelt, W. Swiggard, N. Coleman, M. Malim, and R. W. Doms. 2001. cis Expression of DC-SIGN allows for more efficient entry of human and simian immunodeficiency viruses via CD4 and a coreceptor. J. Virol. 75:12028-12038.[Abstract/Free Full Text]
    14. 14
  14. McDonald, D., M. A. Vodicka, G. Lucero, T. M. Svitkina, G. G. Borisy, M. Emerman, and T. J. Hope. 2002. Visualization of the intracellular behavior of HIV in living cells. J. Cell Biol. 159:441-452.[Abstract/Free Full Text]
    15. 15
  15. McDonald, D., L. Wu, S. M. Bohks, V. N. KewalRamani, D. Unutmaz, and T. J. Hope. 2003. Recruitment of HIV and its receptors to dendritic cell-T cell junctions. Science 300:1295-1297.[Abstract/Free Full Text]
    16. 16
  16. Nobile, C., C. Petit, A. Moris, K. Skrabal, J. P. Abastado, F. Mammano, and O. Schwartz. 2005. Covert human immunodeficiency virus replication in dendritic cells and in DC-SIGN-expressing cells promotes long-term transmission to lymphocytes. J. Virol. 79:5386-5399.[Abstract/Free Full Text]
    17. 17
  17. Pope, M., M. G. Betjes, N. Romani, H. Hirmand, P. U. Cameron, L. Hoffman, S. Gezelter, G. Schuler, and R. M. Steinman. 1994. Conjugates of dendritic cells and memory T lymphocytes from skin facilitate productive infection with HIV-1. Cell 78:389-398.[CrossRef][Medline]
    18. 18
  18. Smed-Sorensen, A., K. Lore, L. Walther-Jallow, J. Andersson, and A. L. Spetz. 2004. HIV-1-infected dendritic cells up-regulate cell surface markers but fail to produce IL-12 p70 in response to CD40 ligand stimulation. Blood 104:2810-2817.[Abstract/Free Full Text]
    19. 19
  19. Stewart, S. A., D. M. Dykxhoorn, D. Palliser, H. Mizuno, E. Y. Yu, D. S. An, D. M. Sabatini, I. S. Chen, W. C. Hahn, P. A. Sharp, R. A. Weinberg, and C. D. Novina. 2003. Lentivirus-delivered stable gene silencing by RNAi in primary cells. RNA 9:493-501.[Abstract/Free Full Text]
    20. 20
  20. Turville, S. G., J. J. Santos, I. Frank, P. U. Cameron, J. Wilkinson, M. Miranda-Saksena, J. Dable, H. Stossel, N. Romani, M. Piatak, Jr., J. D. Lifson, M. Pope, and A. L. Cunningham. 2004. Immunodeficiency virus uptake, turnover, and 2-phase transfer in human dendritic cells. Blood 103:2170-2179.[Abstract/Free Full Text]
    21. 21
  21. Wiley, R. D., and S. Gummuluru. 2006. Immature dendritic cell-derived exosomes can mediate HIV-1 trans infection. Proc. Natl. Acad. Sci. USA 103:738-743.[Abstract/Free Full Text]
    22. 22
  22. Wu, L., T. D. Martin, M. Carrington, and V. N. KewalRamani. 2004. Raji B cells, misidentified as THP-1 cells, stimulate DC-SIGN-mediated HIV transmission. Virology 318:17-23.[CrossRef][Medline]

Journal of Virology, March 2007, p. 2519-2523, Vol. 81, No. 5
0022-538X/07/$08.00+0     doi:10.1128/JVI.01661-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Izquierdo-Useros, N., Naranjo-Gomez, M., Archer, J., Hatch, S. C., Erkizia, I., Blanco, J., Borras, F. E., Puertas, M. C., Connor, J. H., Fernandez-Figueras, M. T., Moore, L., Clotet, B., Gummuluru, S., Martinez-Picado, J. (2009). Capture and transfer of HIV-1 particles by mature dendritic cells converges with the exosome-dissemination pathway. Blood 113: 2732-2741 [Abstract] [Full Text]  
  • Lambert, A. A., Gilbert, C., Richard, M., Beaulieu, A. D., Tremblay, M. J. (2008). The C-type lectin surface receptor DCIR acts as a new attachment factor for HIV-1 in dendritic cells and contributes to trans- and cis-infection pathways. Blood 112: 1299-1307 [Abstract] [Full Text]  
  • Wang, Q., Pang, S. (2008). An intercellular adhesion molecule-3 (ICAM-3) -grabbing nonintegrin (DC-SIGN) efficiently blocks HIV viral budding. FASEB J. 22: 1055-1064 [Abstract] [Full Text]  
  • Neumann, A. K., Thompson, N. L., Jacobson, K. (2008). Distribution and lateral mobility of DC-SIGN on immature dendritic cells-implications for pathogen uptake. J. Cell Sci. 121: 634-643 [Abstract] [Full Text]  
  • de Witte, L., Bobardt, M., Chatterji, U., Degeest, G., David, G., Geijtenbeek, T. B. H., Gallay, P. (2007). Syndecan-3 is a dendritic cell-specific attachment receptor for HIV-1. Proc. Natl. Acad. Sci. USA 104: 19464-19469 [Abstract] [Full Text]  
  • Wang, J.-H., Janas, A. M., Olson, W. J., Wu, L. (2007). Functionally Distinct Transmission of Human Immunodeficiency Virus Type 1 Mediated by Immature and Mature Dendritic Cells. J. Virol. 81: 8933-8943 [Abstract] [Full Text]  
  • Fahrbach, K. M., Barry, S. M., Ayehunie, S., Lamore, S., Klausner, M., Hope, T. J. (2007). Activated CD34-Derived Langerhans Cells Mediate Transinfection with Human Immunodeficiency Virus. J. Virol. 81: 6858-6868 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Boggiano, C.
Right arrow Articles by Littman, D. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boggiano, C.
Right arrow Articles by Littman, D. R.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»