This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bitko, V.
Right arrow Articles by Barik, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bitko, V.
Right arrow Articles by Barik, S.

 Previous Article  |  Next Article 

Journal of Virology, February 2007, p. 1786-1795, Vol. 81, No. 4
0022-538X/07/$08.00+0     doi:10.1128/JVI.01420-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Nonstructural Proteins of Respiratory Syncytial Virus Suppress Premature Apoptosis by an NF-{kappa}B-Dependent, Interferon-Independent Mechanism and Facilitate Virus Growth{triangledown}

Vira Bitko,1 Olena Shulyayeva,1 Barsanjit Mazumder,2 Alla Musiyenko,1 Murali Ramaswamy,3 Dwight C. Look,3 and Sailen Barik1*

Department of Biochemistry and Molecular Biology, University of South Alabama, College of Medicine, 307 University Blvd., Mobile, Alabama 36688-0002,1 Department of Biological, Geological, and Environmental Sciences, College of Science, Cleveland State University, Cleveland, Ohio 44115,2 Department of Internal Medicine, University of Iowa Carver College of Medicine, 200 Hawkins Drive, Iowa City, Iowa 522423

Received 6 July 2006/ Accepted 21 November 2006


arrow
ABSTRACT
 
The two nonstructural (NS) proteins NS1 and NS2 of respiratory syncytial virus (RSV) are abundantly expressed in the infected cell but are not packaged in mature progeny virions. We found that both proteins were expressed early in infection, whereas the infected cells underwent apoptosis much later. Coincident with NS protein expression, a number of cellular antiapoptotic factors were expressed or activated at early stages, which included NF-{kappa}B and phosphorylated forms of protein kinases AKT, phosphoinositide-dependent protein kinase, and glycogen synthase kinase. Using specific short interfering RNAs (siRNAs), we achieved significant knockdown of one or both NS proteins in the infected cell, which resulted in abrogation of the antiapoptotic functions and led to early apoptosis. NS-dependent suppression of apoptosis was observed in Vero cells that are naturally devoid of type I interferons (IFN). The siRNA-based results were confirmed by the use of NS-deleted RSV mutants. Early activation of epidermal growth factor receptor (EGFR) in the RSV-infected cell did not require NS proteins. Premature apoptosis triggered by the loss of NS or by apoptosis-promoting drugs caused a severe reduction of RSV growth. Finally, recombinantly expressed NS1 and NS2, individually and together, reduced apoptosis by tumor necrosis factor alpha, suggesting an intrinsic antiapoptotic property of both. We conclude that the early-expressed nonstructural proteins of RSV boost viral replication by delaying the apoptosis of the infected cell via a novel IFN- and EGFR-independent pathway.


arrow
INTRODUCTION
 
The respiratory syncytial virus (RSV), a member of the Pneumovirus genus within the family Paramyxoviridae, is a ubiquitous cause of severe respiratory infection with a worldwide and seasonal distribution (26). It is the most common cause of lower respiratory tract infection in infants and senior citizens and is life-threatening in immunocompromised individuals such as premature babies, organ recipients, and AIDS patients. Large-scale surveillance studies have estimated that tens of millions of people in the United States alone suffer from RSV infection every winter. Despite intense research for more than two decades, there is no reliable treatment or preventive medicine against RSV.

The RSV genome is a 15-kb-long, single-stranded, negative-sense RNA, transcribed and replicated by the virally encoded RNA-dependent RNA polymerase (RdRP), minimally composed of the large protein (L) and the phosphoprotein (P). The overall strategy of RSV gene expression is common to all members of the negative-strand RNA virus superfamily (2, 28). The initial rounds of transcription, known as "primary" transcription, are carried out by the RdRP activity associated with the incoming viral genome. The transcribed mRNAs are translated into de novo viral proteins including more RdRP, which boosts new rounds of viral gene expression. Perhaps the most unique feature that distinguishes the Pneumovirus genus from the rest of the Paramyxoviridae family is the presence of two nonstructural (NS) proteins, NS1 and NS2, encoded by the first two genes in the viral genome. The proteins are so named because they are not packaged into the mature virion. Nonetheless, both genes are expressed in the infected cell, and the mRNAs are relatively abundant due to the promoter-proximal (3' end of the negative-stranded genome) location of the genes.

The conceptually translated primary structures of NS1 and NS2 consist of, respectively, 139 and 124 amino acid residues. Although they are similar in length, the NS proteins possess no significant sequence homology with each other or with any other protein. Curiously, both have the same tetrapeptide sequence, DLNP, at the C terminus, and an antibody raised against a synthetic peptide corresponding to the C-terminal 12 amino acids of NS2 in fact cross-reacts with NS1 (21). The significance of the modest sequence similarity at the C terminus is unknown.

The NS proteins of human RSV have recently drawn attention because of their potential accessory function. Their absence in the infecting virion suggests that they must be nonessential for primary viral transcription. Early studies testing the role of NS genes on RSV minigenome replication showed inhibition of viral transcription and replication by NS (1, 42). Recent studies suggest that the NS proteins subvert the cellular interferon (IFN) response. Whereas wild-type RSV is a relatively poor inducer of the type I IFNs, i.e., IFN-{alpha} and IFN-ß, recombinant human RSV lacking the NS genes induced type I IFN in cultured cells (40), suggesting that the NS proteins play a role in reducing IFN gene expression. A search for its mechanism led to the finding that NS1 and NS2 act cooperatively to suppress the activation and nuclear translocation of the IFN-regulatory factor IRF-3 (41). Recent studies revealed that RSV also inhibits the type I IFN signaling cascade in the infected cell (35) via proteasome-dependent degradation of signal transducer and activator of transcription 2 (Stat2), providing a molecular mechanism for specific inhibition of the type I IFN JAK-STAT pathway. This effect was attributed to the NS proteins as NS-deficient RSV was unable to inhibit type I IFN response (25, 36). Moreover, recombinantly expressed NS proteins decreased Stat2 levels as well as type I IFN responsiveness of the infected cell (25). Thus, NS proteins may facilitate RSV replication and establishment of a productive viral infection by abrogating the antiviral effect of type I IFN. In support of this, knockdown of NS proteins by short interfering RNA (siRNA) resulted in inhibition of RSV growth and infection in mice (50). The NS2 protein also appeared to positively interact with the NF-{kappa}B pathway, as NS2-deleted recombinant RSV was deficient in activating NF-{kappa}B (41). As with the human RSV, the NS1 and NS2 proteins of bovine RSV also reduce the type I IFN-mediated antiviral state, although its mechanism remains unclear (38, 47). Interestingly, NS-deleted RSV mutants also exhibited reduced replication and small-plaque morphology in vitro (20, 40, 43). Although the exact mechanism of this remained unknown, replication of these deletion mutants was more reduced in HEp-2 cells than in Vero cells, suggesting that the ability of NS proteins to suppress type I IFN response may be at least one factor assisting wild-type RSV growth.

We and others have shown that both human and bovine strains of RSV activate apoptosis in cognate host cells at late stages of infection (4, 14, 30, 34, 37) and also sensitize the cells to extrinsic apoptotic agents (24). In mammalian cells, the AKT pathway generally promotes a prosurvival, antiapoptotic state (16, 49). The pathway begins with upstream signals activating phosphatidylinositol 3-kinase (PI3K), which then catalyzes the conversion of phosphatidylinositol 4,5-bisphosphate into 3,4,5-triphosphate. The latter activates phosphoinositide-dependent protein kinase (PDK) that phosphorylates AKT (also known as protein kinase B, or PKB), thereby activating AKT. The activated AKT phosphorylates a large number of substrates, such as Bad, glycogen synthase kinase 3 (GSK3), and I{kappa}B kinase. This leads to inactivation of the proapoptotic players such as Bad and GSK3. Simultaneously, it activates antiapoptotic players; for example, I{kappa}B kinase-mediated phosphorylation and resultant degradation of I{kappa}B (inhibitor of NF-{kappa}B) sets NF-{kappa}B free to translocate from the cytoplasm to the nucleus, leading to NF-{kappa}B-dependent activation of prosurvival and proinflammatory genes. Studies in recent years investigated these and related steps in the RSV-infected cell. Inhibition of NF-{kappa}B or AKT was shown to result in significantly earlier onset of apoptosis (44). RSV infection also led to the activation of the epidermal growth factor receptor (EGFR) between 6 and 18 h postinfection (hpi), commensurate with its early role (30). Knockdown of EGFR or its inhibition with AG1478 resulted in increased apoptosis. Moreover, between 6 and 12 h of RSV infection of A549 cells, the antiapoptotic protein BclxL increased in amount, whereas the proapoptotic protein BimEL decreased (30). It was, therefore, postulated that EGFR->extracellular signal-related kinase (ERK) signaling led to ERK-induced phosphorylation followed by proteasome-mediated degradation of BimEL in RSV-infected cells, suppressing apoptosis. However, other mechanisms were not ruled out.

In summary, it appears that multiple prosurvival molecules participate in suppressing early apoptosis in the RSV-infected cell, although their relative contributions and exact mechanisms need to be elucidated. As IFN is known to regulate apoptosis via multiple pathways (12, 47) and the NS proteins inhibit IFN synthesis and response, a logical query is whether NS proteins, expressed early in infection, also serve to block early apoptosis of the infected cell. In this paper, we infect A549 cells with nonrecombinant wild-type RSV and knock down the NS proteins by RNA interference (RNAi). We complement these experiments with NS-knockout RSV and antiapoptotic properties of recombinant NS proteins. Our overall results suggest that NS proteins of RSV indeed play a crucial role to suppress premature apoptosis and enhance viral replication in the infected cell. This is achieved through the activation of the NF-{kappa}B and PI3K/AKT pathways and appears to be independent of EGFR and IFN signaling.


arrow
MATERIALS AND METHODS
 
Growth of RSV and infection of A549 cells. Wild-type RSV Long strain of the A serotype was grown on HEp-2 cell monolayers and the NS deletion mutants on Vero cells, using standard cell culture conditions as described previously (6). The green fluorescent protein (GFP)-expressing recombinant RSV and the NS deletion RSV strains have been described before (19, 20). Viruses were further purified by precipitation with polyethylene glycol (molecular weight, 8,000) and sucrose gradient centrifugation (45). The final RSV preparation had infectious titers in the range of 108 to 109 PFU/ml and was stored frozen at –80°C in small portions. All infectious viral titers (PFU) were determined by agarose plaque assay on HEp-2 monolayers with neutral red staining (10). Infection of A549 or Vero cell monolayers with all strains of RSV (at a multiplicity of infection [MOI] of 3) was performed essentially as described previously (4, 6). NHBE cells were from Cambrex (Baltimore, MD) and were grown in monolayers using the supplier's recommended media. Infection and apoptotic studies of these cells were done essentially as described for A549 cells.

Due to the poor replication of NS-deleted RSV, all parameters (such as DNA fragmentation, assay of NF-{kappa}B, and immunoblot for P-PDK, P-AKT, and P-GSK) measured in these cells were normalized to the level of wild-type virus growth. This was done by quantitative immunoblot measuring viral N protein in the infected cell lysates, which was in turn normalized by cellular profilin as an internal control for gel loading (11).

Immunofluorescence studies and assays of cell death. Multiparametric staining of A549 or Vero cells was performed as described before (6). In short, cells were grown on coverslips in 6-well plates to about 75% confluence and infected with RSV as described above. The coverslips were washed three times with phosphate-buffered saline (PBS) and fixed in 10% trichloroacetic acid for 20 min on ice. Successive washes were then performed with 70%, 90%, and 100% ethanol and finally with PBS containing 0.2% Triton X-100. The coverslips were incubated with a mixture of polyclonal antibodies to RSV proteins G, N, and M (Chemicon International) and the corresponding rhodamine-conjugated secondary antibody (Sigma).

For qualitative detection of apoptosis on monolayers, we used the DeadEnd Fluorometric terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling (TUNEL) system (Promega) that measures apoptosis by incorporating fluorescein-12-dUTP at 3'-OH DNA ends of fragmented DNA of apoptotic cells. The fluorescein-12-dUTP-labeled DNA was visualized directly by fluorescence microscopy. Quantitative assay of apoptosis was carried out by Cell Death Detection enzyme-linked immunosorbent assay (ELISA) (Roche) that involves photometric enzymatic immunoassay of mono- and oligonucleosomes in the cytoplasmic fraction of apoptotic cell lysates.

RNA interference. We have described our siRNA design principles in detail before (2, 3, 6, 7). We ensured that the sequences satisfy the asymmetry rule (23, 39) and map to relatively unstructured regions of the mRNAs. Secondary structure predictions were performed with the aid of the Zuker algorithm (51). siRNAs against RSV Long NS1 and NS2 mRNA sequences (GenBank accession numbers U35030 and U35029, respectively) were designed by the NA(N)19TT rule with 3' dTdT extensions (6, 17). The NS1 siRNA is the following: sense strand, GUGAUUCAACAAUGACCAAdTdT; antisense strand, UUGGUCAUUGUUGAAUCUCdTdT. The NS2 siRNA is the following: sense strand, GACAUGAGACCGUUGUCACdTdT; antisense strand, GUGACAACGGUCUCAUGUCdTdT. (All sequences are written 5' to 3'.) The chemically synthesized siRNAs were purchased from Dharmacon (Lafayette, CO) and transfected with TransIT-TKO reagent (Mirus Corp., Madison, WI) as described previously (6, 7). When used, the siRNAs were transfected 6 h before infection. The "Silencer negative control #1 siRNA" (Ambion, Austin, TX) was used as "scrambled siRNA" control where mentioned.

NS1 and NS2 mRNAs were amplified by reverse transcription-PCR using the following primers (all primers are written 5' to 3'). NS1, ATGGGCAGCAATTCATTGAG and TGGCATTGTTGTGAAATTGG; NS2, TTGATGAAAAACAGGCCACA and TGCCAATGCATTCTAAGAACC. In each pair, the first primer is in sense orientation and the second is antisense. The procedure has been described previously (6) and consists of using poly(A)-selected mRNA as template in reverse transcription reactions using antisense primers, followed by treatment of the reaction with DNase-free RNase, heat inactivation of the reverse transcriptase, addition of the sense primer, PCR for 28 cycles with Taq polymerase, and finally agarose gel analysis of the products.

Immunoblot (Western) analysis. The RSV-infected (or sham-infected control) monolayer in 6-well plates was washed twice with PBS. Fifty microliters lysis buffer (50 mM Tris-HCl [pH 8.0], 50 mM NaCl, 0.1 mM EDTA, 0.1% Tween 20, 4 µg/ml phenylmethylsulfonyl fluoride) was then added to each well. The cells were scraped in the buffer and heated at 95°C for 5 min. The mixture was centrifuged at 10,000 x g for 5 min to remove any insoluble material, and equal amounts of supernatant protein (40 µg) were resolved in sodium dodecyl sulfate-14% polyacrylamide gel electrophoresis. Blots were probed with the appropriate antibody followed by corresponding secondary antibody coupled to horseradish peroxidase and developed using the ECL kit (Pierce). The chemiluminescence was detected in the LAS-1000 plus imaging system (Fuji Film). For quantitation of intracellular RSV growth, the intensity of the viral N protein band was measured by densitometry and normalized to equal amounts of profiling and detected by a specific antibody (11).

The following primary antibodies were obtained commercially (46): antibody against RS virion from Chemicon International, phospho-AKT antibody from Cell Signaling Technology, p65 antibody from Santa Cruz Biotechnology, NS-reacting antiserum from Biodesign International, and all phosphospecific antibodies (except p-AKT) from New England Biolabs. Antibodies against phospho- and nonphospho-EGFR (catalog nos. 05-483 and 05-084, respectively) were from Upstate (Millipore).


arrow
RESULTS
 
Early expression of NS proteins versus late apoptosis in RSV-infected cells. Although apoptosis has been documented following RSV infection, its detailed mechanism is unknown. In lung epithelial A549 cells, closer examination revealed that the timing of apoptosis roughly coincided with a surge of overall viral gene expression (4, 31); however, the exact viral trigger(s) of apoptosis remained unidentified. As NS1 and NS2 are the most promoter-proximal genes in the RSV genome, we determined the kinetics of their expression through the infection cycle and compared them with that of apoptosis. The results (Fig. 1A) show that NS1 and NS2 both were expressed very early in infection and reached their maximal intracellular levels sometime between 8 and 18 h. In contrast, the fusion protein F, for example, did not reach its peak until about 48 h postinfection. We then quantitated apoptosis by an ELISA-based assay for nucleosomal DNA fragmentation in parallel monolayers infected with the same virus preparation at the same time. Although detectable at 5 to 8 h, apoptosis was really prominent from about 24 h onward (Fig. 1B). The apparently lower value at 60 h is due to the loss of some dead cells that were detached during the staining procedure. These results clearly reveal the contrasting time frames of early NS protein synthesis versus late apoptosis in the RSV-infected cell.


Figure 1
View larger version (16K):
[in this window]
[in a new window]

  		FIG. 1. Kinetics of NS expression and apoptosis. (A) Total protein of RSV-infected A549 cells at the indicated times postinfection was probed in immunoblot with sera against viral NS proteins and F. C, sham-infected cells at 48 h. Note the early expression of NS1 and NS2. (B) At the same time points, apoptotic DNA fragmentation was quantitated by cell death detection ELISA (Materials and Methods). White bars, sham infected; gray bars, RSV infected. Most data points are averages of three experiments with errors shown as bars.

Knockdown of NS proteins by RNAi promotes early apoptosis. We have introduced RNA interference (RNAi) as a major tool in studies of negative-strand RNA viral growth and host-virus interactions (2, 3, 6-8, 36). To knock down NS proteins, we designed multiple short interfering RNAs (siRNAs) against specific regions of the NS1 and NS2 mRNA sequences and tested them in RSV-infected A549 cells as described in Materials and Methods. Results (Fig. 2A) show significant reduction of NS2 and NS1 proteins as well as RNA by the respective optimized siRNAs. Whereas the anti-NS2 siRNA almost completely silenced NS2 expression at 20 nM, the anti-NS1 siRNA reduced the NS1 protein levels by about half at 80 nM. Scrambled siRNA had no effect on either protein, showing specificity (Fig. 2B). We did not test anti-NS1 siRNA above 80 nM to avoid potential nonspecific effects. When we investigated apoptosis in these cells, reduction of either NS protein resulted in significant apoptosis as early as 8 h (Fig. 2C), contrasting with the 24-h onset in siRNA-untreated cells (Fig. 1B).


Figure 2
View larger version (16K):
[in this window]
[in a new window]

  		FIG. 2. Effect of anti-NS siRNA on NS proteins and apoptosis. The design and transfection of anti-NS siRNAs have been described in Materials and Methods. (A) Immunoblot and reverse transcription-PCR analyses show siRNA-dependent reduction of NS proteins (P) and RNA (R), respectively, measured at 18 hpi. (B) Immunoblot showing no effect of scrambled siRNA. U, uninfected cells, treated with 20 nM scrambled siRNA. (C) DNA fragmentation in these cells was assayed as described in the legend to Fig. 1. Cells were transfected with anti-NS1 (white bars) or anti-NS2 (gray bars) siRNA 6 h prior to the addition of the virus. Each data point represents an average of three experiments with error bars (not shown for small values). C, sham-infected cells at 60 h.

To further correlate the loss of NS with apoptosis at the unicellular level, we immunostained the monolayer to ascertain RSV infection and detected the apoptotic cells by TUNEL staining. The results (Fig. 3) clearly show that in siRNA-untreated RSV-infected monolayer (row A), only a small fraction of cells was apoptotic at 12 h, whereas extensive and bright apoptotic staining was obvious at 30 h. In contrast, when treated with anti-NS1 (row B) and anti-NS2 (row C) siRNAs, strong apoptosis was discernible at 12 h as well. In uninfected controls, neither siRNA caused apoptosis or any obvious cytopathic effect (Fig. 3, row U) for at least up to 60 h, which was the longest time point tested. At less then 1 MOI, a proportionately lower number of apoptotic cells was seen (Fig. 3, two lower panels). This result, together with previous data of lack of apoptosis in uninfected cells separated from infected ones by semipermeable membranes (4), suggest that apoptosis by RSV is a direct effect of infection. Overall, these results demonstrate that when levels of NS proteins are reduced, RSV-infected cells undergo apoptosis early in infection. As a corollary, we conclude that optimal expression of NS proteins plays a critical role in RSV-mediated suppression of early apoptosis.


Figure 3
View larger version (26K):
[in this window]
[in a new window]

  		FIG. 3. Triparametric staining of A549 cells. All nuclei were stained by 4',6'-diamidino-2-phenylindole (DAPI) (blue), apoptotic cells were stained by TUNEL assay (green), and RSV-infected cells were stained by indirect immunofluorescence (IF) using a mixture of antibodies against RSV proteins (red) at 12 or 30 hpi as described in Materials and Methods. U, sham-infected cells. Panels A, B, and C show RSV-infected cells (MOI = 3) transfected, respectively, with no siRNA, 80 nM anti-NS1 siRNA, and 20 nM anti-NS2 siRNA. The two bottom panels show low-MOI infections and apoptosis of a proportionately smaller number of cells.

NS proteins are important for activation of cellular prosurvival pathways. As summarized before, NF-{kappa}B and the AKT pathway are established prosurvival forces, and recent studies have implicated their roles in RSV-infected cells as well. In order to understand the antiapoptotic mechanism of NS proteins, we inquired whether they may activate these prosurvival pathways. First, we investigated if three key markers of the AKT pathway, namely, PDK, AKT, and GSK, are phosphorylated using phosphospecific antibodies. Results (Fig. 4A) show that phosphorylation of all three was highly elevated within 5 h of RSV infection, while the total protein levels remained constant. By about 36 h, all phosphorylation subsided to basal levels. This is consistent with early suppression and late activation of apoptosis. When we knocked down NS proteins, the early phosphorylations were drastically eliminated, confirming a role of NS protein in activating the AKT pathway. Next, we tested a role of NS proteins in the NF-{kappa}B pathway. By 5 hpi, a substantial increase in the phosphorylation of I{kappa}B{alpha} was observed (Fig. 4B) with no change in the protein level. The stimulation of phosphorylation was abrogated by treatment with anti-NS siRNA. Luciferase assay in an NF-{kappa}B reporter cell line provided further evidence of early activation of NF-{kappa}B and its inhibition by anti-NS siRNAs (Fig. 4C), although anti-NS2 siRNA appeared to have a greater effect than anti-NS1 siRNA, confirming similar results recently obtained using NS-deleted recombinant RSV (41). The controls in these experiments included scrambled siRNA that had no effect and the Sp1 transcription factor that was not affected. Taken together, these results establish an important role of the NS proteins in the early activation of the prosurvival molecules AKT and NF-{kappa}B following RSV infection.


Figure 4
View larger version (28K):
[in this window]
[in a new window]

  		FIG. 4. Prosurvival pathways in RSV-infected A549 cells. (A) Phosphorylated PDK, AKT, and GSK were assayed by immunoblot at the indicated times after infection (or sham infected [U]) with or without transfection by anti-NS siRNAs. Control cells received 50 nM of scrambled (SC) siRNA. (B) Similar immunoblot assay of phosphorylated I{kappa}B{alpha} in RSV-infected (or sham-infected [U]) cells at 5 hpi. (C) Assay of NF-{kappa}B activation by reporter luciferase assay in HEK293 cells treated with the indicated concentrations of anti-NS siRNAs (or 50 nM of scrambled siRNA [SC]) at 18 hpi as described before (9). Luciferase activity in RSV-infected HEK293 cells not treated with siRNA was taken as 100, and the other values were expressed as a percentage of this. In both panels A and B, immunoblots of the unphosphorylated proteins and Sp1 serve as unchanged controls.

The antiapoptotic role of NS proteins is IFN independent. As the NS proteins suppress the IFN pathway (25, 36, 40, 41) and IFN can promote apoptosis in various cells, we asked whether suppression of apoptosis by NS proteins is due to the suppression of IFN signaling. To answer this question, we infected Vero cells that are naturally lacking IFN-{alpha} and -ß genes and looked for apoptosis by TUNEL assay. Results (Fig. 5) show apoptosis at 30 hpi, but not at 12 h, clearly demonstrating that late apoptosis in RSV-infected cells is not due to type I IFN. Knockdown of NS1 or NS2 by siRNA promoted earlier apoptosis (at 12 h) in Vero cells, suggesting that NS proteins suppress apoptosis regardless of IFN expression, thus pointing to a potentially different pathway.


Figure 5
View larger version (53K):
[in this window]
[in a new window]

  		FIG. 5. Triparametric staining of Vero cells. The procedure is essentially identical to that described in the legend to Fig. 3, except that Vero cells, deleted of type I IFN genes, were used instead of A549 cells. Vero cells, with or without siRNA pretreatment, were infected with RSV and processed for staining at indicated times postinfection (12 or 30 h). The two bottom panels (–RSV) show "control" uninfected cells either untreated (no siRNA) or treated (+ NS siRNA) with a mixture of 80 nM anti-NS1 plus 20 nM anti-NS2 siRNA and stained 40 h later; note the lack of apoptosis in both panels. DAPI, 4',6'-diamidino-2-phenylindole.

Delayed apoptosis enhances virus growth. Once we confirmed that NS proteins inhibit apoptosis, a natural query was whether or not this offers any evolutionary advantage to the virus. We speculated that preservation of the cellular integrity would allow longer periods of intracellular viral replication and hence higher levels of viral growth. To test this, we used a recombinant, green fluorescent protein (GFP)-expressing RSV in which real-time quantitation of the green fluorescence provides a direct measure of viral macromolecular expression (19). As shown in Fig. 6A, the fluorescence increased with time of infection, reaching nearly 30-fold over background at 36 hpi. Knockdown of NS1 or NS2 by siRNA significantly reduced the rate of increase such that only a 15- to 20-fold increase was seen at the same time point. We argued that if the reduction in virus replication was a direct effect of increased apoptosis, then cell killing by other agents should have the same effect, and conversely, inhibition of cell death should increase virus replication. This was indeed observed (Fig. 6A). The cell-permeable NF-{kappa}B inhibitor (SN50) and the PI3K inhibitor (LY294002) both strongly reduced virus replication, whereas a specific caspase-3 inhibitor (Ac-DEVD-CHO) and a pan-caspase inhibitor (Z-VAD-FMK) both promoted higher levels of virus replication.


Figure 6
View larger version (22K):
[in this window]
[in a new window]

  		FIG. 6. Measurement of RSV growth. (A) Intracellular replication of recombinant RSV expressing green fluorescent protein (rgRSV) (18) in A549 cells. When used, all inhibitors were added to the culture 2 h prior to infection and maintained throughout infection. The various treatments were the following: (a) pan-caspase inhibitor (Z-VAD-FMK); (b) caspase-3 inhibitor (Ac-DEVD-CHO); (c) none; (d) 80 nM anti-NS1 siRNA; (e) 20 nM anti-NS2 siRNA; (f) 25 µM PI3K inhibitor (LY294002); and (g) 15 µM NF-{kappa}B inhibitor (SN50). All inhibitors were from Calbiochem. (B) Specific reduction of progeny RSV by anti-NS siRNA. A549 cells were infected with RSV or human parainfluenza virus type 3, and infectious progeny virions in the culture media at 72 hpi were titrated as described in Materials and Methods. Cells were treated with the indicated concentrations of siRNAs (written above the bars) 6 h prior to the addition of the virus. Results are averages of three experiments with error bars shown.

To determine if the reduced intracellular replication of the virus actually translated into a reduced number of extracellular virions, we assayed the infectious progeny virion titer in the growth media. Knockdown of NS1 or NS2 indeed led to 102- to 103-fold lower levels of extracellular virion (Fig. 6B), which also suggests that virion assembly is strongly affected by even modest reductions of the components. Nevertheless, the viral specificity of the effect was ascertained by the lack of any effect of these siRNAs on human parainfluenza virus titer. Collectively, results in this section show that suppression of premature apoptosis by the NS proteins of RSV benefits the virus by allowing a more sustained virus replication.

NS knockout recombinant RSV fails to suppress early apoptosis. Although we showed knockdown of NS proteins by synthetic siRNA, we wanted to confirm and validate these findings with a parallel approach using RSV mutants that are deleted for NS1, NS2, or both genes. The knockout would lead to total and continuous loss of the corresponding proteins. To compare the two sets of results, we obtained a quantitative estimate of apoptosis and determined its relationship with virus growth. Apoptosis was measured by the ELISA-based nucleosomal cleavage assay described earlier. Intracellular viral replication was monitored by quantitative immunoblot using anti-RSV antibody and profilin as an internal control. Recall that loss of NS function by either RNAi-mediated knockdown (Fig. 6) or gene deletion (40) led to poor virus growth. Thus, we reasoned that in order to compare the wild-type and NS-deficient viruses, it is important to normalize apoptosis against a similar amount of intracellular virus replication. When so presented, such results (Fig. 7A) confirmed the early and exacerbated apoptosis from knockdown of NS1 or NS2, which was already qualitatively visualized in Fig. 3. The effect of the {Delta}NS2 knockout was in fact more severe, consistent with a complete loss of the NS2 protein in the deletion mutant. Interestingly, double deletion of NS1 and NS2 led to an even stronger apoptosis. To validate the conclusion in primary cells, we conducted these studies in human bronchial epithelial (NHBE) cells, whereby essentially identical results were obtained (Fig. 7B).


Figure 7
View larger version (29K):
[in this window]
[in a new window]

  		FIG. 7. Early apoptosis in A549 and NHBE cells infected with NS-deleted ({Delta}NS) RSV. Apoptosis was quantified in A549 (A) and NHBE (B) cells at 12 h after infection with wild-type and NS-deleted RSV using an ELISA-based assay as described in Materials and Methods. All values were expressed as fold of the wild-type RSV value taken as 1. Data with siRNA are added for comparison. (C) The phosphorylated form and total protein of the indicated prosurvival factors were detected using specific antibodies (Materials and Methods). A trial immunoblot was first performed to check the relative band intensities. Based on that result, the volume of each sample was recalculated to run a second gel such that the RSV N protein is present in equal amounts in all lanes, and this result is presented. The lowest panel confirms the loss of the corresponding NS protein in the deletions. Note the activation of phosphorylation of all three proteins in wild-type RSV infection (confirming the results shown in Fig. 4) and its inhibition in the {Delta}NS mutants. (D) Immunoblot detection of unphosphorylated (subpanel a) and phosphorylated (subpanel b) EGFR in A549 cells infected with wild-type RSV (lanes W) or {Delta}NS1 (lanes 1), {Delta}NS2 (lanes 2), and {Delta}NS1,2 (lanes 12) mutant and harvested at 1, 6, 18, or 24 h postinfection. U represents uninfected control cells. A portion of the membrane, stained with Ponceau S, is shown in subpanel c to document similar total protein loads. Note the complete switch of the unphosphorylated EGFR to the phosphorylated form between 6 and 18 h of RSV infection. WT, wild type.

To delve into the mechanism, we investigated the phosphorylation status of the prosurvival molecules in cells infected with NS-deleted RSV. As shown (Fig. 7C), deletion of NS1, NS2, or both led to significant reduction of their phosphorylation, essentially mirroring the effect of NS knockdown by RNAi (Fig. 4). Together, the results with NS-deleted RSV and those obtained using RNAi against wild-type RSV corroborate each other and establish a critically important role of both NS proteins of RSV in suppressing early apoptosis by triggering a prosurvival pathway.

Lastly, as RSV infection activates EGFR, which also suppresses apoptosis (30), we tested this pathway for the NS-deleted strains. Interestingly, while wild-type RSV infection led to essentially complete phosphorylation of EGFR by 18 hpi, confirming the previous results and kinetics, essentially similar levels of phosphorylation were also seen in single and double NS-deletion mutants (Fig. 7). We conclude that NS proteins do not play an appreciable role in activating EGFR in the RSV-infected cells. The corollary is that NS-mediated suppression of apoptosis is brought about by a potentially novel, EGFR-independent mechanism.

Recombinant NS proteins suppress TNF-induced apoptosis. In an attempt to determine if NS proteins alone, in the absence of other viral proteins, can suppress apoptosis, we expressed NS1 and NS2 by recombinant means from pcDNA3 clones that were transiently transfected into A549 cells. Since the natural trigger of apoptosis in the RSV-infected cell is unknown, we used tumor necrosis factor alpha (TNF-{alpha}) to promote apoptosis and tested the ability of NS1 and NS2 to inhibit it. In previous studies RSV infection indeed protected lung epithelial cells from the apoptotic effect of exogenous TNF-{alpha} (15). Results show (Fig. 8) that although the expression of both recombinant proteins was modest and below the levels seen in RSV infection, both appeared to inhibit TNF-{alpha}-mediated apoptosis in a dose-dependent manner. When NS2 and NS1 were expressed jointly, the antiapoptotic effect appeared stronger (Fig. 8). Due to the difficulty of accurately estimating low quantities of the proteins, we could not ascertain whether the effect was additive or synergistic. Nonetheless, these results suggest that NS2 and NS1 possess intrinsic antiapoptotic activity, although they do not rule out a role of other viral proteins in modulating this activity.


Figure 8
View larger version (31K):
[in this window]
[in a new window]

  		FIG. 8. Antiapoptotic properties of recombinant NS proteins. The coding sequences and the 5'-untranslated region of the NS mRNAs were cloned in pcDNA3 (Invitrogen, Carlsbad, CA) between the unique HindIII and BamHI sites. Indicated amounts (in micrograms on the x axis) of the plasmid DNAs were transfected into A549 cells in 6-well plates using Lipofectin (Invitrogen). Control cells received 4 µg of vector with no insert. At 24 h posttransfection, TNF-{alpha} (R&D Systems, Minneapolis, MN) was added to a final concentration of 60 ng/ml, and cells were harvested 6 h later for ELISA-based apoptosis assay (upper panel, NS2, speckled bars; NS1, striped bars; both, gray bars) and immunoblot analysis (lower panels). Apoptosis by TNF-{alpha} alone was taken as 100, and other values are expressed as its percentage. Results with >4 µg plasmid were not presented due to visible cytopathic effect and cell loss. The immunoblot for actin (8) shows equal protein loading.


arrow
DISCUSSION
 
We show here that the nonstructural NS proteins of RSV suppress premature apoptosis of the infected cell by a mechanism that is independent of suppression of IFN signaling by these proteins, and that prolonged cellular life promotes better intracellular viral growth. We integrate our conclusions with published ones to present a working hypothesis in Fig. 9, in which RSV growth is stimulated by three fundamentally distinct RSV-proximal pathways. (i) Evidence for the NS-dependent pathway NS->PI3K->AKT is presented here. The activated AKT suppresses apoptosis by a variety of ways, one of which is to activate NF-{kappa}B. As stated in the introduction, AKT can also inactivate downstream promoters of apoptosis, such as Bad and caspases, by direct phosphorylation, although this is yet to be demonstrated in RSV infection. (ii) The second NS-dependent pathway, suppression of innate immunity, involves the well-documented suppression of the antiviral IFN response. (iii) We have shown that the EGFR->ERK pathway is NS independent, and as postulated (30), it may lead to the direct phosphorylation and resultant degradation of BimEL, thereby promoting apoptosis.


Figure 9
View larger version (18K):
[in this window]
[in a new window]

  		FIG. 9. Working model for NS action. The model is based on past and present results as detailed in Discussion. In brief, stimulation of RSV growth may result from (i) subversion of IFN signaling by NS proteins and (ii and iii) suppression of premature apoptosis by the NS-dependent PI3K->AKT->NF-{kappa}B pathway and NS-independent EGFR->ERK pathway. These pathways are incomplete, and multiple crossovers are possible but not shown to avoid complexity. Notable among them are sphingosine kinase, which mediates the activation of ERK and AKT (30), and multiple protein kinase C isoforms that play an important role in activating ERK and NF-{kappa}B (5, 29).

We emphasize that other pathways may exist that are awaiting discovery. The parallel nature of the pathways (Fig. 9) also implies their nonexclusivity such that they can function simultaneously and independently. Recent results have indeed shown that acute activation of ERK1/ERK2 and AKT can proceed by independent pathways (13, 31). Alternatively, the pathways can act in a partially overlapping and cooperative manner. For example, though the predominant mechanism of activation of the transcription factor AP1 (Fos-Jun) is through phosphorylation of c-Jun by Jun N-terminal protein kinase, recently ERK2 was also shown to phosphorylate c-Fos and thereby activate AP1 (32, 33). Thus, the EGFR->ERK pathway can activate AP1, whereas AKT can activate NF-{kappa}B. It is possible that an antiapoptotic gene will contain enhancers for both AP1 and NF-{kappa}B and therefore require both transcription factors for optimal expression. In this case, inhibition of either pathway will promote apoptosis, as shown before (30) and in this paper. Although the NS proteins suppress IFN signaling, the relationship between IFN and apoptosis in RSV-infected cells is unknown. The IFN suppression pathway may overlap with the other two, since IFN can act either as a pro- or an antiapoptotic cytokine, depending on the signaling environment (12, 48).

Do NS1 and NS2 work together? We would like to think they do or that they have overlapping functions for at least a subset of their physiological roles. First, in the assays that we have conducted, the {Delta}NS1,2 double mutant generally showed a more severe effect than either mutant alone (Fig. 7A), and the same trend was seen with double knockdown (data not shown). Second, coexpressed NS1 and NS2 appeared to be more effective in counteracting TNF-{alpha}-mediated apoptosis than each protein expressed separately (Fig. 8). Third, in both human and bovine RSV, the use of NS deletion mutants suggested that the two proteins function independently as well as cooperatively (38, 40, 41). Finally, in a complementary approach Lo et al. (25) recombinantly expressed NS1 and NS2 individually and together and found synergism in essentially all steps related to IFN suppression. Nevertheless, it is entirely possible that NS1 and NS2 differ in their potency in different pathways. For example, we observed closely comparable phenotypes in the siRNA experiments, although NS2 knockdown had a more severe effect than NS1, suggesting that perhaps NS2 makes a greater contribution to the suppression of apoptosis. Clearly, a more robust expression of the recombinant NS proteins will allow a detailed analysis and comparison of the individual prosurvival pathways they activate.

The nature of the apoptotic trigger(s) in the RSV-infected cell is unknown. We previously showed that RSV infection causes endoplasmic reticulum stress, leading to the activation of caspases (4). We suggested that this is triggered by the trafficking of one or more RSV glycoproteins through the endoplasmic reticulum, the identity of which needs to be identified. How delayed apoptosis helps RSV growth also remains to be elucidated. RSV is known to depend on various cellular structures, such as the cytoskeletal components (8, 10, 11, 22, 27), for optimal replication and gene expression. Some or all of these components may lose structural and functional integrity in apoptosis. In addition, a number of cellular genes regulated upon RSV infection may have important beneficial roles in virus growth. The delaying of nuclear DNA damage should prolong the expression of these genes. The identification of the physiological apoptotic trigger(s) and the cellular or viral binding partners of NS proteins in the context of RSV infection would be an important first step in providing clues to the mechanism of NS action. These studies are in progress.


arrow
ACKNOWLEDGMENTS
 
We are deeply indebted to Hong Jin (MedImmune Vaccines, Inc., Mountain View, CA) for the recombinant NS-deleted RSV strains, Titus Barik for help with the RNA folding program, and Mark Peeples (Columbus Children's Research Institute, Ohio State University, Columbus, OH) and Peter L. Collins (NIAID, NIH) for the recombinant green RSV (rgRSV). Thanks are also due to James Downey for the EGFR antibodies.

This research was supported in part by NIH grants AI049682, EY013826, and AI59267.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biochemistry and Molecular Biology, University of South Alabama, College of Medicine, 307 University Blvd., Mobile, AL 36688-0002. Phone: (251) 460-6860. Fax: (251) 460-6850. E-mail: sbarik{at}jaguar1.usouthal.edu. Back

{triangledown} Published ahead of print on 6 December 2006. Back


arrow
REFERENCES
 
    1
  1. Atreya, P. L., M. E. Peeples, and P. L. Collins. 1998. The NS1 protein of human respiratory syncytial virus is a potent inhibitor of minigenome transcription and RNA replication. J. Virol. 72:1452-1461.[Abstract/Free Full Text]
    2. 2
  2. Barik, S. 2004. Control of nonsegmented negative-strand RNA virus replication by siRNA. Virus Res. 102:27-35.[CrossRef][Medline]
    3. 3
  3. Barik, S. 2004. Development of gene-specific double-stranded RNA drugs. Ann. Med. 36:540-551.[CrossRef][Medline]
    4. 4
  4. Bitko, V., and S. Barik. 2001. An endoplasmic reticulum-specific stress-activated caspase (caspase-12) is implicated in the apoptosis of A549 epithelial cells by respiratory syncytial virus. J. Cell. Biochem. 80:441-454.[CrossRef][Medline]
    5. 5
  5. Bitko, V., and S. Barik. 1998. Persistent activation of RelA by respiratory syncytial virus involves protein kinase C, underphosphorylated I{kappa}Bß, and sequestration of protein phosphatase 2A by the viral phosphoprotein. J. Virol. 72:5610-5618.[Abstract/Free Full Text]
    6. 6
  6. Bitko, V., and S. Barik. 2001. Phenotypic silencing of cytoplasmic genes using sequence-specific double-stranded short interfering RNA and its application in the reverse genetics of wild type negative-strand RNA viruses. BMC Microbiol. 1:34.[CrossRef][Medline]
    7. 7
  7. Bitko, V., A. Musiyenko, O. Shulyayeva, and S. Barik. 2005. Inhibition of respiratory viruses by nasally administered siRNA. Nat. Med. 11:50-55.[CrossRef][Medline]
    8. 8
  8. Bitko, V., A. Oldenburg, N. E. Garmon, and S. Barik. 2003. Profilin is required for viral morphogenesis, syncytium formation, and cell-specific stress fiber induction by respiratory syncytial virus. BMC Microbiol. 3:9.[CrossRef][Medline]
    9. 9
  9. Bitko, V., A. Velazquez, L. Yang, Y. C. Yang, and S. Barik. 1997. Transcriptional induction of multiple cytokines by human respiratory syncytial virus requires activation of NF-kappa B and is inhibited by sodium salicylate and aspirin. Virology 232:369-378.[CrossRef][Medline]
    10. 10
  10. Burke, E., L. Dupuy, C. Wall, and S. Barik. 1998. Role of cellular actin in the gene expression and morphogenesis of human respiratory syncytial virus. Virology 252:137-148.[CrossRef][Medline]
    11. 11
  11. Burke, E., N. M. Mahoney, S. C. Almo, and S. Barik. 2000. Profilin is required for optimal actin-dependent transcription of respiratory syncytial virus genome RNA. J. Virol. 74:669-675.[Abstract/Free Full Text]
    12. 12
  12. Caraglia, M., G. Vitale, M. Marra, A. Budillon, P. Tagliaferri, and A. Abbruzzese. 2004. Alpha-interferon and its effects on signalling pathways within cells. Curr. Protein Pept. Sci. 5:475-485.[CrossRef][Medline]
    13. 13
  13. Chiu, D., K. Ma, A. Scott, and V. Duronio. 2005. Acute activation of Erk1/Erk2 and protein kinase B/akt proceed by independent pathways in multiple cell types. FEBS J. 272:4372-4384.[CrossRef][Medline]
    14. 14
  14. Cristina, J., A. S. Yunus, D. D. Rockemann, and S. K. Samal. 2001. Bovine respiratory syncytial virus can induce apoptosis in MDBK cultured cells. Vet. Microbiol. 83:317-320.[CrossRef][Medline]
    15. 15
  15. Domachowske, J. B., C. A. Bonville, A. J. Mortelliti, C. B. Colella, U. Kim, and H. F. Rosenberg. 2000. Respiratory syncytial virus infection induces expression of the anti-apoptosis gene IEX-1L in human respiratory epithelial cells. J. Infect. Dis. 181:824-830.[CrossRef][Medline]
    16. 16
  16. Downward, J. 2004. PI3-kinase, Akt and cell survival. Semin. Cell. Dev. Biol. 15:177-182.[CrossRef][Medline]
    17. 17
  17. Elbashir, S. M., J. Harborth, W. Lendeckel, A. Yalcin, K. Weber, and T. Tuschl. 2001. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411:494-498.[CrossRef][Medline]
    18. 18
  18. Green, D. R., and G. Kroemer. 2004. The pathophysiology of mitochondrial cell death. Science 305:626-629.[Abstract/Free Full Text]
    19. 19
  19. Hallak, L. K., D. Spillmann, P. L. Collins, and M. E. Peeples. 2000. Glycosaminoglycan sulfation requirements for respiratory syncytial virus infection. J. Virol. 74:10508-10513.[Abstract/Free Full Text]
    20. 20
  20. Jin, H., H. Zhou, X. Cheng, R. Tang, M. Munoz, and N. Nguyen. 2000. Recombinant respiratory syncytial viruses with deletions in the NS1, NS2, SH, and M2-2 genes are attenuated in vitro and in vivo. Virology 273:210-218.[CrossRef][Medline]
    21. 21
  21. Johnson, P. R., and P. L. Collins. 1989. The 1B (NS2), 1C (NS1) and N proteins of human respiratory syncytial virus (RSV) of antigenic subgroups A and B: sequence conservation and divergence within RSV genomic RNA. J. Gen. Virol. 70:1539-1547.[Abstract/Free Full Text]
    22. 22
  22. Kallewaard, N. L., A. L. Bowen, and J. E. Crowe, Jr. 2005. Cooperativity of actin and microtubule elements during replication of respiratory syncytial virus. Virology 331:73-81.[CrossRef][Medline]
    23. 23
  23. Khvorova, A., A. Reynolds, and S. D. Jayasena. 2003. 2003. Functional siRNAs and miRNAs exhibit strand bias. Cell 115:209-216. (Erratum, 115:505.)[CrossRef][Medline]
    24. 24
  24. Kotelkin, A., E. A. Prikhod'ko, J. I. Cohen, P. L. Collins, and A. Bukreyev. 2003. Respiratory syncytial virus infection sensitizes cells to apoptosis mediated by tumor necrosis factor-related apoptosis-inducing ligand. J. Virol. 77:9156-9172.[Abstract/Free Full Text]
    25. 25
  25. Lo, M. S., R. M. Brazas, and M. J. Holtzman. 2005. Respiratory syncytial virus nonstructural proteins NS1 and NS2 mediate inhibition of Stat2 expression and alpha/beta interferon responsiveness. J. Virol. 79:9315-9319.[Abstract/Free Full Text]
    26. 26
  26. Maggon, K., and S. Barik. 2004. New drugs and treatment for respiratory syncytial virus. Rev. Med. Virol. 14:149-168.[CrossRef][Medline]
    27. 27
  27. McDonald, T. P., A. R. Pitt, G. Brown, H. W. Rixon, and R. J. Sugrue. 2004. Evidence that the respiratory syncytial virus polymerase complex associates with lipid rafts in virus-infected cells: a proteomic analysis. Virology 330:147-157.[CrossRef][Medline]
    28. 28
  28. McGivern, D. R., P. L. Collins, and R. Fearns. 2005. Identification of internal sequences in the 3' leader region of human respiratory syncytial virus that enhance transcription and confer replication processivity. J. Virol. 79:2449-2460.[Abstract/Free Full Text]
    29. 29
  29. Monick, M., J. Staber, K. Thomas, and G. Hunninghake. 2001. Respiratory syncytial virus infection results in activation of multiple protein kinase C isoforms leading to activation of mitogen-activated protein kinase. J. Immunol. 166:2681-2687.[Abstract/Free Full Text]
    30. 30
  30. Monick, M. M., K. Cameron, J. Staber, L. S. Powers, T. O. Yarovinsky, J. G. Koland, and G. W. Hunninghake. 2005. Activation of the epidermal growth factor receptor by respiratory syncytial virus results in increased inflammation and delayed apoptosis. J. Biol. Chem. 280:2147-2158.[Abstract/Free Full Text]
    31. 31
  31. Monick, M. M., K. Cameron, L. S. Powers, N. S. Butler, D. McCoy, R. K. Mallampalli, and G. W. Hunninghake. 2004. Sphingosine kinase mediates activation of extracellular signal-related kinase and Akt by respiratory syncytial virus. Am. J. Respir. Cell. Mol. Biol. 30:844-852.[Abstract/Free Full Text]
    32. 32
  32. Monje, P., M. J. Marinissen, and J. S. Gutkind. 2003. Phosphorylation of the carboxyl-terminal transactivation domain of c-Fos by extracellular signal-regulated kinase mediates the transcriptional activation of AP-1 and cellular transformation induced by platelet-derived growth factor. Mol. Cell. Biol. 23:7030-7043.[Abstract/Free Full Text]
    33. 33
  33. Murphy, L. O., S. Smith, R. H. Chen, D. C. Fingar, and J. Blenis. 2002. Molecular interpretation of ERK signal duration by immediate early gene products. Nat. Cell Biol. 4:556-564.[Medline]
    34. 34
  34. O'Donnell, D., R., L. Milligan, and J. M. Stark. 1999. Induction of CD95 (Fas) and apoptosis in respiratory epithelial cell cultures following respiratory syncytial virus infection. Virology 257:198-207.[CrossRef][Medline]
    35. 35
  35. Ramaswamy, M., L. Shi, M. M. Monick, G. W. Hunninghake, and D. C. Look. 2004. Specific inhibition of type I interferon signal transduction by respiratory syncytial virus. Am. J. Respir. Cell. Mol. Biol. 30:893-900.[Abstract/Free Full Text]
    36. 36
  36. Ramaswamy, M., L. Shi, S. M. Varga, S. Barik, M. A. Behlke, and D. C. Look. 2006. Respiratory syncytial virus nonstructural protein 2 specifically inhibits type I interferon signal transduction. Virology 344:328-339.[CrossRef][Medline]
    37. 37
  37. Roe, M. F., D. M. Bloxham, D. K. White, R. I. Ross-Russell, R. T. Tasker, and D. R. O'Donnell. 2004. Lymphocyte apoptosis in acute respiratory syncytial virus bronchiolitis. Clin. Exp. Immunol. 137:139-145.[CrossRef][Medline]
    38. 38
  38. Schlender, J., B. Bossert, U. Buchholz, and K. K. Conzelmann. 2000. Bovine respiratory syncytial virus nonstructural proteins NS1 and NS2 cooperatively antagonize alpha/beta interferon-induced antiviral response. J. Virol. 74:8234-8242.[Abstract/Free Full Text]
    39. 39
  39. Schwarz, D. S., G. Hutvagner, T. Du, Z. Xu, N. Aronin, and P. D. Zamore. 2003. Asymmetry in the assembly of the RNAi enzyme complex. Cell 115:199-208.[CrossRef][Medline]
    40. 40
  40. Spann, K. M., K. C. Tran, B. Chi, R. L. Rabin, and P. L. Collins. 2004. Suppression of the induction of alpha, beta, and lambda interferons by the NS1 and NS2 proteins of human respiratory syncytial virus in human epithelial cells and macrophages. J. Virol. 78:4363-4369. (Erratum, 78:6705, 2005.)[Abstract/Free Full Text]
    41. 41
  41. Spann, K. M., K. C. Tran, and P. L. Collins. 2005. Effects of nonstructural proteins NS1 and NS2 of human respiratory syncytial virus on interferon regulatory factor 3, NF-{kappa}B, and proinflammatory cytokines. J. Virol. 79:5353-5362.[Abstract/Free Full Text]
    42. 42
  42. Teng, M. N., and P. L. Collins. 1998. Identification of the respiratory syncytial virus proteins required for formation and passage of helper-dependent infectious particles. J. Virol. 72:5707-5716.[Abstract/Free Full Text]
    43. 43
  43. Teng, M. N., and P. L. Collins. 1999. Altered growth characteristics of recombinant respiratory syncytial viruses which do not produce NS2 protein. J. Virol. 73:466-473.[Abstract/Free Full Text]
    44. 44
  44. Thomas, K. W., M. M. Monick, J. M. Staber, T. Yarovinsky, A. B. Carter, and G. W. Hunninghake. 2002. Respiratory syncytial virus inhibits apoptosis and induces NF-kappa B activity through a phosphatidylinositol 3-kinase-dependent pathway. J. Biol. Chem. 277:492-501.[Abstract/Free Full Text]
    45. 45
  45. Ueba, O. 1978. Respiratory syncytial virus. I. Concentration and purification of the infectious virus. Acta Med. Okayama 32:265-272.
    46. 46
  46. Urnowey, S., T. Ansai, V. Bitko, K. Nakayama, T. Takehara, and S. Barik. 2006. Temporal activation of anti- and pro-apoptotic factors in human gingival fibroblasts infected with the periodontal pathogen, Porphyromonas gingivalis: potential role of bacterial proteases in host signalling. BMC Microbiol. 6:26.[CrossRef][Medline]
    47. 47
  47. Valarcher, J. F., J. Furze, S. Wyld, R. Cook, K. K. Conzelmann, and G. Taylor. 2003. Role of alpha/beta interferons in the attenuation and immunogenicity of recombinant bovine respiratory syncytial viruses lacking NS proteins. J. Virol. 77:8426-8439.[Abstract/Free Full Text]
    48. 48
  48. Yang, C. H., A. Murti, and L. M. Pfeffer. 2005. Interferon induces NF-{kappa}B-inducing kinase/tumor necrosis factor receptor-associated factor-dependent NF-{kappa}B activation to promote cell survival. J. Biol. Chem. 280:31530-31536.[Abstract/Free Full Text]
    49. 49
  49. Yilmaz, O., T. Jungas, P. Verbeke, and D. M. Ojcius. 2004. Activation of the phosphatidylinositol 3-kinase/Akt pathway contributes to survival of primary epithelial cells infected with the periodontal pathogen Porphyromonas gingivalis. Infect. Immun. 72:3743-3751.[Abstract/Free Full Text]
    50. 50
  50. Zhang, W., H. Yang, X. Kong, S. Mohapatra, H. San Juan-Vergara, G. Hellermann, S. Behera, R. Singam, R. F. Lockey, and S. S. Mohapatra. 2005. Inhibition of respiratory syncytial virus infection with intranasal siRNA nanoparticles targeting the viral NS1 gene. Nat. Med. 11:56-62. (Erratum, 11:233.)[CrossRef][Medline]
    51. 51
  51. Zuker, M. 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31:3406-3415.[Abstract/Free Full Text]

Journal of Virology, February 2007, p. 1786-1795, Vol. 81, No. 4
0022-538X/07/$08.00+0     doi:10.1128/JVI.01420-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Ling, Z., Tran, K. C., Teng, M. N. (2009). Human Respiratory Syncytial Virus Nonstructural Protein NS2 Antagonizes the Activation of Beta Interferon Transcription by Interacting with RIG-I. J. Virol. 83: 3734-3742 [Abstract] [Full Text]  
  • Bem, R. A., van Woensel, J. B. M., Bos, A. P., Koski, A., Farnand, A. W., Domachowske, J. B., Rosenberg, H. F., Martin, T. R., Matute-Bello, G. (2009). Mechanical ventilation enhances lung inflammation and caspase activity in a model of mouse pneumovirus infection. Am. J. Physiol. Lung Cell. Mol. Physiol. 296: L46-L56 [Abstract] [Full Text]  
  • Bartlett, E. J., Cruz, A.-M., Esker, J., Castano, A., Schomacker, H., Surman, S. R., Hennessey, M., Boonyaratanakornkit, J., Pickles, R. J., Collins, P. L., Murphy, B. R., Schmidt, A. C. (2008). Human Parainfluenza Virus Type 1 C Proteins Are Nonessential Proteins That Inhibit the Host Interferon and Apoptotic Responses and Are Required for Efficient Replication in Nonhuman Primates. J. Virol. 82: 8965-8977 [Abstract] [Full Text]  
  • Munir, S., Le Nouen, C., Luongo, C., Buchholz, U. J., Collins, P. L., Bukreyev, A. (2008). Nonstructural Proteins 1 and 2 of Respiratory Syncytial Virus Suppress Maturation of Human Dendritic Cells. J. Virol. 82: 8780-8796 [Abstract] [Full Text]  
  • Eckardt-Michel, J., Lorek, M., Baxmann, D., Grunwald, T., Keil, G. M., Zimmer, G. (2008). The Fusion Protein of Respiratory Syncytial Virus Triggers p53-Dependent Apoptosis. J. Virol. 82: 3236-3249 [Abstract] [Full Text]  
  • Collins, P. L., Graham, B. S. (2008). Viral and Host Factors in Human Respiratory Syncytial Virus Pathogenesis. J. Virol. 82: 2040-2055 [Full Text]  
  • Won, S., Ikegami, T., Peters, C. J., Makino, S. (2007). NSm Protein of Rift Valley Fever Virus Suppresses Virus-Induced Apoptosis. J. Virol. 81: 13335-13345 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bitko, V.
Right arrow Articles by Barik, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bitko, V.
Right arrow Articles by Barik, S.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»