This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cohen, J. I.
Right arrow Articles by Ali, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cohen, J. I.
Right arrow Articles by Ali, M. A.

 Previous Article  |  Next Article 

Journal of Virology, February 2007, p. 1586-1591, Vol. 81, No. 4
0022-538X/07/$08.00+0     doi:10.1128/JVI.01220-06

Absence or Overexpression of the Varicella-Zoster Virus (VZV) ORF29 Latency-Associated Protein Impairs Late Gene Expression and Reduces VZV Latency in a Rodent Model{triangledown}

Jeffrey I. Cohen,* Tammy Krogmann, Lesley Pesnicak, and Mir A. Ali

Medical Virology Section, Laboratory of Clinical Infectious Diseases, National Institutes of Health, Bethesda, Maryland

Received 11 June 2006/ Accepted 1 October 2006


arrow
ABSTRACT
 
Varicella-zoster virus (VZV) ORF29 encodes the viral single-stranded DNA binding protein and is expressed during latency in human ganglia. We constructed an ORF29 deletion mutant virus and showed that the virus could replicate only in cells expressing ORF29. An ORF29-repaired virus, in which ORF29 was driven by a cytomegalovirus promoter, grew to peak titers similar to those seen with the parental virus. The level of ORF29 protein in cells infected with the repaired virus was greater than that seen with parental virus. Infection of cells with either the ORF29 deletion or repaired virus resulted in similar levels of VZV immediate-early proteins but reduced levels of glycoprotein E compared to those observed with parental virus. Cotton rats infected with the ORF29 deletion mutant had a markedly reduced frequency of latent infection in dorsal root ganglia compared with those infected with parental virus (P < 0.00001). In contrast, infection of animals with the ORF29 deletion mutant resulted in a frequency of ganglionic infection at 3 days similar to that seen with the parental virus. Animals infected with the ORF29-repaired virus, which overexpresses ORF29, also had a reduced frequency of latent infection compared with those infected with parental virus (P = 0.0044). These studies indicate that regulation of ORF29 at appropriate levels is critical for VZV latency in a rodent model.


arrow
INTRODUCTION
 
Primary infection with varicella-zoster virus (VZV) results in chickenpox, and the virus subsequently establishes latency in cranial nerve and dorsal root ganglia. During latency a limited repertoire of viral genes are expressed, including open reading frames (ORFs) 4, 21, 29, 62, 63, and 66. ORF29 transcripts have been detected in human (8, 9, 20, 21) and rodent (22, 34) ganglia by in situ hybridization and reverse transcription followed by PCR.

ORF29 encodes a 130-kDa protein that binds to single-stranded DNA and localizes predominantly to the nucleus of virus-infected cells in vitro (24). ORF29 contains an atypical nuclear localization signal within amino acids 9 to 154, and transport to the nucleus requires Ran and karyopherins (37). While ORF29 protein is present in the nucleus of lytically infected cells, the protein is in the cytoplasm of neurons from human ganglia (17, 25). ORF29 protein localizes to the cytoplasm of guinea pig enteric ganglia neurons (5) and in an astrocyte-like cell line (38). Treatment with a proteosome inhibitor or expression of herpes simplex virus type 1 (HSV-1) ICP0 or VZV ORF61 results in translocation of ORF29 protein to the nucleus in both guinea pig enteric ganglia neurons and the astrocyte-like cell line.

ORF29 protein is secreted from VZV-infected fibroblasts and is endocytosed by human neurons in vitro (1). The protein is present in endothelial and epithelial cells in the skin of patients with varicella and zoster; the protein is also located in nerves in the dermis of patients with varicella. ORF29 protein is not present in virions (23).

ORF29 is expressed from a bidirectional promoter that it shares with ORF28 (27, 28, 40). Expression is activated during lytic infection by ORF62 protein and the USF transcription factor. During lytic infection, ORF29 transcripts of 4.1 and 4.2 kb are expressed, while during latency only the 4.2-kb transcript is present (26). Expression of ORF29 in T cells enhances the ability of ORF62 protein to transactivate the gI promoter; however, the effect of ORF29 is more modest in fibroblasts and melanoma cells, and expression of ORF29 in neuronal cells inhibits the ability of ORF62 protein to activate the gI promoter (2, 18). ORF29 protein also augments the ability of ORF62 to activate the ORF28 and ORF29 promoters; however, ORF29 protein does not activate transcription of these promoters directly (10).

Here we describe an ORF29 deletion mutant and repaired virus and characterize their growth in vitro as well as their ability to establish latency in rodents.


arrow
MATERIALS AND METHODS
 
Cells and viruses. VZV was propagated in human melanoma (MeWo) cells. Recombinant VZV was constructed using cosmids derived from the Oka vaccine strain. Baculovirus was grown in Sf9 (Spodoptera frugiperda) insect cells using TNM-FH media (PharMingen, San Diego, Calif.). Baculoviruses expressing ORF29 were constructed by cotransfecting Sf9 cells with BaculoGold-linearized baculovirus DNA (PharMingen) and either plasmid pAc-CMV29StuI or pAc-CMV 29EcoRV to produce viruses Baculo 29 and Baculo 29EcoRV, respectively. The recombinant baculoviruses were plaque purified on Sf9 cells, concentrated by centrifugation at 8,800 x g for 2 h, and resuspended in phosphate-buffered saline with 1% fetal bovine serum.

Plasmids and cosmids. Plasmid pCI-29 was constructed by performing PCR on VZV cosmid MstII B with primers GCCTAGCTAGCCAAAATGGAAAATACTCAGAAGACTGTG and GTCAGAATGCGGCCGCGGGAGGTTAAATCATTTCCATTG that amplify the ORF29 open reading frame, cutting the PCR product with NheI and NotI, and inserting the fragment into the corresponding sites of pCI (Promega, Madison, WI). Plasmid pAc-CMV (41) contains the human cytomegalovirus (CMV) immediate-early (IE) promoter inserted into the XhoI-EcoRI site of pAcSG2 (PharMingen). Plasmids pAc-CMV29StuI and pAc-CMV29EcoRV were constructed to produce baculoviruses expressing ORF29. Plasmid pCI-29 was cut with NheI, blunted with the Klenow fragment of Escherichia coli DNA polymerase, and cut with BamHI, and the fragment containing ORF29 and the simian virus 40 (SV40) polyadenylation sequence was inserted into the StuI-BglII site of pAc-CMV to create plasmid pAc-CMV29StuI. This plasmid is predicted to express ORF29 from both the baculovirus polyhedron promoter and the human immediate-early (IE) CMV promoter. Plasmid pCI-29 was cut with BglII, blunted with Klenow, and cut with BamHI, and the fragment containing ORF29 driven by the human CMV IE promoter and followed by the SV40 polyadenylation sequence was inserted into the EcoRV-BglII site of pAc-CMV to create plasmid pAc-CMV29EcoRV. This plasmid is predicted to express ORF29 from only the human IE CMV promoter.

VZV cosmids NotI A, NotI B, MstII A, and MstII B encompass the VZV genome (Fig. 1). VZV ORF29, encoded by nucleotides 50857 to 54468 of the VZV genome, is predicted to express a protein of 1,204 amino acids (14). To construct a virus deleted for ORF29, VZV cosmid MstII B was partially digested with HpaII using the RecA-assisted restriction endonuclease cleavage procedure (15). Two single-stranded oligonucleotides, CGGGGCCCCTGGGTTACGTTTATGCGTGCCGGGTTGAAGATTTGGATCTGGAGGAAATTT and GGCGCTTCTTGAAAAAACGGAAAACTTACCGGAATTATGGACTACGGCTTTTACTTCAAC, centered around HpaII sites at nucleotides 50919 and 53725 in the VZV genome were annealed to cosmid MstII B using the E. coli RecA protein. Additional HpaII sites in the cosmid were methylated using HpaII methylase and S-adenosylmethinone, and the reaction was heated to 65°C to remove the oligonucleotide-RecA complexes. The DNA was precipitated and cut with HpaII, and the large fragment, which lacks most of the ORF29 gene, was ligated to itself and was inserted into E. coli to produce cosmid VZV MstII B-29D (Fig. 1).


Figure 1
View larger version (15K):
[in this window]
[in a new window]

  		FIG. 1. Construction of recombinant VZV deleted for ORF29 and an ORF29-repaired virus. The VZV genome (line 1) consists of unique long (UL), unique short (US), terminal repeat (TR), and internal repeat (IR) regions (line 2). Cosmids NotI A and NotI B (line 3), MstII A, and MstII B (line 4) encompass the VZV genome. Cosmid MstII B-29D is deleted for most of ORF29 (line 5). Cosmid MstII A-29 has a cassette with ORF29 driven by the human CMV promoter inserted into the AvrII site of the cosmid (line 6). Numbers indicate nucleotide positions based on the sequence of VZV strain Dumas (14).

ORF29 was inserted into cosmid MstII A to construct a virus expressing ORF29 at a non-native site. VZV cosmid MstII A was digested with AvrII, which cuts at nucleotide 112853 (between VZV ORFs 65 and 66), and the ends of the cosmid were blunted with Klenow. The BglII-BamHI fragment containing ORF29 from pCI-29 was blunted with Klenow and inserted into the AvrII site of cosmid MstII A. The resulting cosmid MstII A-29 contains the ORF29 gene driven by the human CMV promoter and followed by an SV40 polyadenylation signal (Fig. 1).

Transfections, Southern blotting, immunoblotting, and virus growth studies. VZV cosmids were linearized with NotI or Bsu36I and transfected along with plasmid pCMV62 into human melanoma cells using the calcium phosphate procedure. Cells were passaged each week by treatment with trypsin, and cytopathic effects were noted.

Virion DNA was isolated from nucleocapsids, digested with restriction enzymes, fractionated on 1% agarose gels, transferred to nylon membranes, and probed with a radiolabeled fragment containing ORF29.

Lysates of baculovirus or VZV-infected cells were fractionated on sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels, transferred to nylon membranes, and incubated with rabbit antibody to VZV ORF29 protein (24), thymidine kinase (a gift from Christine Talarico), IE4 (29), IE63 (31), IE62 (23), or mouse monoclonal antibody to glycoprotein E (gE) (Chemicon, Temecula, Calif.). The blots were incubated with horseradish peroxidase-conjugated anti-rabbit or anti-mouse antibodies and developed with enhanced chemiluminescence (Pierce Chemical Company, Rockford, Ill.). Intensity of bands was quantified by densitometry.

Duplicate flasks of melanoma cells were infected with 200 PFU of VZV recombinants, and on days 1 to 5 after infection the cells were treated with trypsin and serial dilutions were titrated on melanoma cells. VZV deleted for ORF29 was titrated on melanoma cells that had been infected with Baculo 29 at a multiplicity of infection of 25 the day before. One week after infection, the cells were fixed and stained with crystal violet and plaques were counted. The mean number of plaques obtained from duplicate wells was determined.

Animal experiments. Four- to 6-week-old female cotton rats were inoculated intramuscularly along the sides of the spine with virus-infected melanoma cells containing 1.75 x 105 PFU of recombinant VZV. For analysis of acute infection, animals were sacrificed 3 days after infection; for latent infection, animals were sacrificed 5 to 6 weeks after infection. Dorsal root ganglia from the left thoracic and lumbar spine were pooled, DNA was isolated, and PCR was performed using 500 ng of ganglia DNA from infected animals or serial dilutions of cosmid NotI A in 500 ng of ganglia DNA from uninfected animals (to generate a standard curve) and primers corresponding to ORF21 (3). The PCR products were fractionated by electrophoresis on agarose gels, transferred to nylon membranes, and probed with a radiolabeled ORF21 probe, and copy numbers were determined using a PhosphorImager. The lower limit of reliable detection was 10 copies per 500 ng of ganglia DNA. PCR was also performed using 500 ng of ganglia DNA and ORF29 primers CATTTGACCCTGCCAACAAC and TAGTGCGTGCTCCAGAAACC (the latter sequence is located within the region absent from the ORF29 deletion mutant). Southern blotting was performed, and the membrane was hybridized to a radiolabeled ORF29 probe.

RNA from dorsal root ganglia was isolated using Trizol (Invitrogen, Carlsbad, Calif.), treated with DNase I, and heated to inactivate DNase, and cDNA was prepared using oligo(dT)12-18 and reverse transcriptase. PCR was performed using ORF63 primers (35), and Southern blotting of the amplified DNA was performed using a radiolabeled ORF63 probe.


arrow
RESULTS
 
VZV ORF29 is required for virus replication. Cosmid MstII B-29D was constructed which is deleted for codons 22 to 957 of ORF29. Transfection of melanoma cells with VZV cosmids NotI A, NotI B, MstII A, and MstII B yielded infectious virus (termed VZV ROka) 7 days after infection. However, transfection of cells with cosmids NotI A, NotI B, MstII A, and MstII B-29D failed to yield VZV.

To complement a VZV ORF29 deletion mutant, we produced baculovirus expressing ORF29. Infection of Sf9 insect cells with Baculo 29 followed by immunoblotting with antibody to ORF29 protein yielded a 130-kDa band (Fig. 2, lane 3). A similar-sized band was not detected in cells infected with control baculovirus AcNPV. Infection of melanoma cells with Baculo 29 or control baculovirus failed to show a band corresponding to ORF29 protein; however, infection of the cells with VZV ROka showed a band of 130 kDa (Fig. 2, lane 1). Sodium butyrate is a histone deacetylase inhibitor that enhances expression of foreign genes in mammalian cells when expressed by baculovirus (11). Therefore, we treated baculovirus-infected melanoma cells with 5 mM sodium butyrate 1 day before preparing lysates of infected cells. Immunoblotting of Baculo 29-infected cells treated with sodium butyrate showed a band of 130 kDa (Fig. 2, lane 5); no band was detected in cells infected with control baculovirus that had been treated with the chemical.


Figure 2
View larger version (59K):
[in this window]
[in a new window]

  		FIG. 2. Expression of ORF29 by recombinant baculovirus. Sf9 cells were infected with control baculovirus (Baculo; lane 2) or baculovirus expressing ORF29 (Baculo 29; lane 3). Melanoma cells were infected with VZV ROka (lane 1), Baculo 29 in the absence (lane 4) or presence (lane 5) of sodium butyrate (buty), or control baculovirus in the absence (lane 6) or presence (lane 7) of sodium butyrate. A prominent band of 110 kDa is present in Sf9 cells infected with Baculo 29. This band was not reduced in the presence of the proteosome inhibitor MG132 (J. I. Cohen and M. A. Ali, unpublished data) and could be due to protein degradation or initiation of translation at an internal site in insect cells. The numbers correspond to the sizes of the proteins in kilodaltons.

To construct VZV deleted for ORF29, we infected melanoma cells with Baculo 29 or Baculo 29EcoRV and 1 h later transfected the cells with cosmids NotI A, NotI B, MstII A, and MstII B-29D. One week after transfection, the cells were treated with trypsin and additional baculovirus was added to the cells. Cytopathic effects were detected in melanoma cells 10 days after cosmid transfection of Baculo 29-infected cells and 12 days after transfection of Baculo 29EcoRV-infected cells. Virus obtained from Baculo 29-infected cells was used for all subsequent experiments and was termed VZV ROka29D.

To verify that the deletion in ORF29 did not significantly affect expression of the genes adjacent to ORF29, we constructed cosmid MstII A-29, which contains the ORF29 gene driven by the human CMV promoter. Transfection of cells with cosmids NotI A, NotI B, MstII A-29, and MstII B-29D yielded infectious virus 7 days after transfection. This virus was termed ROka29DR.

To verify that VZV ROka29D and ROka29DR had the expected genomic structures, Southern blotting was performed. Virion DNA was digested with EcoRI and PacI and hybridized with a radiolabeled probe to ORF29. Virion DNA from cells infected with VZV ROka showed a band of 6.5 kbp, while cells infected with ROka29D had a band of 3.7 kbp due to the 2.8-kbp deletion in ORF29 (Fig. 3). Virion DNA from cells infected with VZV ROka29DR had the 2.8-kbp band due to the deletion in ORF29 and a new band of 22 kbp due to the insertion of ORF29 into the genome between ORFs 65 and 66.


Figure 3
View larger version (31K):
[in this window]
[in a new window]

  		FIG. 3. Southern blot of virion DNA from cells infected with ORF29 mutants. Virion DNA from cells infected with VZV ROka, ROka29D, or ROka29DR was digested with EcoRI and PacI and hybridized with a radiolabeled ORF29 DNA probe. Numbers indicate the sizes of DNAs in kilobase pairs.

Reduced or excessive expression of ORF29 reduces late but not immediate-early or putative early gene expression. Lysates were prepared from cells infected with ROka, ROka29DR, and ROka29D and Baculo 29 or from ROka29D that had been passaged once in cells without Baculo 29, and immunoblotting was performed with several VZV antibodies (Fig. 4). Cells infected with ROka29DR expressed fivefold higher levels of ORF29 protein than cells infected with ROka, while cells infected with ROka29D passaged once in cells without Baculo 29 expressed 1.5-fold less ORF29 protein than those infected with ROka or ROka29D and Baculo 29.


Figure 4
View larger version (39K):
[in this window]
[in a new window]

  		FIG. 4. Immunoblot of lysates from cells infected with ORF29 mutants blotted with antibody to ORF29 protein, IE62, IE63, IE4, VZV thymidine kinase (TK), or gE. Lysates were obtained from cells infected with ROka29D in the presence of Baculo 29 (ROka29D), ROka, ROka29DR, and ROka29D after one passage in cells without Baculo 29 (ROka29D P1) or were not infected with any virus. The small amount of ORF29 protein in cells infected with ROka29D that has been passaged once in melanoma cells likely reflects some residual ORF29 protein in the inoculum. Equivalent amounts of lysates were loaded in each lane and in each panel.

Expression of VZV IE62, IE63, IE4, and viral thymidine kinase, a putative early gene, was similar in cells infected with ROka, ROka29DR, or ROka29D either in the presence or absence of added Baculo 29. In contrast, expression of VZV gE was reduced twofold in cells infected with ROka29DR compared with cells infected with ROka and was reduced threefold in cells infected with ROka29D passaged once in cells in the absence of Baculo 29 (ROka29D P1) compared with cells infected with ROka. These experiments indicate that appropriate levels of ORF29 protein are required for optimal expression of gE but not for VZV IE or putative early proteins.

Growth of VZV ORF29 deletion and repaired virus in cell culture. To study the growth of the ORF29 mutants in cell culture, melanoma cells were infected with the viruses and titers were measured for five consecutive days. VZV deleted for ORF29 was unable to grow in melanoma cells (Fig. 5). VZV ROka29DR, in which ORF29 was driven by the human CMV promoter at a non-native site in the virus genome, grew slower than ROka but eventually reached a peak titer that was nearly equivalent to that of ROka.


Figure 5
View larger version (21K):
[in this window]
[in a new window]

  		FIG. 5. Growth of ORF29 mutants in melanoma cells. VZV ROka, ROka29D, and ROka29DR were grown in melanoma cells, and at various times the cells were treated with trypsin and virus titers were determined.

VZV deleted for ORF29 can infect ganglia. To determine whether VZV ORF29 is required for acute infection of ganglia, cotton rats were infected with ROka29D or ROka, and 3 days later the animals were sacrificed and dorsal root ganglia were obtained and assayed for VZV DNA. All animals infected with VZV ROka29D (6/6; 100%) or ROka (7/7; 100%) had viral DNA in their ganglia.

VZV ORF29 is critical for latent infection. To determine if VZV ORF29 is required for establishment of latent infection, cotton rats were inoculated with ROka29D, ROka29DR, or ROka, and 5 to 6 weeks later the animals were sacrificed, DNA was isolated from dorsal root ganglia, and PCR was performed with primers for ORF21 followed by Southern blotting. In the first experiment, 1 of 10 animals infected with VZV ROka29D, 3 of 11 animals infected with ROka 29DR, and 6 of 10 animals infected with ROka had viral DNA in ganglia (Fig. 6A). In the second experiment, none of 10 animals infected with ROka29D, 4 of 11 animals infected with ROka29DR, and 11 of 11 animals infected with ROka had VZV DNA in their ganglia (Fig. 6B). Taken together, 5% (1 of 20) of animals infected with ROka29D, 32% (7 of 22) of animals infected with ROka29DR, and 81% (17 of 21) of animals infected with ROka were latently infected. When the results of the two experiments were pooled, the differences between animals infected with ROka29D and ROka (P < 0.00001) and ROka29DR and ROka (P = 0.0044) were statistically significant, while the difference between animals infected with ROka29D and ROka29DR was barely significant (P = 0.045).


Figure 6
View larger version (12K):
[in this window]
[in a new window]

  		FIG. 6. Copy number of VZV genomes in animals latently infected with VZV ROka, ROka29D, or ROka29DR in experiments 1 (A) and 2 (B). The lower limit of detection of viral DNA is 10 copies, and the geometric mean copy number per 500 ng of DNA for the PCR-positive ganglia is shown at the bottom.

To verify that animals were latently infected with the ORF29 mutants, RNA was isolated from ganglia on the opposite side of the spinal cord from which DNA had been isolated. cDNA was prepared from the RNA and PCR was performed using primers for ORF63, a gene known to be expressed in VZV latently infected rodent ganglia, followed by Southern blotting. ORF63 RNA was detected in two of eight ganglia from animals infected with ROka29D, one of six animals with ROka29DR, and two of three animals infected with ROka (Fig. 7).


Figure 7
View larger version (18K):
[in this window]
[in a new window]

  		FIG. 7. Southern blot of cDNA corresponding to ORF63 RNA from animals latently infected with ROka29D, ROka29DR, or ROka. RNA was isolated from dorsal root ganglia of infected animals, cDNA was prepared, PCR was performed with primers to ORF63, and the blot was hybridized with a radiolabeled ORF63 probe. Cosmid MstII A, which encodes ORF63, is a positive control.

The inoculum used to infect animals with ROka29D was prepared by passaging Baculo 29-infected cells that had subsequently been infected with VZV ROka29D onto uninfected melanoma cells. Therefore, it was possible that recombination might have occurred between Baculo 29 and ROka29D. PCR and Southern blotting for ORF29 using DNA from rodent ganglia showed that one of eight ganglia from animals infected with ROka29D was positive for ORF29, while five of eight animals infected with ROka were positive for ORF29 (Fig. 8). These results imply that recombination between Baculo 29 and ROka 29D likely occurred in cell culture. Since such a recombinant virus was not detected by Southern blotting (Fig. 3) or by growing the virus on melanoma cells in the absence of Baculo 29 (Fig. 5), this suggests that recombination is a very rare event. These observations are consistent with the fact that 44 flasks (175 cm2 each) were required to prepare the ROka29D inocula for the animal experiments, while each in vitro experiment required 2 or fewer flasks of ROka29D-infected cells.


Figure 8
View larger version (32K):
[in this window]
[in a new window]

  		FIG. 8. Southern blot for ORF29 in ganglia of animals latently infected with ROka29D or ROka. Numbers correspond to the size of DNA in kilobase pairs.


arrow
DISCUSSION
 
We have shown that ORF29, the major DNA binding protein, is required for replication in cell culture. We also show that cells infected with VZV mutants either deleted for ORF29 or that overexpress the protein are impaired for late gene expression and for establishment of latency in rodents.

Cells infected with VZV deleted for ORF29 expressed similar levels of IE or putative early proteins as cells infected with parental virus, but the level of gE was reduced. Previous studies using transient transfections showed that ORF29 protein has no significant effect on the ability of IE62 to activate the ORF20 or ORF21 promoter and only a modest effect on the ORF28 promoter (10). While transient transfection using a plasmid expressing ORF29 protein alone did not upregulate expression from the gI promoter, ORF29 enhanced the ability of ORF62 protein to transactivate the gI promoter in transfections (18). In contrast, our studies show that in the context of the virus, ORF29 protein is important for expression of a late gene, gE.

HSV ICP8 is the homolog of VZV ORF29. Both proteins bind to single-stranded DNA (24, 33) and localize to punctate regions within the nucleus (4, 10), and ICP8, like ORF29, is essential for virus replication (16). Metabolic labeling studies with an HSV-2 ICP8 replication-defective mutant virus showed that proteins of all kinetic classes were expressed at levels similar to or slightly less than those of parental virus; gB and gD were expressed at lower levels than wild-type virus on immunoblot (12). Surprisingly, we found that overexpression of ORF29 protein during virus infection also resulted in reduced expression of gE. Thus, the level of ORF29 protein must be properly regulated for optimal late gene expression but not necessarily for immediate-early or early gene expression.

ORF29 is one of six proteins that are expressed during latency in human sensory or cranial nerve ganglia. Previously we showed that ORFs 21 and 66 are not required for establishment of latency (36, 39), while ORFs 4 and 63 (6, 7) have a critical role in latency in rodents. Here we show that while ORF29 is not required for VZV to enter ganglia, ORF29 is important for efficient establishment of latency in rodents. Similar studies with HSV-2 showed that an ICP8 null mutant was markedly impaired for latency in mice (19). Overexpression of ORF29 protein, as exemplified by the ROka29DR mutant, was also associated with a significant impairment of VZV latency in rodents. ORF29 protein is present in the nucleus of lytically infected cells but in the cytoplasm of human neurons during latency (17, 25). Interestingly, when an astrocytoma-derived cell line is infected with adenovirus which expresses ORF29, the protein is expressed in the cytoplasm; however, when these cells are treated with a proteosome inhibitor, the half-life of ORF29 protein is increased and the protein migrates to the nucleus (38). Thus, it is possible that overexpression of ORF29 protein in ROka29DR-infected neurons could result in both cytoplasmic and nuclear expression of the protein in the cells and thereby impair latency.

It is important to note that the cotton rat model does not reproduce all of the features of latency seen in humans. While the same VZV transcripts expressed during latency in humans are also expressed during latency in rodents experimentally infected with VZV (34), VZV reactivation from latency has not been described in rodents either in vivo or by cocultivation of ganglia on cell cultures in vitro. It is possible that reactivation occurs in rodents, but it has not been detected, since the animals are also asymptomatic during acute infection with VZV. It is important to note that VZV reactivation has also not been demonstrated by explant cocultivation of human ganglia. Thus, it will be important to study the effects of mutants in viruses similar to VZV, such as simian varicella virus.

VZV mutants of ORF29 might serve as useful vaccine candidates. Inoculation of mice with the HSV-1 d301 ICP8 deletion mutant virus induces HSV-specific T-cell proliferation and protects animals from lethal infection with wild-type virus (30, 32). Similarly, inoculation of animals with an HSV-2 IPC8 null mutant reduces acute and latent infection with a challenge virus and protects the animals from death by a challenge virus (13, 19). A VZV ORF29 deletion mutant might be useful as a replication-defective VZV vaccine, provided that a mutant is made that cannot recombine with the complementing cell line. Alternatively, ROka29DR, which overexpresses the ORF29 protein and is also impaired for latency, might serve as a vaccine candidate. This virus is impaired for latency but has the advantage that none of the viral proteins are deleted and all can be presented to the immune system, albeit at higher or lower levels than with wild-type virus.


arrow
ACKNOWLEDGMENTS
 
This study was supported by the intramural research program of the National Institute of Allergy and Infectious Diseases.

We thank Paul Kinchington for antibodies to ORF29, IE62, and IE63 proteins, Christine Talarico for antibody to VZV thymidine kinase, Bernard Roizman for plasmid pAc-CMV, and Jing Qin for help with statistics.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Laboratory of Clinical Infectious Diseases, Bldg. 10, Room 11N234, National Institutes of Health, 10 Center Drive, Bethesda, MD 20892. Phone: (301) 496-5265. Fax: (301) 496-7383. E-mail: jcohen{at}niaid.nih.gov. Back

{triangledown} Published ahead of print on 6 December 2006. Back


arrow
REFERENCES
 
    1
  1. Annunziato, P. W., O. Lungu, C. Panagiotidis, J. H. Zhang, D. N. Silvers, A. A. Gershon, and S. J. Silverstein. 2000. Varicella-zoster virus proteins in skin lesions: implications for a novel role of ORF29p in chickenpox. J. Virol. 74:2005-2010.[Abstract/Free Full Text]
    2. 2
  2. Boucaud, D., H. Yoshitake, J. Hay, and W. Ruyechan. 1998. The varicella-zoster virus (VZV) open-reading frame 29 protein acts as a modulator of a late VZV gene promoter. J. Infect. Dis. 178(Suppl. 1):S34-S38.
    3. 3
  3. Brunell, P. A., L. C. Ren, J. I. Cohen, and S. E. Straus. 1999. Viral gene expression in rat trigeminal ganglia following neonatal infection with varicella-zoster virus. J. Med. Virol. 58:286-290.[CrossRef][Medline]
    4. 4
  4. Bush, M., D. R. Yager, M. Gao, K. Weisshart, A. I. Marcy, D. M. Coen, and D. M. Knipe. 1991. Correct intranuclear localization of herpes simplex virus DNA polymerase requires the viral ICP8 DNA-binding protein. J. Virol. 65:1082-1089.[Abstract/Free Full Text]
    5. 5
  5. Chen, J. J., A. A. Gershon, Z. S. Li, O. Lungu, and M. D. Gershon. 2003. Latent and lytic infection of isolated guinea pig enteric ganglia by varicella zoster virus. J. Med. Virol. 70(Suppl. 1):S71-S78.
    6. 6
  6. Cohen, J. I., E. Cox, L. Pesnicak, S. Srinivas, and T. Krogmann. 2004. The varicella-zoster virus ORF63 latency-associated protein is critical for establishment of latency. J. Virol. 78:11833-11840.[Abstract/Free Full Text]
    7. 7
  7. Cohen, J. I., T. Krogmann, J. P. Ross, L. Pesnicak, and E. Prikhodko. 2005. Varicella-zoster virus ORF4 latency-associated protein is important for establishment of latency. J. Virol. 79:6969-6975.[Abstract/Free Full Text]
    8. 8
  8. Cohrs, R. J., M. Barbour, and D. H. Gilden. 1996. Varicella-zoster virus (VZV) transcription during latency in human ganglia: detection of transcripts mapping to genes 21, 29, 62, and 63 in a cDNA library enriched for VZV RNA. J. Virol. 70:2789-2796.[Abstract]
    9. 9
  9. Cohrs, R. J., J. Randall, J. Smith, D. H. Gilden, C. Dabrowski, H. van der Keyl, and R. Tal-Singer. 2000. Analysis of individual human trigeminal ganglia for latent herpes simplex virus type 1 and varicella-zoster virus nucleic acids using real-time PCR. J. Virol. 74:11464-11471.[Abstract/Free Full Text]
    10. 10
  10. Cohrs, R. J., J. Wischer, C. Essman, and D. H. Gilden. 2002. Characterization of varicella-zoster virus gene 21 and 29 proteins in infected cells. J. Virol. 76:7228-7238.[Abstract/Free Full Text]
    11. 11
  11. Condreay J. P., S. M. Witherspoon, W. C. Clay, and T. A. Kost. 1999. Transient and stable gene expression in mammalian cells transduced with a recombinant baculovirus vector. Proc. Natl. Acad. Sci. USA 96:127-132.[Abstract/Free Full Text]
    12. 12
  12. Da Costa, X. J., N. Bourne, L. R. Stanberry, and D. M. Knipe. 1997. Construction and comparison of a replication-defective herpes simplex virus 2 ICP8 mutant strain and its use in immunization studies in a guinea pig model of genital disease. Virology 232:1-12.[CrossRef][Medline]
    13. 13
  13. Da Costa, X. J., L. A. Morrison, and D. M. Knipe. 2001. Comparison of different forms of herpes simplex replication-defective mutant viruses as vaccines in a mouse model of HSV-2 genital infection. Virology 288:256-263.[CrossRef][Medline]
    14. 14
  14. Davison, A. J., and J. Scott. 1986. The complete DNA sequence of varicella-zoster virus. J. Gen. Virol. 67:1759-1816.[Abstract/Free Full Text]
    15. 15
  15. Ferrin, L. J., and R. D. Camerini-Otero. 1991. Selective cleavage of human DNA: RecA-assisted restriction endonuclease (RARE) cleavage. Science 254:1494-1497.[Abstract/Free Full Text]
    16. 16
  16. Gao, M., and D. M. Knipe. 1989. Genetic evidence for multiple nuclear functions of the herpes simplex virus ICP8 DNA-binding protein. J. Virol. 63:5258-5267.[Abstract/Free Full Text]
    17. 17
  17. Grinfeld, E., and P. Kennedy. 2004. Translation of varicella-zoster virus genes during human ganglionic latency. Virus Genes 29:317-319.[CrossRef][Medline]
    18. 18
  18. He, H., D. Boucard, J. Hay, and W. T. Ruyechan. 2001. Cis and trans elements regulating expression of the varicella-zoster virus gI gene. Arch. Virol. Suppl. 17:57-60.
    19. 19
  19. Jones, C. A., T. J. Taylor, and D. M. Knipe. 2000. Biological properties of herpes simplex virus 2 replication defective mutant strains in a murine nasal infection model. Virology 278:137-150.[CrossRef][Medline]
    20. 20
  20. Kennedy, P. G. E., E. Grinfeld, and J. E. Bell. 2000. Varicella-zoster virus gene expression in latently infected and explanted human ganglia. J. Virol. 74:11893-11898.[Abstract/Free Full Text]
    21. 21
  21. Kennedy, P. G. E., E. Grinfeld, and J. W. Gow. 1999. Latent varicella-zoster virus in human dorsal root ganglia. Virology 258:451-454.[CrossRef][Medline]
    22. 22
  22. Kennedy, P. G. E., E. Grinfeld, S. Bontems, and C. Sadzot-Delvaux. 2001. Varicella-zoster virus gene expression in latently infected rat dorsal root ganglia. Virology 289:218-223.[CrossRef][Medline]
    23. 23
  23. Kinchington, P. R., J. K. Hougland, A. M. Arvin, W. T. Ruyechan, and J. Hay. 1992. The Varicella-zoster virus immediate-early protein IE62 is a major component of virus particles. J. Virol. 66:359-366.[Abstract/Free Full Text]
    24. 24
  24. Kinchington, P. R., G. Inchauspé, J. H. Subak-Sharpe, F. Robey, J. Hay, and W. T. Ruyechan. 1988. Identification and characterization of a Varicella-zoster virus DNA-binding protein by using antisera directed against a predicted synthetic oligonucleotide. J. Virol. 62:802-809.[Abstract/Free Full Text]
    25. 25
  25. Lungu, O., C. A. Panagiotidis, P. W. Annunziato, A. A. Gershon, and S. J. Silverstein. 1998. Aberrant intracellular localization of varicella-zoster virus regulatory proteins during latency. Proc. Natl. Acad. Sci. USA 95:7080-7085.[Abstract/Free Full Text]
    26. 26
  26. Meier, J. L., R. P. Holman, K. D. Croen, J. E. Smialek, and S. E. Straus. 1993. Varicella-zoster virus transcription in human trigeminal ganglia. Virology 193:193-200.[CrossRef][Medline]
    27. 27
  27. Meier, J. L., X. Luo, M. Sawadogo, and S. E. Straus. 1994. The cellular transcription factor USF cooperates with Varicella-zoster virus immediate-early protein 62 to symmetrically activate a bidirectional viral promoter. Mol. Cell. Biol. 10:6896-6906.
    28. 28
  28. Meier, J. L., and S. E. Straus. 1993. Varicella-zoster virus DNA polymerase and major DNA-binding protein genes have overlapping divergent promoters. J. Virol. 67:7573-7581.[Abstract/Free Full Text]
    29. 29
  29. Moriuchi, H., M. Moriuchi, S. Debrus, J. Piette, and J. I. Cohen. 1995. The acidic amino-terminal region of varicella-zoster open reading frame 4 protein is required for transactivation and can functionally replace the corresponding region of herpes simplex virus ICP27. Virology 208:376-382.[CrossRef][Medline]
    30. 30
  30. Morrison, L. A., and D. M. Knipe. 1994. Immunization with replication-defective mutants of herpes simplex virus type 1: sites of immune intervention in pathogenesis of challenge virus. J. Virol. 68:689-696.[Abstract/Free Full Text]
    31. 31
  31. Ng, T. I., L. Keenan, P. R. Kinchington, and C. Grose. 1994. Phosphorylation of Varicella-zoster virus open reading frame (ORF) 62 regulatory product by viral ORF47-associated protein kinase. J. Virol. 68:1350-1359.[Abstract/Free Full Text]
    32. 32
  32. Nguyen, L. H., D. M. Knipe, and R. W. Finberg. 1992. Replication-defective mutants of herpes simplex virus (HSV) induce cellular immunity and protect against lethal HSV infection. J. Virol. 66:7067-7072.[Abstract/Free Full Text]
    33. 33
  33. Ruyechan, W. T. 1983. The major herpes simplex virus DNA-binding protein holds single-stranded DNA in an extended conformation. J. Virol. 46:661-666.[Abstract/Free Full Text]
    34. 34
  34. Sadzot-Delvaux, C., S. Debrus, A. Nikkels, J. Piette, and B. Rentier. 1995. Varicella-zoster virus latency in the adult rat is a useful model for human latent infection. Neurology 45(Suppl. 8):S18-S20.[Abstract/Free Full Text]
    35. 35
  35. Sato, H., L. Pesnicak, and J. I. Cohen. 2002. Varicella-zoster virus open reading frame 2 encodes a membrane phosphoprotein that is dispensable for viral replication and for establishment of latency. J. Virol. 76:3575-3578.[Abstract/Free Full Text]
    36. 36
  36. Sato, H., L. Pesnicak, and J. I. Cohen. 2003. Varicella-zoster virus ORF47 protein kinase which is required for replication in human T cells, and ORF66 protein kinase which is expressed during latency, are dispensable for establishment of latency. J. Virol. 77:11180-11185.[Abstract/Free Full Text]
    37. 37
  37. Stallings, C. L., and S. Silverstein. 2005. Dissection of a novel nuclear localization signal in open reading frame 29 of Varicella-zoster virus. J. Virol. 79:10370-10381.
    38. 38
  38. Stallings, C. L., G. J. Duigou, A. A. Gershon, M. D. Gersohn, and S. J. Silverstein. 2006. The cellular localization pattern of Varicella-zoster virus ORF29p is influenced by proteosome-mediated degradation. J. Virol. 80:1497-1512.[Abstract/Free Full Text]
    39. 39
  39. Xia, D., S. Srinivas, H. Sato, L. Pesnicak, S. E. Straus, and J. I. Cohen. 2003. Varicella-zoster virus ORF21, which is expressed during latency, is essential for virus replication but dispensable for establishment of latency. J. Virol. 77:1211-1218.
    40. 40
  40. Yang, M., J. Hay, and W. T. Ruyechan. 2004. The DNA element controlling expression of the Varicella-zoster virus open reading frame 28 and 29 genes consists of two divergent unidirectional promoters which have a common USF site. J. Virol. 78:10939-10952.[Abstract/Free Full Text]
    41. 41
  41. Zhou, G., V. Galvan, G. Campadelli-Fiume, and B. Roizman. 2000. Glycoprotein D or J delivered in trans blocks apoptosis in SK-N-SH cells induced by a herpes virus 1 mutant lacking intact genes expressing both glycoproteins. J. Virol. 74:11782-11791.[Abstract/Free Full Text]

Journal of Virology, February 2007, p. 1586-1591, Vol. 81, No. 4
0022-538X/07/$08.00+0     doi:10.1128/JVI.01220-06




This article has been cited by other articles:

  • Kyratsous, C. A., Silverstein, S. J. (2007). BAG3, a Host Cochaperone, Facilitates Varicella-Zoster Virus Replication. J. Virol. 81: 7491-7503 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cohen, J. I.
Right arrow Articles by Ali, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cohen, J. I.
Right arrow Articles by Ali, M. A.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»