The Human TRIM5{alpha} Restriction Factor Mediates Accelerated Uncoating of the N-Tropic Murine Leukemia Virus Capsid

The host cell factors TRIM5 ${alpha}$ _hu and Fv-1 restrict N-tropic murineleukemia virus (N-MLV) infection at an early postentry stepbefore or after reverse transcription, respectively. Interestingly,the identity of residue 110 of the MLV capsid determines susceptibilityto both TRIM5 ${alpha}$ _hu and Fv-1. In this study, we investigate thefate of the MLV capsid in cells expressing either the TRIM5 ${alpha}$ _huor Fv-1 restriction factor. The expression of TRIM5 ${alpha}$ _hu, but notFv-1, specifically promoted the premature conversion of particulateN-MLV capsids within infected cells to soluble capsid proteins.The TRIM5 ${alpha}$ _hu-mediated disassembly of particulate N-MLV capsidswas dependent upon residue 110 of the viral capsid. Furthermore,the deletion or disruption of TRIM5 ${alpha}$ _hu domains necessary forpotent N-MLV restriction completely abrogated the disappearanceof particulate N-MLV capsids observed with wild-type TRIM5 ${alpha}$ _hu.These results suggest that premature disassembly of the viralcapsid contributes to the restriction of N-MLV infection byTRIM5 ${alpha}$ _hu, but not by Fv-1.

INTRODUCTION

Top

Introduction

Intracellular restriction factors can govern the species-specifictropism of a broad range of retroviruses. Early studies identifiedthe Friend virus susceptibility factor 1 (Fv-1) locus as a mousedeterminant governing the ability of mouse strains to be infectedby murine leukemia viruses (MLV) and to subsequently developleukemia (17). Two major alleles of Fv-1 have been identified:Fv-1ⁿ, which renders NIH mice resistant to B-tropic MLV (B-MLV)infection but susceptible to N-tropic (N-MLV) infection, andFv-1^b, which renders BALB/c mice resistant to N-MLV but susceptibleto B-MLV infection (4, 10). Fv-1 is a dominant, saturable restrictionfactor that inhibits MLV infection following reverse transcriptionof the viral RNA but prior to the integration of viral DNA intothe cellular genome (14). The Fv-1 protein is related to retroviralcapsid proteins (14). The viral determinant of susceptibilityto Fv-1 restriction has been mapped to residue 110 of the MLVcapsid (7, 16). Currently, the mechanism by which Fv-1 restrictsMLV infection is unknown.

More recently, rhesus monkey TRIM5 ${alpha}$ (TRIM5 ${alpha}$ _rh) and human TRIM5 ${alpha}$ (TRIM5 ${alpha}$ _hu) were identified as intracellular restriction factorscapable of blocking human immunodeficiency virus type 1 (HIV-1)and N-MLV infection, respectively, in the cells of these primatespecies (11, 15, 24, 33, 38). TRIM5 ${alpha}$ restricts HIV-1 and N-MLVat an early postentry step prior to reverse transcription (2,3, 6, 12, 19, 30, 36). Interestingly, arginine 110 of the N-MLVcapsid determines sensitivity to TRIM5 ${alpha}$ _hu-mediated restriction(24, 36). Replacing the arginine residue at position 110 ofthe N-MLV capsid with the corresponding glutamic acid residuefrom B-MLV generates a virus that can partially overcome TRIM5 ${alpha}$ _hurestriction. Conversely, replacement of glutamic acid 110 ofthe B-MLV capsid with arginine generates a virus that is susceptibleto TRIM5 ${alpha}$ _hu restriction.

TRIM5 ${alpha}$ is a member of the tripartite motif family of proteinsand contains RING, B-box 2, and coiled-coil (RBCC) domains (25).At least three isoforms ( ${alpha}$ , ${gamma}$ , and ${delta}$ ) of TRIM5 are generated byalternative splicing of the mRNA transcript. The longest ofthese isoforms, TRIM5 ${alpha}$ , contains a C-terminal B30.2/SPRY domain.The role of each of the TRIM5 ${alpha}$ domains in retroviral restrictionhas been studied. For instance, removal of the RING domain partiallyabrogates TRIM5 ${alpha}$ restriction of either HIV-1 or N-MLV (13, 21,33). Deletion of the B-box 2 domain completely eliminates therestricting ability of TRIM5 ${alpha}$ ; the precise function of this domainremains unknown (13, 21). The coiled-coil domain has been shownto facilitate the multimerization of TRIM5 ${alpha}$ , and its deletioncompletely abrogates HIV-1 and N-MLV restriction (1a, 18, 21).The TRIM5 ${alpha}$ B30.2 domain is the primary determinant for capsidrecognition and restriction specificity (23, 26, 28, 35, 39).TRIM5 ${gamma}$ , which lacks a B30.2 domain, and mutants of TRIM5 ${alpha}$ withdeleted B30.2 domains do not block HIV-1 or N-MLV infection(21, 33).

The exact mechanism by which TRIM5 ${alpha}$ restricts N-MLV infectionis currently unknown. To investigate how TRIM5 ${alpha}$ mediates therestriction of retroviruses, we developed a fate-of-capsid assaythat allowed us to monitor the steady-state levels of particulateretroviral capsids within an infected cell (34). This assaydiscriminates between cytosolic capsids that are potentiallyon the infection pathway and capsids that are nonspecificallyendocytosed into the cell but do not enter the cytosol. Theassay further distinguishes particulate capsids from smallermoieties in the cytosol of infected cells. In this study, weutilized the fate-of-capsid assay to explore the effects ofTRIM5 ${alpha}$ _hu and Fv-1 expression on the integrity of particulateMLV capsids within restricted cells.

MATERIALS AND METHODS

Top

Materials and Methods

Vectors, cell lines, and viruses. All cell lines were maintained in Dulbecco's modified Eagle'smedium supplemented with 10% newborn calf serum and antibiotics.All stably transduced cell lines were generated using the pLPCXvector, selected using 3.0 µg/ml puromycin, and maintainedin 1.0 µg/ml puromycin. All of the expressed TRIM proteinscontain a hemagglutinin (HA) tag at the C terminus, with theexception of mouse 9230105E10, which contains an N-terminalHA tag. The C95A, ${Delta}$ RING ( ${Delta}$ 1-92), ${Delta}$ B-box 2 ( ${Delta}$ 95-127), ${Delta}$ RING/ ${Delta}$ B-box2 ( ${Delta}$ 1-130), ${Delta}$ Coiled-coil ( ${Delta}$ 130-231) ( ${Delta}$ CC), and RBCC ( ${Delta}$ 239-497) variantsof TRIM5 ${alpha}$ _hu were generated in the pLPCX vector using PCR mutagenesis.The Fv-1ⁿ and Fv-1^b proteins are untagged; cDNA constructs werekindly provided by Jonathan P. Stoye. Recombinant MLV expressinggreen fluorescent protein (MLV-GFP) was prepared by calciumphosphate transfection of 293T cells with the pCIG Gag/Pol vector(5), an MLV vector expressing GFP, and pVPack-VSV-G at a weightratio of 15:15:4, respectively. The pVPack-VSV-G plasmid expressesthe vesicular stomatitis virus (VSV) G envelope glycoprotein,which mediates efficient entry into a variety of vertebratecells (40). All MLV-GFP vectors were titrated onto 293T cellsand normalized for infectivity based on a dilution of virusthat yielded 50% infected cells.

A single-round infection assay using MLV-GFP. MDTF cells (2 x 10⁴) stably transduced with either an emptyLPCX vector or LPCX expressing HA-tagged TRIM5 or untagged Fv-1were seeded onto a 24-well plate and incubated overnight at37°C. Various doses of normalized N- or B-MLV-GFP were thendiluted to 500 µl and added to the cells in the presenceof 5.0 µg/ml Polybrene. After 16 h of incubation, thevirus-containing medium was replaced with fresh medium and incubationcontinued for an additional 48 h. GFP-positive cells were thenquantified using fluorescence-activated cell sorting (FACS).

Fate-of-capsid assay. Recombinant MLV virus-like particles (VLPs) were produced bycalcium phosphate cotransfection of 293T cells with pCIGN, pCIGB,pCIGNBNN, or pCIGBNBB vector (5), along with pVPack-VSV-G, ata weight ratio of 15:4.

Stably transduced NIH 3T3 (1.5 x 10⁶) or MDTF (1.5 x 10⁶) cellsexpressing the different TRIM5 or Fv-1 variants were seededin 80-cm² flasks. The following day, the cells were incubatedwith 5 to 10 ml (approximately 2.5 x 10⁵ to 5.0 x 10⁵ transcriptaseunits) of N-, B-, NBNN-, or BNBB-MLV VLPs at 4°C for 30min to allow viral attachment to the cells. The cells were thenshifted to 37°C until they were harvested at various timepoints. For cells harvested at time points later than 4 h, thevirus was removed after 4 h and replaced with fresh medium.The cells were washed three times using ice-cold phosphate-bufferedsaline (PBS) and detached by treatment with 1.0 ml of pronase(7.0 mg/ml in Dulbecco's modified Eagle's medium) for 5 minat 25°C. The cells were then washed three times with PBS.The cells were resuspended in 2.5 ml hypotonic lysis buffer(10 mM Tris-HCl, pH 8.0, 10 mM KCl, 1 mM EDTA, and one Completeprotease inhibitor tablet) and incubated on ice for 15 min.The cells were lysed using 15 strokes in a 7.0-ml Dounce homogenizerwith pestle B. Cellular debris was cleared by centrifugationfor 3 min at 3,000 rpm. To allow assessment of the total inputMLV p30 capsid protein, 100 µl of the cleared lysate wascollected, made 1x in sodium dodecyl sulfate (SDS) sample buffer,and analyzed by SDS-polyacrylamide gel electrophoresis (PAGE)and Western blotting (see below). Then, 2.0 ml of the clearedlysate was layered onto a 50% sucrose (weight per volume) cushionin 1x PBS and centrifuged at 125,000 x g for 2 h at 4°Cin a Beckman SW41 rotor. Following centrifugation, 100 µlof the topmost portion of the supernatant was collected andmade 1x in SDS sample buffer; this sample is referred to asthe soluble p30 fraction. The pellet was resuspended in 50 µl1x SDS sample buffer and is referred to as the particulate p30fraction. All samples were then subjected to SDS-PAGE and Westernblotting (see below).

Some pilot experiments were conducted using sucrose cushionsin which the sucrose concentration ranged from 45 to 70% (weightper volume).

Immunoblotting. HA-tagged TRIM5 variants were detected using the horseradishperoxidase-conjugated 3F10 antibody. The MLV p30 protein wasdetected using a rat monoclonal antibody purified from the R187hybridoma cell line (American Type Culture Collection).

Analysis of the N-MLV genome. Approximately 1.5 x 10⁶ MDTF cells stably transduced with eitheran empty LPCX vector or an LPCX vector expressing TRIM5 ${alpha}$ _hu wereseeded in 80-cm² flasks. The following day, the cells were incubatedwith 5.0 ml (approximately 2.5 x 10⁵ to 5.0 x 10⁵ reverse transcriptaseunits) of N-MLV-GFP at 4°C for 30 min to allow viral attachmentto the cells. The cells were then shifted to 37°C for 2h and analyzed using the fate-of-capsid assay, as describedabove. The pellet was resuspended in either 50 µl 1x SDSsample buffer and subjected to SDS-PAGE and Western blotting(see above) or 250 µl RLT RNeasy lysis buffer, and totalRNA was purified using an RNeasy Kit (QIAGEN). Reverse transcription(RT) PCR was performed using a QuantiTect SYBR Green RT-PCRkit (QIAGEN) and primers specific to the GFP gene in the vector(forward primer, GACGTAAACGGCCACAAGTT; reverse primer, GGTCTTGTAGTTGCCGTCGT).The reaction mixtures contained Quantitect SYBR Green, 500 nMof each primer, and 5.0 µl of purified RNA. The PCR conditionswere 30 min at 50°C and 15 min at 95°C, followed by40 cycles of 15 seconds at 95°C and 30 seconds at 72°C,on an MJ Research DNA Engine Opticon.

RESULTS

Top

Results

Establishment of an assay to investigate the postentry fate of MLV capsids in infected cells. We previously utilized the fate-of-capsid assay to demonstratethat a decrease in the level of particulate HIV-1 capsids isobserved in the cytosol of cells expressing a restricting TRIM5 ${alpha}$ protein (34). To investigate the fate of MLV capsids in infectedcells, we developed an approach that would allow us to distinguishcytosolic MLV capsids that are potentially on the infectionpathway from capsids that are nonspecifically endocytosed andthat do not lead to infection of the cell. Because the densityof endosomes is less than that of retroviral capsids, endosome-associatedcapsids can be separated from cytosolic capsids by density gradientcentrifugation. To identify the appropriate sucrose concentrationsthat would allow discrimination between endosomal and cytosoliccapsids, we incubated MDTF cells with N-MLV and B-MLV that lackedenvelope glycoproteins or that were pseudotyped with the VSVG envelope glycoprotein. Although the viruses lacking envelopeglycoproteins can attach to cells and be endocytosed, the capsidsof these viruses do not enter the cytosol because virus-hostcell membrane fusion does not occur. Figure 1A (left) showsthat postnuclear lysates from MDTF cells contain similar levelsof the N-MLV capsid protein, p30, following exposure to viruseswith and without envelope glycoproteins. Sedimentation through45 to 55% sucrose solutions allowed separation of particulatecapsids from endosomal capsids (Fig. 1A, right). Density gradientsedimentation through solutions of 60% or higher concentrationsof sucrose resulted in decreased recovery of cytosolic particulateN-MLV capsids. The density of a 60% (weight per volume) sucrosesolution, 1.23 g/ml, corresponds exactly to the reported densityof Moloney MLV capsids (1).

View larger version (41K):
[in this window]
[in a new window]

FIG. 1. Assay to follow the fate of the MLV capsid within infected cells. (A) MDTF cells transduced with an empty LPCX control vector were infected with either VSV G-pseudotyped (Env+) N-MLV or envelope-deficient (Env–) N-MLV virus-like particles for 4 h. Cell lysates were then prepared, and an aliquot was used for Western blotting with an antibody directed against the MLV p30 capsid protein (left). The remaining cell lysates were analyzed on gradients formed with the indicated concentrations of sucrose (weight per volume). The pellets were Western blotted using an antibody directed against the MLV p30 capsid protein. (B) MDTF cells transduced with an empty LPCX control vector were infected with either VSV G-pseudotyped (Env+) or envelope-deficient (Env–) N-MLV or B-MLV virus-like particles for 4 h. Cell lysates were then prepared and analyzed on gradients formed with the indicated concentrations of sucrose (weight per volume). The total input and pellets were Western blotted using an antibody directed against the p30 capsid protein. (C) MDTF cells stably transduced with either an empty LPCX control vector or an LPCX vector expressing TRIM5 ${alpha}$ _hu were infected with either VSV G-pseudotyped (Env+) or envelope-deficient (Env–) N-MLV-GFP for 2 h and analyzed using the fate-of-capsid assay, as described in Materials and Methods. The total input, supernatants, and pellets were Western blotted using an antibody directed against the p30 capsid protein. (D) MDTF cells transduced with either an empty LPCX control vector or an LPCX vector expressing TRIM5 ${alpha}$ _hu were infected with either VSV G-pseudotyped (Env+) or envelope-deficient (Env–) N-MLV-GFP for 2 h and analyzed by the fate-of-capsid assay. The presence of viral RNA within the pelleted cores was detected by RT-PCR, as described in Materials and Methods. The amount of viral RNA in the pellet associated with the LPCX cells exposed to (Env+) N-MLV-GFP was standardized to 100% and set as a reference for comparison to the RNA levels associated with the LPCX-transduced cells exposed to (Env–) N-MLV-GFP and the TRIM5 ${alpha}$ _hu-expressing cells exposed to the (Env+) N-MLV-GFP. The error bars indicate standard deviations.

The results obtained with B-MLV differed from those seen forN-MLV. The amounts of MLV p30 capsid proteins in the lysatesof MDTF cells exposed to VSV G-pseudotyped B-MLV virions weretypically within threefold of those observed in cells exposedto the VSV G-pseudotyped N-MLV virions (Fig. 1B, left). However,unlike the cytosolic N-MLV capsids, the cytosolic B-MLV capsidsdid not sediment through 55% sucrose cushions (Fig. 1B, right).This result suggests that, under these conditions, cytosolicB-MLV capsids exhibit lower density or stability, or both, thanN-MLV capsids. Based on these observations, we employed 50%(weight per volume) sucrose cushions for our subsequent analysesof the fates of both N-MLV and B-MLV capsids after infection.

To investigate the effect of TRIM5 ${alpha}$ _hu expression in the targetcells on the fate of the N-MLV capsid, MDTF cells transducedwith the empty LPCX vector or LPCX expressing TRIM5 ${alpha}$ _hu were incubatedwith N-MLV particles pseudotyped with VSV G glycoprotein orlacking envelope glycoproteins. Cell lysates cleared of nucleiand large debris were layered onto 50% sucrose cushions andcentrifuged. The input lysates from the cells incubated withthe virions lacking envelope glycoproteins, as well as withthe VSV G-pseudotyped virions, contained detectable p30 capsidproteins (Fig. 1C). Particulate cytosolic capsids were readilydetected 2 hours after infection of the control LPCX-transducedcells with VSV G-pseudotyped N-MLV. In comparison, by 2 hoursafter infection of TRIM5 ${alpha}$ _hu-expressing cells with VSV G-pseudotypedN-MLV, the amount of cytosolic capsid that sedimented throughthe 50% sucrose cushion was greatly reduced. The supernatantsthat did not enter the 50% sucrose cushion were analyzed forthe presence of the N-MLV capsid protein. Multiple 100-µlsamples were sequentially removed from the top of the supernatantsand Western blotted for the p30 capsid protein. Figure 1C showsthe results obtained for the uppermost layer of supernatants.The amount of the p30 capsid protein in this supernatant layerfrom the TRIM5 ${alpha}$ _hu-expressing cells was greater than that seenfor the LPCX-transduced control cells. Similar results wereobtained for the additional 100-µl samples taken fromsequentially lower layers of the supernatants (data not shown).The endosomal layer that bands immediately above the 50% sucrosecushion demonstrated high levels of p30 capsid protein, as wellas the unprocessed p65 Gag precursor protein, for both the LPCX-transducedand TRIM5 ${alpha}$ _hu-expressing cells (data not shown). This endosomallayer apparently contains immature virion particles, as wellas mature virions that have not entered the cytosol. To avoidsampling this endosomal layer, we analyzed only the uppermostfraction of the supernatants in subsequent experiments.

We conclude that, in TRIM5 ${alpha}$ _hu-expressing cells compared withcontrol cells, a reduction in the level of particulate capsidsis accompanied by an increase in the amount of soluble capsidproteins in the cytosol. Note that, because only a fractionof the supernatant is sampled and analyzed, a quantitative conversionof capsid protein from the pellet to the supernatant is notexpected. These results are consistent with a model in whichTRIM5 ${alpha}$ _hu-mediated restriction of N-MLV infection is accompaniedby an accelerated conversion of particulate capsid complexesto smaller subunits in the cytosol. The major fraction of N-MLVcapsid proteins detectable in TRIM5 ${alpha}$ _hu-expressing cells did notexhibit evident changes in migration on SDS-polyacrylamide gelscompared with capsid proteins derived from control cells. Thus,most N-MLV capsid proteins in TRIM5 ${alpha}$ _hu-expressing cells do notundergo extensive posttranslational modifications (e.g., ubiquitylationor SUMOylation) that differ from those occurring in the controlcells.

To document that viral RNA is associated with the particulatecapsids detected in the assay described above, the pellets fromthe sucrose density gradients were used for RNA extraction.The extracted RNA was reverse transcribed and quantified byreal-time PCR. The amount of viral RNA detected by this methodwas proportional to the amount of p30 capsid protein pelletedfrom the lysates of TRIM5 ${alpha}$ _hu-expressing and LPCX control cellsexposed to envelope-deficient and VSV G-pseudotyped N-MLV virions(compare Fig. 1D with the pellet p30 in C). Thus, the capsidsthat sediment in this assay are associated with viral RNA.

Association of human TRIM5 ${alpha}$ restriction with decreases in the amount of particulate N-MLV capsids in the cytosol. To examine the relationship between TRIM5 ${alpha}$ _hu-mediated restrictionand the levels of particulate N-MLV capsids in the cytosol ofinfected cells, we applied the fate-of-capsid assay to MDTFand NIH 3T3 cells expressing different TRIM proteins and exposedto N-MLV and B-MLV. MDTF and NIH 3T3 cells expressing TRIM5 ${alpha}$ _hu,TRIM5 ${alpha}$ _rh, and the mouse TRIM protein, 9230105E10, were studied(Fig. 2A). The mouse 9230105E10 protein is related to TRIM5but is not orthologous and does not restrict N-MLV infection.As shown in Fig. 2B, the expression of TRIM5 ${alpha}$ _hu potently restrictedN-MLV in MDTF cells, whereas only a modest level of restrictionwas observed in cells expressing TRIM5 ${alpha}$ _rh. The efficiency ofN-MLV infection of cells expressing the murine TRIM protein,9230105E10, was comparable to that of control cells transducedwith the empty LPCX vector. B-MLV infection was unaffected bythe expression of any of the TRIM variants.

View larger version (57K):
[in this window]
[in a new window]

FIG. 2. Effect of the expression of a restricting TRIM ${alpha}$ protein on the amounts of particulate N-MLV capsids in the cytosol of infected cells. (A) Steady-state expression levels of the TRIM proteins are shown. Lysates from MDTF or NIH 3T3 cells transduced with either an empty LPCX vector or LPCX vectors expressing HA-tagged TRIM proteins were subjected to Western blotting using an anti-HA antibody. The lysates were also blotted against ß-actin to control for total protein. "Mouse" refers to the mouse 9230105E10 protein, used here as a negative control. (B) MDTF cells transduced with LPCX vectors expressing the indicated TRIM proteins were infected with various doses of N-MLV-GFP or B-MLV-GFP. GFP-positive cells were quantified by FACS analysis. (C) MDTF or NIH 3T3 cells stably transduced with either an empty LPCX control vector or an LPCX vector expressing the indicated TRIM protein were infected with VSV G-pseudotyped N- or B-MLV virus-like particles for 4 h and analyzed using the fate-of-capsid assay, as described in Materials and Methods. Total input, supernatants, and pellets were Western blotted using an antibody directed against the p30 capsid protein. "Mouse" refers to the mouse 9230105E10 protein.

Using the fate-of-capsid assay, we analyzed the amounts of particulatecapsids in the cytosol of MDTF and NIH 3T3 cells expressingthe various TRIM proteins. As shown in Fig. 2C, expression ofthe potently restricting TRIM5 ${alpha}$ _hu protein resulted in a dramaticreduction in the amount of particulate cytosolic N-MLV capsidscompared to the amount in the empty LPCX control cells. Importantly,this decrease in particulate N-MLV capsid coincided with anincrease in the amount of soluble p30 capsid protein withinthe supernatant. Only a slight reduction in the amount of particulateN-MLV capsids was observed in the cytoplasm of cells expressingthe moderately restricting TRIM5 ${alpha}$ _rh protein. Expression of thenonrestricting mouse 9230105E10 TRIM protein had no effect onthe amount of particulate cytosolic N-MLV capsids recoveredcompared with the amount in control cells. The amount of particulateB-MLV capsids recovered from the cytosol of the MDTF and NIH3T3 cells was generally less than that in the N-MLV capsids,despite similar amounts of input capsid. This may be relatedto differences in the density and/or stability of N-MLV andB-MLV cytosolic capsids, as discussed above. Expression of theTRIM variants had no significant effect on the amounts of particulateB-MLV capsids. In some experiments in which the amount of pelletableB-MLV p30 was low, minor variation in pelletable p30 was observed,but this was not reproducible. We conclude that the expressionof TRIM5 ${alpha}$ _hu results in restriction of N-MLV infection; accompanyingthis restriction are decreases in the levels of particulateN-MLV capsids and increases in the levels of soluble capsidprotein in the cytosol.

Timing of the TRIM5 ${alpha}$ _hu effect on particulate cytosolic N-MLV capsids. Studies examining the effects of cyclosporine A treatment havedemonstrated that the owl monkey restriction factor, TRIMCyp,mediates HIV-1 restriction within 15 min of virus entry intothe cell (22, 27). Furthermore, previous fate-of-capsid studieshave demonstrated that TRIM5 ${alpha}$ _rh promotes the disappearance ofparticulate cytosolic HIV-1 capsids within 1 h after infection(34). These data suggest that TRIM proteins block retroviralinfection shortly after virus entry into the cytoplasm. To determinehow fast TRIM5 ${alpha}$ _hu decreases the levels of particulate cytosolicN-MLV capsids, MDTF cells were incubated with VSV-G-pseudotypedN-MLV at 4°C and then the temperature was raised to 37°Cto allow virus entry to occur. At various times after the temperatureincrease, the fate-of-capsid assay was performed. As shown inFig. 3, particulate N-MLV capsids were readily detectable inthe cytosol of MDTF cells containing an empty LPCX vector within15 min of the temperature increase. By contrast, the expressionof TRIM5 ${alpha}$ _hu resulted in decreases in the amounts of particulateN-MLV capsids that were evident by 15 min after the temperatureincrease. TRIM5 ${alpha}$ _hu expression had no consistent effect on thesteady-state levels of particulate B-MLV capsids. We concludethat TRIM5 ${alpha}$ _hu can promote the disappearance of particulate N-MLVcapsids in the target cell cytoplasm within 15 min of infection.

View larger version (74K):
[in this window]
[in a new window]

FIG. 3. Time course of TRIM5 ${alpha}$ _hu-induced loss of particulate N-MLV capsids in infected cells. MDTF cells transduced with either an empty LPCX vector or an LPCX vector expressing TRIM5 ${alpha}$ _hu were incubated at 4°C for 30 min with either N-MLV (A) or B-MLV (B) virus-like particles. The cells were then incubated at 37°C for the indicated times and analyzed using the fate-of-capsid assay. Total input, supernatants, and pellets were Western blotted using an antibody directed against the p30 capsid protein, as described in Materials and Methods.

Influence of residue 110 of the MLV capsid on TRIM5 ${alpha}$ _hu-mediated decreases in the amounts of particulate capsids. N-MLV susceptibility to TRIM5 ${alpha}$ _hu restriction is influenced byarginine 110 of the viral capsid (24, 36). Replacement of thisarginine with the corresponding residue of B-MLV, glutamic acid,creates NBNN-MLV, which partially escapes TRIM5 ${alpha}$ _hu restriction(24, 36). Conversely, replacing glutamic acid 110 of B-MLV withthe arginine found in the N-MLV capsid generates BNBB-MLV, whichis susceptible to TRIM5 ${alpha}$ _hu restriction (24, 36). To determineif there is a correlation between the residue at position 110of the MLV capsid and the amount of particulate capsid observedin the cytosol of restricted cells, we infected control or TRIM5 ${alpha}$ _hu-expressingMDTF or NIH 3T3 cells with N-, B-, NBNN-, and BNBB-MLV and performedthe fate-of-capsid assay. As demonstrated in Fig. 4, virusessusceptible to TRIM5 ${alpha}$ _hu restriction, N- and BNBB-MLV, exhibitedlevels of particulate capsids in cells expressing TRIM5 ${alpha}$ _hu significantlylower than those seen in cells transduced with the empty LPCXvector. By contrast, only a modest decrease in the steady-statelevel of particulate NBNN-MLV capsids was observed in TRIM5 ${alpha}$ _hu-expressingcells, consistent with the observation that NBNN-MLV can partiallyescape TRIM5 ${alpha}$ _hu restriction (24, 36). The expression of TRIM5 ${alpha}$ _huin NIH 3T3 or MDTF cells did not result in a relative decreasein the amounts of particulate B-MLV capsids. Of interest, whenthe input amount of p30 capsid protein is taken into consideration,a generalized decrease in the amounts of particulate capsidswas observed in all cell lines infected with B- and NBNN-MLVcompared to N- and BNBB-MLV-infected cells. We conclude thatthe TRIM5 ${alpha}$ _hu-mediated decrease in the level of particulate MLVcapsids in the cytosol is dependent upon the arginine at position110 of the viral capsid.

View larger version (41K):
[in this window]
[in a new window]

FIG. 4. Influence of MLV capsid residue 110 on the TRIM5 ${alpha}$ _hu-mediated loss of particulate N-MLV capsids. NIH 3T3 and MDTF cells transduced either with an empty LPCX vector or with a vector expressing TRIM5 ${alpha}$ _hu were infected with N-, B-, NBNN-, or BNBB-MLV virus-like particles for 4 h and analyzed using the fate-of-capsid assay, as described in Materials and Methods. Total input, supernatants, and pellets were Western blotted using an antibody directed against the p30 capsid protein. The amount of pelleted p30 was quantified and normalized against total input p30. The percentage of particulate p30 in TRIM5 ${alpha}$ _hu-expressing cells compared to that in the control LPCX cells is provided at the bottom of the figure for each virus.

TRIM5 ${alpha}$ _hu domains are required to promote decreases in the levels of particulate N-MLV capsids in the cytosol of cells. Previous studies using deletion mutagenesis have identifiedthe B-box 2, coiled-coil, and B30.2 domains as critical forthe antiviral activity of TRIM5 ${alpha}$ _rh (13, 21). By contrast, deletionof the RING domain only partially reduces TRIM5 ${alpha}$ _rh antiviralactivity (13, 21, 33). We wished to determine which TRIM5 ${alpha}$ _hudomains are necessary for N-MLV restriction and whether thesecorrelate with the TRIM5 ${alpha}$ _hu domains required to mediate decreasesin the level of particulate N-MLV capsids in the cytosol ofinfected cells. To that end, we generated a series of TRIM5 ${alpha}$ _hudeletion mutants and measured their abilities to restrict N-and B-MLV infection. As shown in Fig. 5A, MDTF cells expressingTRIM5 ${alpha}$ _hu are very resistant to N-MLV infection. Deletion of theRING domain (TRIM5 ${alpha}$ _hu ${Delta}$ RING) reduced the N-MLV inhibition approximately10-fold, suggesting that the RING domain potentiates, but isnot absolutely required for, restriction. By contrast, deletionof the B-Box 2 (TRIM5 ${alpha}$ _hu ${Delta}$ B-box), RING and B-box 2 (TRIM5 ${alpha}$ _hu ${Delta}$ RING/ ${Delta}$ B-box),coiled-coil (TRIM5 ${alpha}$ _hu ${Delta}$ CC), or B30.2 (TRIM5 ${alpha}$ _hu RBCC) domain resultedin TRIM5 ${alpha}$ _hu proteins that had no effect on N-MLV infection. B-MLVinfection was unaffected by the expression of any of the TRIM5 ${alpha}$ _hudeletion variants. We conclude that the B-box 2, coiled-coil,and B30.2 domains of TRIM5 ${alpha}$ _hu are essential for its anti-N-MLVactivity; the RING domain contributes significantly to the antiviralactivity but is not absolutely essential.

View larger version (47K):
[in this window]
[in a new window]

FIG. 5. Effects of deletion of the TRIM5 ${alpha}$ _hu domains on N-MLV restriction and levels of particulate N-MLV capsids in the cytosol of infected cells. (A) MDTF cells transduced with LPCX vectors expressing wild-type TRIM5 ${alpha}$ _hu or deletion mutants were infected with various doses of N-MLV-GFP or B-MLV-GFP. GFP-positive cells were quantified using FACS analysis. (B) Steady-state expression levels of TRIM5 variants are shown. Lysates from MDTF cells transduced with either an empty LPCX vector or LPCX vectors expressing the indicated HA-tagged TRIM5 ${alpha}$ _hu variants were subjected to Western blotting using an anti-HA antibody. The lysates were also blotted against ß-actin to control for total protein. (C) MDTF cells transduced with either an empty LPCX vector or vectors expressing the indicated TRIM5 ${alpha}$ _hu variants were infected with VSV G-pseudotyped (Env+) N-MLV virus-like particles for 4 h and analyzed using the fate-of-capsid assay. Cells transduced with the empty LPCX vector were also incubated with N-MLV virus-like particles lacking envelope glycoproteins (Env–). Total input, supernatants, and pellets were Western blotted using an antibody directed against the MLV p30 capsid protein.

Western blot analysis demonstrated that all of the TRIM5 ${alpha}$ _hu deletionmutants tested were expressed at least as well as the wild-typeTRIM5 ${alpha}$ _hu protein (Fig. 5B). As has been reported previously forTRIM5 ${alpha}$ _rh (8, 13, 21), deletion of the RING and/or B-box 2 domainof TRIM5 ${alpha}$ _hu resulted in increased steady-state levels of expression.

To identify which TRIM5 ${alpha}$ _hu domains are involved in mediatingdecreases in the levels of particulate cytosolic N-MLV capsids,we performed the fate-of-capsid assay using MDTF cells expressingthe TRIM5 ${alpha}$ _hu deletion mutants. As observed previously, the expressionof wild-type TRIM5 ${alpha}$ _hu greatly reduced the amount of particulateN-MLV capsids in the cytosol of MDTF cells (Fig. 5C). Deletionof any TRIM5 ${alpha}$ _hu domain severely compromised the ability of TRIM5 ${alpha}$ _huto promote decreases in the level of particulate N-MLV capsids.An N-MLV vector lacking an envelope glycoprotein was includedto ensure that endosomal p30 was not contaminating the cytosolicp30 fractions (34). The assay was repeated, using larger amounts(2.0 ml and 10.0 ml) of N-MLV VLPs, with similar results (datanot shown). We conclude that deletion of any TRIM5 ${alpha}$ _hu domainnecessary for potent restriction of N-MLV also compromises theability of TRIM5 ${alpha}$ _hu to promote a decrease in the level of particulateN-MLV capsids in the cytosol of infected cells.

Deletion of the TRIM5 ${alpha}$ B-box 2 domain completely abrogates HIV-1and N-MLV restriction yet has no effect on TRIM5 ${alpha}$ multimerizationor interaction with the viral capsid (13, 18, 21, 34). Theseobservations suggest that the B-box 2 domain may mediate aneffector function critical for retroviral restriction. We examinedthe consequences of a single amino acid change within the TRIM5 ${alpha}$ _huB-box 2 domain for N-MLV restriction and cytosolic levels ofN-MLV capsid particles. Previously, we identified an alaninesubstitution within the TRIM5 ${alpha}$ _rh B-box 2 domain that completelyabrogated HIV-1 restriction while maintaining wild-type TRIM5 ${alpha}$ _rhexpression levels and subcellular localization (13). The analogousTRIM5 ${alpha}$ _hu variant [TRIM5 ${alpha}$ _hu(C95A)] was generated by substitutionof alanine for cysteine 95 in the B-box 2 domain. As shown inFig. 6A, TRIM5 ${alpha}$ _hu(C95A) was expressed in MDTF cells at a levelat least as great as that of the wild-type TRIM5 ${alpha}$ _hu protein.Despite this efficient level of expression, TRIM5 ${alpha}$ _hu(C95A) wascompletely unable to restrict N-MLV infection (Fig. 6B). Furthermore,the expression of TRIM5 ${alpha}$ _hu(C95A) had no effect on the amountof particulate cytosolic N-MLV capsids compared with the levelsobserved in the control cells transduced with the empty LPCXvector (Fig. 6C). By contrast, expression of the wild-type TRIM5 ${alpha}$ _huprotein resulted in a decrease in the amount of particulateN-MLV capsids and a concomitant increase in the amount of solublecapsid proteins in the cytosol of infected cells. These datasuggest that the conserved cysteine at position 95 of the B-box2 domain is critical for both TRIM5 ${alpha}$ _hu-mediated processes: restrictionof N-MLV infection and the conversion of particulate cytosolicN-MLV capsids into soluble forms of capsid.

View larger version (25K):
[in this window]
[in a new window]

FIG. 6. Effect of a single amino acid change in the TRIM5 ${alpha}$ _hu B-box 2 domain on N-MLV restriction and the loss of particulate N-MLV capsids. (A) Steady-state expression levels of TRIM5 variants are shown. Lysates from MDTF cells transduced with either an empty LPCX vector or LPCX vectors expressing HA-tagged TRIM5 ${alpha}$ _hu or TRIM5 ${alpha}$ _hu(C95A) were subjected to Western blotting using an anti-HA antibody. The lysates were also blotted against ß-actin to control for total protein. (B) MDTF cells transduced with either an empty LPCX vector or LPCX vectors expressing TRIM5 ${alpha}$ _hu or TRIM5 ${alpha}$ _hu(C95A) were infected with various doses of N-MLV-GFP or B-MLV-GFP. GFP-positive cells were quantified using FACS analysis. (C) MDTF cells expressing either an empty LPCX vector or LPCX vectors expressing TRIM5 ${alpha}$ _hu or TRIM5 ${alpha}$ _hu(C95A) were infected with VSV G-pseudotyped (Env+) N-MLV virus-like particles for 4 h and analyzed using the fate-of-capsid assay. The control cells transduced with the empty LPCX vector were also incubated with N-MLV virus-like particles without envelope glycoproteins (Env–). Total input, supernatants, and pellets were Western blotted using an antibody directed against the p30 capsid protein.

Effect of Fv-1 expression on the amount of particulate MLV capsid in the cytosol of infected cells. Although TRIM5 ${alpha}$ and Fv-1 restrictions are both influenced byresidue 110 of the MLV capsid, they target different steps ofthe MLV life cycle: TRIM5 ${alpha}$ restricts N-MLV prior to reverse transcription,whereas Fv-1 restricts N- or B-MLV following the completionof reverse transcription (24, 36). To determine whether Fv-1restriction modulates the amount of particulate cytosolic MLVcapsids, we first generated MDTF cells stably expressing Fv-1ⁿor Fv-1^b and examined their abilities to support N- or B-MLVinfection. As shown in Fig. 7A, the expression of Fv-1ⁿ potentlyrestricted B-MLV infection but had no effect on N-MLV infection.Conversely, the expression of Fv-1^b potently restricted N-MLVinfection but had no effect on B-MLV infection.

View larger version (26K):
[in this window]
[in a new window]

FIG. 7. Effect of Fv-1 expression on the amount of particulate MLV capsids recovered in the fate-of-capsid assay. (A) MDTF cells transduced with LPCX vectors expressing either Fv-1ⁿ or Fv-1^b were infected with various doses of N-MLV-GFP or B-MLV-GFP. GFP-positive cells were quantified by FACS analysis. The experiment was repeated with comparable results; the data from a single experiment are shown. (B) MDTF cells expressing either an empty LPCX vector or LPCX vectors expressing TRIM5 ${alpha}$ _hu, Fv-1ⁿ, or Fv-1^b were incubated with VSV G-pseudotyped N-MLV or B-MLV virus-like particles for 4 h. The virus-containing medium was then replaced with fresh medium, and the cells were lysed 16 h later. Cell lysates were analyzed using the fate-of-capsid assay. Total input, supernatants, and pellets were Western blotted using an antibody directed against the p30 capsid protein.

The potency of Fv-1 restriction in MDTF cells allows examinationof the effect of Fv-1 restriction on the level of particulateMLV capsids following infection. As shown in Fig. 7B, equivalentlevels of particulate N- or B-MLV capsids were recovered after16 h from the cytosol of MDTF cells transduced with an emptyLPCX vector or vectors expressing Fv-1ⁿ or Fv-1^b. By contrast,expression of TRIM5 ${alpha}$ _hu in the MDTF cells resulted in a completeloss of particulate capsids from the cytosol, consistent withthe results described above. As observed previously, comparedwith the amount of particulate N-MLV capsids, significantlyless particulate B-MLV capsid protein was recovered after centrifugationof cytosolic lysates. Similar results were also obtained 4 hpostinfection (data not shown). These results suggest that theexpression of a restricting Fv-1 protein in MDTF cells exertslittle or no effect on the amounts of particulate MLV capsidsin the cytosol of infected cells.

DISCUSSION

Top

Discussion

In this study, we utilized a recently developed fate-of-capsidassay (24, 36) to demonstrate that TRIM5 ${alpha}$ _hu expression rapidlydecreases the steady-state levels of particulate N-MLV capsidsin the cytosol of the infected cell. The study of TRIM proteinsfrom different species, TRIM5 ${alpha}$ _hu mutants, and MLV capsid variantsrevealed a close correlation between the restriction of virusinfection and decreases in the amounts of particulate viralcapsids in the cytosol. Hypothetically, two models might accountfor the TRIM5 ${alpha}$ _hu-associated decreases in the amounts of particulateN-MLV capsids observed in the fate-of-capsid assay: (i) TRIM5 ${alpha}$ _hudegrades the N-MLV capsid or (ii) TRIM5 ${alpha}$ _hu promotes the rapiddisassembly of the N-MLV capsid. Several lines of evidence suggestthat neither ubiquitin modification nor degradation of the retroviralcapsid is an essential element of the TRIM5 ${alpha}$ restriction mechanism.First, treatment of TRIM5 ${alpha}$ _rh-expressing cells with proteasomalinhibitors does not relieve HIV-1 restriction (5a, 22, 34, 37).Moreover, N-MLV infection was efficiently blocked by TRIM5 ${alpha}$ _huin a Chinese hamster E36 cell line expressing a temperature-sensitiveE1 ubiquitin ligase, even at the nonpermissive temperature (22).In our study and a previous study (34), no modified forms orcleavage products of the N-MLV p30 capsid protein were observedspecifically in TRIM5 ${alpha}$ _hu-expressing cells. Most importantly,in TRIM5 ${alpha}$ _hu-expressing cells compared with control cells, anincrease in soluble p30 typically accompanied the observed decreasein particulate p30, suggesting that TRIM5 ${alpha}$ _hu promotes the conversionof the particulate viral core into slower-sedimenting formsof p30. Taken together, these data argue that ubiquitin ligation,proteasome degradation, and/or massive degradation of the viralcore are not essential components of TRIM5 ${alpha}$ restriction.

Our data support a model in which TRIM5 ${alpha}$ _hu mediates N-MLV restrictionby promoting the rapid disassembly of the viral capsid. Previousstudies have hinted at the existence of an optimal stabilityof the retroviral core for HIV-1 infection (9, 29). Changesin the HIV-1 capsid protein that alter the stability of theviral core in either a positive or negative direction have deleteriouseffects on the efficiencies of early infection events (9). Thesedata suggest that the retroviral core is a metastable structurethat is stable enough to allow reverse transcription yet sufficientlylabile to facilitate the uncoating necessary for subsequentsteps in the viral life cycle. TRIM5 ${alpha}$ _hu may accelerate the normaluncoating process or promote aberrant disassembly of the N-MLVcore. Either of these processes might result in aborted reversetranscription and infection. Premature disassembly of the retroviralcapsid may expose other viral proteins and the genome to ubiquitin-dependentor independent degradation pathways. Wu et al. recently reportedthat treatment of TRIM5 ${alpha}$ _rh-expressing cells with proteasome inhibitorsallowed HIV-1 to complete reverse transcription, even thoughthe cells remained restricted for HIV-1 infection (37). If theviral cDNA detected in their study is on the infection pathway,the result suggests that the TRIM5 ${alpha}$ _rh restriction mechanism doesnot necessarily rely upon the degradation of the viral genome.

Interestingly, particulate B-MLV capsids were inefficientlyrecovered from the cellular cytosol by our fate-of-capsid assay.Moreover, the efficiency with which we recovered particulateMLV capsids was influenced by the identity of residue 110 ofthe MLV capsid (Fig. 4). One explanation for these observationsis that N- and B-MLV have evolved relatively stable or unstablecapsids, respectively. The intrinsic stability of the MLV capsidcould govern viral susceptibility to intracellular restrictionfactors, possibly explaining why N-MLV and not B-MLV is targetedby a diverse group of TRIM molecules (3, 31, 32, 36). For example,a virus that has evolved a relatively stable capsid might bemore susceptible to factors that promote rapid capsid destabilizationthan a virus that normally tolerates a less stable capsid. Alternatively,stable N-MLV capsids could provide a more suitable recognitionsurface for TRIM molecules. TRIM5 ${alpha}$ _hu has been reported to bindN-MLV, but not B-MLV, capsids (28). Furthermore, Shi and Aikendemonstrated that only stable HIV-1 virus-like particles areable to compete for TRIM5 ${alpha}$ (29). Destabilization of the HIV-1core by mutagenesis abrogates the ability of these virus-likeparticles to saturate TRIM5 ${alpha}$ restriction, suggesting that thestability of the retroviral core can govern the efficiency ofinteraction with TRIM5 ${alpha}$ .

TRIM5 ${alpha}$ _rh-mediated restriction of HIV-1 infection involves multipledomains: the B30.2 domain specifies recognition of the incomingviral capsids, the coiled coil promotes the multimerizationof TRIM5 ${alpha}$ molecules, and an effector region (RING and B-box 2domains), although not needed for viral capsid binding, contributesto full restriction. Our deletion analysis of the TRIM5 ${alpha}$ _hu domainsdemonstrated that the B-box 2, coiled-coil, and B30.2 domainsare essential for mediating N-MLV restriction. Furthermore,for this set of TRIM5 ${alpha}$ deletion mutants, we observed a correlationbetween restriction of infection and the ability to promotedecreases in the levels of particulate N-MLV capsids in thecytosol of infected cells. Our assay for restriction of N-MLVinfections may be more sensitive than the fate-of-capsid assay,based upon the observation that deletion of the TRIM5 ${alpha}$ _hu RINGdomain abrogated activity in the latter assay but only partiallyattenuated virus restriction.

A recent study has demonstrated that the overexpression of theFv-1^b allele in human TE671 cells can compete with endogenousTRIM5 ${alpha}$ _hu (20). Indeed, the expression of Fv-1^b allows N-MLV toovercome TRIM5 ${alpha}$ _hu restriction and become blocked at a post-reversetranscription step, characteristic of Fv-1 restriction (20).These data suggest that both TRIM5 ${alpha}$ _hu and Fv-1 interact withthe MLV capsid shortly after viral entry but restrict MLV infectioneither before or after reverse transcription, respectively.In this study, we demonstrated that the expression of TRIM5 ${alpha}$ _hucauses a rapid decrease in particulate N-MLV capsids withinthe cytoplasm as early as 15 min postinfection. Conversely,no change in the level of particulate MLV capsids was observedin the cytosol of Fv-1ⁿ- or Fv-1^b-expressing cells at either4 or 16 h after infection. These data suggest that Fv-1 andTRIM5 ${alpha}$ _hu restrict MLV infection through two distinct mechanisms.

Further studies examining early postentry events and how theseevents are modulated by host factors will expand our knowledgeof retroviral biology and the mechanism of TRIM5 ${alpha}$ restriction.

ACKNOWLEDGMENTS

We thank Yvette McLaughlin and Elizabeth Carpelan for manuscriptpreparation and Kathleen McGee-Estrada and Alan Engelman forassistance with the RT-PCR assay.

We thank the National Institutes of Health (AI063987 and a Centerfor AIDS Research Award, AI60354), the International AIDS VaccineInitiative, the Bristol-Myers Squibb Foundation, and the lateWilliam F. McCarty-Cooper. H.J. was supported by a fellowshipfrom the Canadian Institutes of Health Research and by the WilliamA. Haseltine Foundation for the Arts and Sciences. M.S. wassupported by a National Defense Science and Engineering Fellowshipand is a Fellow of the Ryan Foundation.

FOOTNOTES

* Corresponding author. Mailing address: Dana-Farber Cancer Institute, 44 Binney Street, JFB 824, Boston, MA 02115. Phone: (617) 632-3371. Fax: (617) 632-4338. E-mail: joseph_sodroski{at}dfci.harvard.edu.

Published ahead of print on 29 November 2006.

REFERENCES

Top