This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dölken, L.
Right arrow Articles by Pfeffer, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dölken, L.
Right arrow Articles by Pfeffer, S.

 Previous Article  |  Next Article 

Journal of Virology, December 2007, p. 13771-13782, Vol. 81, No. 24
0022-538X/07/$08.00+0     doi:10.1128/JVI.01313-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Mouse Cytomegalovirus MicroRNAs Dominate the Cellular Small RNA Profile during Lytic Infection and Show Features of Posttranscriptional Regulation{triangledown}

Lars Dölken,1 Jonathan Perot,2 Valérie Cognat,2 Abdelmalek Alioua,2 Matthias John,3,{dagger} Jürgen Soutschek,3,{ddagger} Zsolt Ruzsics,1 Ulrich Koszinowski,1 Olivier Voinnet,2 and Sébastien Pfeffer2*

Max von Pettenkofer-Institut für Virologie, Ludwig-Maximilians-Universität München, Pettenkoferstr. 9a, 80336 München, Germany,1 IBMP-CNRS, 12, rue du Général Zimmer, 67084 Strasbourg Cedex, France,2 Alnylam Europe AG, Fritz-Hornschuch-Str. 9, 95326 Kulmbach, Germany3

Received 15 June 2007/ Accepted 3 October 2007


arrow
ABSTRACT
 
MicroRNAs (miRNAs) are small, noncoding RNA molecules that regulate gene expression at the posttranscriptional level. Originally identified in a variety of organisms ranging from plants to mammals, miRNAs have recently been identified in several viruses. Viral miRNAs may play a role in modulating both viral and host gene expression. Here, we report on the identification and characterization of 18 viral miRNAs from mouse fibroblasts lytically infected with the murine cytomegalovirus (MCMV). The MCMV miRNAs are expressed at early times of infection and are scattered in small clusters throughout the genome with up to four distinct miRNAs processed from a single transcript. No significant homologies to human CMV-encoded miRNAs were found. Remarkably, as soon as 24 h after infection, MCMV miRNAs constituted about 35% of the total miRNA pool, and at 72 h postinfection, this proportion was increased to more than 60%. However, despite the abundance of viral miRNAs during the early phase of infection, the expression of some MCMV miRNAs appeared to be regulated. Hence, for three miRNAs we observed polyuridylation of their 3' end, coupled to subsequent degradation. Individual knockout mutants of two of the most abundant MCMV miRNAs, miR-m01-4 and miR-M44-1, or a double knockout mutant of miR-m21-1 and miR-M23-2, incurred no or only a very mild growth deficit in murine embryonic fibroblasts in vitro.


arrow
INTRODUCTION
 
Among the numerous families of small RNA molecules implicated in RNA silencing pathways, microRNAs (miRNAs) are certainly the most studied in animal organisms. These ~22-nucleotide (nt) RNAs regulate gene expression at the posttranscriptional level in a wide range of organisms (23, 25, 26, 41). miRNAs are involved in a variety of biological functions, including, but not limited to, temporal regulation, developmental and cellular differentiation, tumorigenesis, apoptosis, hormone secretion, and hematopoiesis (1, 4, 22, 54). The biogenesis of miRNAs has been extensively reviewed in the literature (4, 10, 12, 15, 30, 45). Briefly, a long primary transcript (pri-miRNA) is processed in the nucleus by the RNase III Drosha in a stem-loop structured pre-miRNA, which is exported to the cytoplasm and further matured by the RNase III Dicer to a small interfering RNA-like duplex. The single-stranded mature miRNA is then asymmetrically transferred into an Argonaute-containing miRNA effector complex, which can induce mRNA cleavage and/or translational inhibition.

While RNA silencing plays a major role in protecting insect and plant organisms against viral infection (50, 53), DNA viruses infecting mammals appear to have evolved ways of using this pathway to their own advantage. Indeed, a number of mammalian viruses have been found to express miRNAs (37). Since the initial discovery of miRNAs in the gammaherpesvirus Epstein-Barr virus (EBV) (38), miRNAs have been found in Kaposi's sarcoma-associated herpesvirus (KSHV) (6, 36, 43), murine herpesvirus 68 (36), human cytomegalovirus (HCMV) (13, 16, 36), herpes simplex virus type 1 (9, 18), Marek's disease virus (5, 55), rhesus lymphocryptovirus (7), rhesus monkey rhadinovirus (44), simian virus 40 (SV40) (47), and human immunodeficiency virus type 1 (34). Although the precise role of viral miRNAs is not known in many instances, they are believed to represent a general mechanism whereby viruses regulate expression of both their own genome and their host's genome during productive infection and/or latency. For instance, the SV40-encoded miR-S1 mediates cis cleavage of the large viral T-antigen transcript encoding the major viral regulator (47), a process thought to facilitate evasion of the host immune response of the host. It has been proposed that herpes simplex virus type 1 miR-LAT could down-regulate in trans the accumulation of cellular TGFß and SMAD3 to reduce apoptosis (18). Most of the viral miRNAs identified thus far have been found in human herpesviruses, and with the exception of murine herpesvirus 68, few miRNAs are known in viruses infecting small animal models, a prerequisite for the in vivo investigation of viral miRNA functions.

Herpesviruses are large DNA viruses, which upon primary infection establish lifelong, latent infections, leaving infected individuals at risk of subsequent reactivation and disease. Although HCMV is usually asymptomatic in healthy individuals, it is the major cause of morbidity in immunocompromised patients and allogeneic bone marrow or organ transplant recipients. It is also the leading agent of birth defects among congenitally transmitted infections. HCMV shows a long replication period of 48 to 72 h (32) such that HCMV faces several layers of innate and adaptive immune responses during primary infection and reactivation. Nonetheless, HCMV has evolved multiple mechanisms to thwart cellular defenses mounted by the host, and production of miRNAs represents an original example of such viral counterdefensive strategies, which does not require protein production. To date, a total of 11 miRNAs have been identified in HCMV (13, 16, 36). As opposed to those of other viruses, such as EBV and KSHV encoding clustered miRNAs, HCMV miRNAs are spread along the genome. Recently, it was shown that one of the HCMV miRNAs (miR-UL112-1) targets MIC-B, a stress-induced ligand of the natural killer (NK) cell-activating receptor NKG2D, which is critical for NK cell killing of virus-infected cells (46). Mouse infection with the murine CMV (MCMV) is the animal model of choice to study the biology of CMV infection in vivo (19, 20). Here we report on the identification and characterization of 18 miRNAs expressed by the MCMV during lytic infection of mouse NIH 3T3 fibroblasts. Using small RNA cloning and sequencing, as well as Northern blotting and nuclease protection assays, we define their kinetics of expression in primary infection both in vitro and in vivo. We show that some of these miRNAs are posttranscriptionally regulated. We report on the generation of miRNA deletion mutants for four MCMV miRNAs. By showing that virus replication of none of the mutants is grossly affected in fibroblasts, and thus are unlikely to contain secondary mutations, we lay the basis for their functional characterization in further studies in vivo.


arrow
MATERIALS AND METHODS
 
Cell lines and viruses. BALB/c murine embryonic fibroblasts (MEFs), M2-10B4 bone marrow stroma cells (CRL-1972; ATCC), and NIH 3T3 fibroblasts (CRL-1658; ATCC) were prepared and treated as described previously (31). Wild-type and mutant MCMVs derived from the Smith strain were reconstituted by transfection of the respective bacterial artificial chromosome (BAC) DNA into MEFs using Superfect transfection reagent (Qiagen) according to the manufacturer's instructions. All virus stocks were prepared on M2-10B4 cells as described previously, and virus titers were determined on MEFs by the standard plaque assay (40). Growth of viruses on MEFs was characterized in multistep growth conditions. Approximately 1 x 105 to 2 x 105 cells were infected at a multiplicity of infection (MOI) of 0.1 in 24-well plates. After 1 hour of incubation at 37°C, the virus inoculum was removed, cells were washed with phosphate-buffered saline, and fresh cell growth medium was added. Supernatants were harvested daily over a 6-day period, and virus production was quantified on MEFs by plaque assays (40).

MCMV infection of mice. Female 12-week-old BALB/c mice were purchased from Harlan-Winkelmann (Borchen, Germany), infected at 12 to 13 weeks of age, and kept under specific-pathogen-free conditions throughout. Mice were infected intravenously (i.v.) with either 1 x 106 (for virus titrations) or 5 x 106 PFU (for miRNA detection by nuclease protection assays) of tissue culture-derived MCMV diluted in a total volume of 200 µl. Mice were killed at day 1, 3, 5, and 7 postinfection, and their livers, lungs, and spleens were taken. Titers of infectious virus were determined by titrating organ homogenates using centrifugal enhancement (30 min at 800 x g) and the standard plaque assay.

RNA preparation and Northern blotting. NIH 3T3 fibroblasts were infected at an MOI of 10 using centrifugal enhancement (30 min at 800 x g). Total cellular RNA was prepared from cells 4 to 72 h postinfection (hpi) or from mouse tissues using TRIzol reagent (Invitrogen) following the manufacturer's instructions. In order to characterize the kinetics of viral miRNA expression, RNA was prepared from cells infected and cultured in the presence of either cycloheximide (50 µg/ml), which blocks de novo protein synthesis, or foscarnet (phosphonoacetic acid [PAA]) (300 µg/ml), which blocks DNA replication (11). Alternatively, small RNAs were prepared directly from mouse liver tissue using Ambion miRvana purification kit for short RNA according to the manufacturer's instructions.

Northern blot analysis was performed as described previously (38) loading 10 µg of total RNA per lane and using 5' 32P-radiolabeled oligodeoxynucleotides complementary to the miRNA sequence or to part of the U6 snRNA sequence as probes. Blots were analyzed and quantified by phosphorimaging using an FLA7000 scanner from Fuji.

Small RNA cloning. Small RNA cloning was performed as described previously (35, 36) using 100 µg of total RNA per library. Sequences were annotated as described previously (36) using the following databases: genomic sequences were from the release mm8 of the mouse genome from the UCSC Genome Browser database (NCBI build 36, February 2006). tRNA, rRNA, sn-snoRNA, and small cytoplasmic RNA sequences were extracted from release 158 of GenBank (15 February 2007) (http://www.ncbi.nlm.nih.gov/Genbank/) for Mus musculus, Rattus norvegicus, and Homo sapiens genomes. miRNA sequences were extracted from release 9.1 of miRBase (http://microrna.sanger.ac.uk/sequences/).

Nuclease protection assays. Synthetic DNA probes complementary to MCMV miR-m01-4 or miR-M44-1 and with nonspecific 3' overhangs (5'-ACGCGCACGTGTTAGCATAGGATCTTCTT 3' and 5'-CCGCGGCTCTGGAAAAAGATACGATCGGAGCTCTTCTT 3', respectively [nonspecific overhang underlined]) were 5' end labeled using polynucleotide kinase (New England Biolabs). Total RNA (miR-m01-4) or the small RNA fraction purified using the Ambion miRvana kit (miR-M44-1) from the liver, lung, or spleen was hybridized in solution to the miRNA-specific probe in the presence of 45% formamide (miR-m01-4) or without formamide (miR-M44-1). After denaturation at 92°C for 2 min, the samples were incubated for an additional 2 h at room temperature. The hybridization conditions allowed detection of the mature microRNA, not pre-microRNA. Following treatment with S1 nuclease (GE Healthcare) at 37°C, samples were loaded on a denaturing 10% acrylamide gel. Gels were exposed to a phosphorimager screen and analyzed on a Typhoon 9200 instrument (GE Healthcare).

Detection and quantification of m01 and IE1 transcripts by quantitative real-time PCR. Quantitative real-time PCRs were established for Light Cycler (Roche Molecular Biochemicals) to quantify m01 and IE1 gene expression. Each reaction was carried out using 5 µl of cDNA (corresponding to 50 ng RNA) and 15-µl reaction mixtures consisting of Light Cycler Fast Start, DNA MasterPlus SYBR green I, and 0.5 µM of each primer. PCR mixtures were subjected to 10 min of 95°C hot start enzyme activation, and 45 cycles of 95°C denaturation for 10 s, 58°C annealing for 3 s, and 72°C elongation for 10 s, including subsequent melting curve analysis. Oligonucleotide primers used for amplification of the IE1 gene were as described previously (49). Three sets of primers were chosen and tested for amplification of the m01 gene, including the following: m01-for1, GCTACCCAGACTCACCGCTGAGAGA; m01-rev1, AGGCAACAGTCGCTTCACCGCT; m01-for2, CGCCTGAGTCAGCCTCCGG; m01-rev2, GCTTCACACGCTGGCGGG; m01-for3, GCAACGTACCCGCAAGTCGATC; and m01-rev3, GTGACAACAGCCTACTTGGGTGGG.

NIH 3T3 cells were infected with BAC-derived wild-type MCMV or its miR-m01-4 deletion mutant at an MOI of 10. RNA was extracted from infected cells at 24, 48, and 72 hpi and from uninfected cells as a control. Two micrograms of RNA was treated with DNase I (Invitrogen) for 15 min. RNA was recovered using RNeasy MinElute Spin columns (Qiagen). cDNA synthesis was performed using Superscript III with oligo(dT) primers (both from Invitrogen) following the manufacturer's instructions. cDNA samples were tested in four replicate samples for m01 and IE1 expression.

Construction of MCMV miRNA deletion mutants. For construction of miRNA mutant MCMV genomes, we used homologous recombination of linear PCR fragments with the MCMV BAC plasmid pSM3fr (52) in Escherichia coli as described elsewhere (51). Linear fragments were generated by PCR with plasmid pCP15 (8), which contains a kanamycin resistance gene located in between two FLP recombinase recognition target (FRT) sites. The following contiguous primers were used: H5-miR-m01-4-ko, AACGCTCGTTTTCTGAGTCGTTTTTGCGCTAGAACGCATATCGGGGGAGTCCAGGGTTTT CCC; H3-miR-m01-4-ko, GCGCGCGGCCCGGAGGCTGACTCAGGCGAGCGCGCGTCTGCTTCCGGCTCGTATGTTGTGTGG; H5-miR-M23-2-ko, AGATAGACAGACAGGCTCAGTCTCATACCGTCGGCCATCCTCGGGGGAGTCCAGGGTTTTCCC; H3-miR-M23-2-ko, TCCCGGTTTCTTTGTCCGACGCTCGTCGATCGAGGCGCTACTTCCGGCTCGTATGTTG TGTGG; H5-miR-M44-ko, CTCGATGCTGTCAGTTATCTGTTGTATACGATTGCCGGCGTCGGGGGAGTCCAGGGTTTTCCC; and H3-miR-M44-ko, AAACGCCGATCGACGTACGTCTGTGTTATATGCCGCCGTGCTTCCGGCTCGTATGTTGTGTGG). The homologies targeting the sequences directly flanking the pre-miRNA regions are underlined. After insertion into the MCMV genome by homologous recombination, the kanamycin resistance cassette was excised as described previously (8), thereby replacing the pre-miRNA sequences with 276 nt of pCP15 containing a single FRT site.


arrow
RESULTS
 
Small RNA cloning from MCMV-infected cells. In order to identify miRNAs encoded by MCMV, we generated small RNA libraries from NIH 3T3 mouse fibroblasts lytically infected by the Smith strain (14) of MCMV for 24, 48, and 72 h and from noninfected cells as controls. To obtain a comprehensive picture of the corresponding small RNA profiles, between 1,600 and 2,000 small RNA clones per library were sequenced. Most of the sequences (around 90% in average) were represented by miRNAs due to the use of a cloning protocol designed to enrich the library for sequences with a 5' phosphate (35, 36) (Table 1). In addition, and in contrast to previous observations (36), there was no significant accumulation of random degradation products from longer RNAs, compared to the reference library from noninfected cells, even though the cells were lytically infected for up to 72 h. Throughout the time course of infection, the ratio of sequences originating from the virus rose steadily from 32% of total sequences at 24 hpi to 56% at 72 hpi. The vast majority of these viral sequences was found to correspond to viral miRNAs, and only 0.3% were cloned only once and could not be bioinformatically assigned to a stem-loop precursor. Compared to the overall pool of miRNAs (i.e., cellular plus viral), the contribution of viral miRNAs was highly significant. Viral miRNAs represented 35% of all (cellular plus viral) miRNAs at 24 hpi, 53% at 48 hpi, and 61% at 72 hpi.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Distribution of small RNAs in different libraries

Identification of 18 MCMV-encoded miRNAs. In order to identify MCMV-encoded miRNAs, we analyzed all sequences matching the viral genome, which were cloned multiple times, and that mapped at a location adjacent to an approximately 30-nt-long, highly complementary sequence defining a putative pre-miRNA position. Folding of the surrounding 60 to 130 nt with mFold (56) was used to confirm the presence of a potential stem-loop precursor structure (Fig. 1A). In some cases, the existence of the putative double-stranded RNA precursor was confirmed by cloning small RNAs from both arms of the predicted pre-miRNA, either in the form of the nonfunctional star sequence, or because the small RNAs from both arms accumulated to similar levels (Table 2 and Fig. 1A). We identified a total of 27 different viral small RNA sequences that could be assigned to 18 distinct pre-miRNAs (Table 2). We have named these miRNAs according to their genomic location in accordance with previously used nomenclature (36, 38). The sequences are spread across the entire viral genome and are expressed either as individual or clustered miRNAs. Nine miRNAs are present in the 3' untranslated regions (3'-UTRs), seven are in the coding sequences of predicted genes (m01, M55, M87, M88, m107, and m108), and two miRNAs are located 5' of a predicted open reading frame (ORF) (m01 and M95). While pre-miR-M95 ends only 14 nt upstream of the M95 ORF, pre-miR-m01-1 is located more than 1,100 nt upstream of the predicted m01 coding sequence and of pre- miR-m01-2.


Figure 1
View larger version (51K):
[in this window]
[in a new window]

 
FIG. 1. MCMV-encoded miRNAs. (A) Predicted stem-loop secondary structures of MCMV-encoded miRNAs. Mature miRNA sequences are shown in bold type, and miRNA* sequences are underlined. Nucleotides indicated by a black arrowhead (miR-108-1-3p [m108-1]) were changed from A to G compared to the available MCMV genome sequence. Secondary structures were determined using mFold. (B) Northern blot analysis of MCMV-expressed miRNAs. Murine fibroblast cells were infected at a multiplicity of 10 PFU per cell. Total RNA was harvested from mock-infected cells (M) and in MCMV-infected cells at 4, 14, and 26 hpi and subjected to Northern blot analysis using probes specific for the cloned viral miRNA sequences. Northern blot analysis of cellular miR-21 and of U6 snRNA served as loading controls.


View this table:
[in this window]
[in a new window]

 
TABLE 2. MCMV miRNA sequences, genomic positions, and distribution in the three libraries made from MCMV-infected NIH 3T3 cells

Some miRNAs were more abundant than others. Thus, miR-m01-4 represented on average 40% of all viral miRNAs. The next most abundant miRNAs were miR-M23-2, miR-m21-1, and miR-M44-1, which accounted, respectively, for 22%, 12%, and 5% of all viral miRNAs. Intriguingly, we noted that in three cases, miRNAs were expressed from both genomic strands of the same genomic locus. miR-m21-1 is expressed from the plus strand at position 23515-23535, and miR-M23-2* is expressed from the minus strand at position 23509 to 23530. Consequently, the two miRNAs are perfectly complementary over 16 nt. The same is true for miR-m22-1 and miR-M23-1-5p, respectively, matching the plus and minus strand, and shifted by 4 nt (see below). Additionally, miR-m107-1 is expressed from the plus strand at a position opposite that of miR-m108-2-3p, shifted by only 1 nt (Table 2). Strand complementarity does not seem to interfere with the accumulation of these miRNAs, as they were cloned multiple times and could be readily detected by Northern blot analysis. We also noted for miR-m108-1-3p that two positions were mutated from A to G compared to the genomic sequence (Table 2 and Fig. 1). Sequencing of the BAC revealed that these mutations are present on the genomic DNA and thus do not represent editing of the pre-miRNA (data not shown).

To validate the expression of MCMV miRNAs in infected cells, we carried out Northern blot analysis of RNA extracted from NIH 3T3 cells, either noninfected or infected for 4, 14, or 26 h. We could confirm the expression of all cloned sequences, except for miR-m59-2, miR-M95-1, and miR-m108-1, for which we did not perform Northern blotting. Figure 1B shows the results obtained for 12 out of the 18 MCMV miRNAs.

Kinetics of MCMV miRNA expression. To obtain insight into the kinetics of MCMV miRNA expression during infection, we carried out Northern blot analysis of RNA extracted from cells infected from 4 hpi up to 72 hpi. We also analyzed RNA from cells treated with the protein synthesis inhibitor cycloheximide or the DNA replication inhibitor foscarnet (PAA), sampled at 24 hpi (Fig. 2). With the exception of miR-m01-1 (for which the mature form was hardly detectable, despite it being cloned numerous times), both the pre-miRNA and the mature miRNA could be detected by Northern blotting for all analyzed sequences. Except for miR-M55-1 and miR-m108-2-5p, all of the viral miRNAs became detectable between 4 and 14 hpi (Fig. 1B and Fig. 2), indicating immediate-early or early expression kinetics, upon which accumulation of mature miRNAs rose steadily over time. In cells treated with cycloheximide, mature miRNAs accumulated below the detection level, consistent with early expression kinetics. However, in some cases, the corresponding pre-miRNAs were still detectable (miR-m01-2, miR-m59-1, miR-M23-2, and miR-M44-1), indicating immediate-early kinetics. Consistent with these data, foscarnet treatment either did not impair expression of MCMV miRNAs at all or only slightly reduced it (miR-m01-4, miR-m01-2, miR-m01-3, miR-m21-1, and miR-m59-1).


Figure 2
View larger version (85K):
[in this window]
[in a new window]

 
FIG. 2. Expression kinetics of MCMV miRNAs. Murine fibroblast cells were infected at a multiplicity of 10 PFU per cell in the presence of either cycloheximide (CHX), foscarnet (PAA), or no drug. RNA was harvested at multiple time points (in hours) throughout infection and after 24 h of CHX or PAA treatment and subjected to Northern blot analysis. The expression of mature miRNAs and corresponding pre-miRNAs is shown. Northern blot analysis for cellular miR-16 and U6 snRNA served as loading controls. Lanes M, RNA from mock-infected cells.

Two MCMV miRNAs, namely, miR-M23-1-5p and -3p, showed a feature distinct from all the others. miR-M23-1-5p and -3p miRNAs were cloned 35 and 30 times, respectively, at 24 hpi, but the number of clones dropped dramatically by 48 and 72 hpi (Table 2). As indicated earlier, these miRNAs are expressed from a position opposite another miRNA, miR-m22-1 (Fig. 3A). We monitored the accumulation of these two miRNAs by Northern blot analysis and, surprisingly, detected a ladder of low-molecular-weight RNA species increasing in size over time from 24 hpi to 72 hpi (Fig. 3B). The accumulation of pre-miRNA was either unchanged (miR-M23-1-5p) or increased slightly over time (miR-M23-1-3p). When analyzing the sequences representing miR-M23-1-5p, we could detect several clones showing a nontemplated addition of one or two uridines at the 3' end of the small RNA (Fig. 3C). Therefore, these two miRNAs appear to be 3' polyuridylated.


Figure 3
View larger version (48K):
[in this window]
[in a new window]

 
FIG. 3. MCMV miR-M23-1-5p and -3p are polyuridylated. (A) Schematic representation of the m21-M23 loci in the genome. Known or predicted ORFs are indicated by white open arrows, and miRNAs are indicated by gray arrowheads. (B) Northern blot analysis of miR-M23-1-5p and miR-M23-1-3p at 24, 48, and 72 hpi (MOI of 10) showed the appearance of an RNA ladder, a feature distinct from all other miRNAs. Lanes M, RNA from mock-infected cells. (C) Sequence clones representing miR-M23-1-5p. Nongenomic nucleotides are indicated by bold type. The number of clones of the sequence at 24, 48, and 72 hpi is indicated to the right of the sequence.

Detection of MCMV miRNAs in vivo. In order to get closer to natural infection conditions, we aimed at detecting MCMV miRNAs during in vivo infection. We infected BALB/c mice i.v. with 5 x 106 PFU wild-type MCMV and extracted RNA from the liver, lung, and spleen at 3 and 5 days postinfection. Using a nuclease protection assay, we could detect the accumulation of miR-m01-4 in all of these organs and the accumulation of miR-M44-1 in the liver (Fig. 4A). While miR-m01-4 expression levels increased in the lung from day 3 to day 5 postinfection, the opposite was observed for the liver and spleen. Similarly, miR-M44-1 expression decreased from day 3 to day 5 in the liver. The same kinetics were seen for virus titers in these organs, as determined by titration assay in a separate experiment (Fig. 4B), indicating that miRNA accumulation parallels the production of infectious virus in vivo.


Figure 4
View larger version (24K):
[in this window]
[in a new window]

 
FIG. 4. In vivo detection of MCMV miRNAs by nuclease protection assay. (A) Five micrograms of RNA extracted from the livers, lungs, and spleens of two noninfected mice or three mice i.v. infected with 5 x 106 PFU MCMV for 3 days (lanes A, B, and C) or 5 days (lanes D, E, and F) were hybridized to a radiolabeled probe complementary to miR-m01-4 or miR-M44-1, digested with nuclease S1, and loaded on a denaturing acrylamide gel. The arrows indicate the expected positions of the protected fragment. ND, not digested; Neg, negative-control yeast RNA; M1 and M2, RNA from mock-infected mouse 1 and mouse 2, respectively; Pos, RNA from NIH 3T3 cells infected by MCMV; dpi, days postinfection. (B) Time course of infectious virus present in different organs of BALB/c mice i.v. infected with 1 x 106 PFU MCMV. Five mice were infected per group. The livers, lungs, and spleens were taken at 1, 3, 5, and 7 days postinfection. The titers of infectious virus were determined by titrating organ homogenates using centrifugal enhancement (30 min. at 800 x g) and a standard plaque assay. The broken lines indicate the detection limit, and the short black lines indicate the median value.

Generation and characterization of miRNA deletion mutants for miR-m01-4, miR-M23-2/m21-1, and miR-M44-1 in vitro. The m01 gene encodes a cluster of four distinct miRNAs. Interestingly, miR-m01-1 is located almost 1,200 nt upstream of the predicted m01 coding region. While miR-m01-2 and miR-m01-3 are both located within the predicted m01 ORF, miR-m01-4 is located about 100 nt downstream of pre-miR-m01-3 in the 3'-UTR of the m01 transcript. According to our cloning and sequencing data, miR-m01-4 contributes to about 40% of all viral miRNA produced throughout lytic infection of NIH 3T3 fibroblasts. To assess the importance of miR-m01-4 for viral replication in fibroblasts, we created a deletion mutant of miR-m01-4 using BAC technology, replacing the pre-miRNA coding sequence with a 276-nt insert derived from pCP15 (see Materials and Methods). The knockout deletion was confirmed by sequencing, and the integrity of the overall genomic sequence of the mutant MCMV BAC was tested by analysis of several restriction patterns (data not shown). The mutant BAC was then reconstituted into virus by transfection of MEFs. To test whether the deletion of the pre-miR-m01-4 coding sequence indeed resulted in the specific loss of miR-m01-4, Northern blot analysis of RNA prepared from NIH 3T3 cells infected with the deletion mutant was performed (Fig. 5A). While miR-m01-4 was undetectable by Northern blotting, miR-m01-2, miR-M23-2, miR-M44-1, and miR-16 were still detectable with signal intensities similar to the intensity of signal from RNA extracted from cells infected with the wild-type virus, indicating that expression of other miRNAs was largely unaffected. Nonetheless, the knockout of pre-miR-m01-4 resulted in a specific 2- to 2.7-fold increase in miR-m01-3 levels at 24 and 48 hpi, possibly caused by more efficient processing of the miR-m01-4-proximal pre-miR-m01-3 in the absence of pre-miR-m01-4 (Fig. 5B).


Figure 5
View larger version (64K):
[in this window]
[in a new window]

 
FIG. 5. Characterization of miRNA deletion mutants. (A) Expression of viral miRNAs in NIH 3T3 cells infected (MOI of 10) with wild-type MCMV (wt) or with deletion mutants for miR-m01-4, miR-M23-2/m21-1, and miR-M44-1 or in mock-infected cells (M). Total RNA was harvested at 24, 48, and 72 hpi and subjected to Northern blot analysis. The expression of viral miRNAs and corresponding pre-miRNAs is shown. Northern blot analysis for cellular miR-16 and ethidium bromide staining for U6 snRNA served as loading controls. m01-4, MiR-m01-4. (B) Relative quantification of indicated miRNAs in {Delta}miR-m01-4 versus wild-type (wt) MCMV-infected cells after normalization to U6 signals. The broken line indicates a relative value of 1. (C) Growth curves of wild-type MCMV (closed circles) and MCMV deletion mutants MCMV-{Delta}miR-m01-4 (open squares), MCMV-{Delta}miR-M23-2/m21-1 (open circles), and MCMV-{Delta}miR-M44-1 (open triangles) on murine embryonic fibroblasts. MEFs were infected at an MOI of 0.1. Supernatants (from duplicate samples) were harvested daily over a 6-day period and titrated on MEFs by the standard plaque assay. Combined data of two independent experiments are shown. (D) Relative quantification of m01 transcripts in NIH 3T3 cells infected with wild-type (wt) MCMV (open bars) and MCMV-{Delta}miR-m01-4 (gray bars) at an MOI of 10 for 24, 48, and 72 h. After RNA extraction, viral DNA was efficiently removed by DNase I treatment, and cDNA was synthesized using oligo(dT) primers. Relative quantification of m01 and IE1 transcripts was performed by real-time PCR based on standard curves prepared from BAC DNA (data not shown). The values are shown as means ± standard errors of the means (error bars).

Additional knockout mutants for miR-M23-2/m21-1 and miR-M44-1 were created and validated as described above for miR-m01-4 (Fig. 5A). In addition to the knockout of miR-M23-2, this deletion mutant also lacks miR-m21-1, as the two miRNAs are expressed from opposing strands from the same genomic locus. All of these miRNAs are located in the 3'-UTR of the corresponding transcripts and show no overlap with other predicted MCMV transcripts. Thus, their knockout did not directly interfere with any predicted MCMV open reading frame. No attenuation was observed during the propagation of all three deletion viruses on M2-10B4 cells. While the miR-m01-4 deletion mutant replicated to levels similar to those of wild-type virus even under multistep growth conditions on MEFs, the other two mutants showed very mild attenuation (two- to fivefold decreases) (Fig. 5C), which may be due to secondary effects on the M23 and M44 loci. In a consecutive study, revertants of these three mutants will be created to identify and characterize the functions of these viral miRNAs in vitro and in vivo.

In a previous study, the m01 transcript was not detectable by microarray analysis and hardly detectable by PCR (48). In order to test whether this was due to very low m01 transcript levels caused by efficient turnover of m01 transcripts into miRNAs or problems associated with the detection of the m01 transcript, we established a quantitative real-time PCR for m01 and IE1 (to normalize for viral gene expression). In total, we had to test three pairs of PCR primers for efficient amplification of small parts of the m01 locus. The first two sets of primers, both located within the m01 ORF either in between pre-miR-m01-2 and pre-miR-m01-3 or pre-miR-m01-3 and pre-miR-m01-4, did not allow efficient target amplification on BAC DNA. At least 1,000-fold-higher concentrations of BAC DNA were required to achieve detection levels similar to those for IE1. In the presence of 5% dimethyl sulfoxide, a small increase in PCR efficiency was observed, indicating that low PCR efficiency was due to the formation of secondary structures by pre-miRNA folding (data not shown). The third set of primers (m01-for3 and m01-rev3) located just 5' of the predicted m01 ORF allowed efficient and specific target amplification. Standard curves for m01 and IE1 were prepared using BAC DNA (data not shown) for relative quantification of the corresponding transcripts.

RNA was prepared from NIH 3T3 cells infected with wild-type virus or its miR-m01-4 deletion mutant (MOI of 10) for 24, 48, and 72 h. Following RNA extraction and DNase I digestion, cDNA synthesis was carried out using oligo(dT) primers. In order to exclude detection of viral genomes instead of m01 and IE1 cDNA, a second reverse transcription assay was carried out in parallel without adding reverse transcriptase to the reaction mix. These samples showed a >100-fold-lower concentration of PCR targets than those for the cDNA samples. In addition, no specific signals were obtained when analyzing cDNA prepared from uninfected cells (data not shown). Thus, the specificity of viral IE1 and m01 cDNA detection was confirmed. Interestingly, relative quantification of m01 to IE1 transcripts revealed very similar, high expression levels for m01 and IE1 at 24, 48, and 72 hpi, indicating that a substantial amount of m01 transcripts was not utilized for miRNA synthesis. At 24 and 48 hpi, m01 transcript levels were found to be slightly higher for the miR-m01-4 deletion mutant than for wild-type virus. Thus, deletion of the most abundant viral miRNA leads to a very small increase in m01 transcript levels (Fig. 5D). This effect was reversed at 72 hpi.


arrow
DISCUSSION
 
In this study, we identified 27 small RNAs expressed from discrete foci scattered throughout the MCMV genome. There is strong evidence that these RNAs are bona fide miRNAs encoded by MCMV. First, all RNAs were cloned from pools of small RNAs isolated and fractionated from cells infected by MCMV (Table 1). Second, the genomic regions directly surrounding all cloned small RNAs were found to fold into typical short hairpin structures by in silico analysis (Fig. 1A). Third, all mature miRNAs and, in most cases, their predicted pre-miRNAs were detected by Northern blotting exclusively in MCMV-infected cells (Fig. 1B and 2). Finally, for some miRNAs, both arms of the predicted pre-miRNAs were cloned. MCMV miRNAs accumulate to very high levels, increasing over time throughout fibroblast infection. At late infection time points, MCMV miRNAs become even more abundant than some of the most abundant host miRNAs, suggesting that they might well eventually outcompete cellular miRNAs. In adenovirus-infected cells, the virus-associated RNAs, which are expressed and accumulate at extremely high levels, saturate the export and processing machinery of cellular miRNAs (2, 3). Similarly, expression of viral miRNAs in lytic MCMV infection stages might perturb, at least to some extent, some of the fine-tuned regulation orchestrated by cellular miRNAs.

The mature form of a number of MCMV miRNAs was already detectable at 4 to 8 hpi, indicating that they are expressed with early or even immediate-early kinetics (Fig. 2). Nonetheless, mature MCMV miRNAs were not detectable in cells treated with cycloheximide for 24 h, indicating that de novo synthesis of viral proteins is likely required for their production. However, for a number of miRNAs, specific signals with sizes very similar to those of the predicted pre-miRNAs were detectable by Northern blotting in cycloheximide-treated cells, which is consistent with immediate-early expression of these pre-miRNAs. A similar observation was made for HCMV miRNA miR-UL36-1 (16), but not for any other HCMV miRNA. Both the HCMV UL36 transcript and the UL36 pre-miRNA are expressed with immediate-early kinetics. Similar to our observation, the mature miR-UL36-1 is not detectable in cycloheximide-treated cells, whereas the pre-miRNA accumulated to levels higher than those in nontreated cells. Thus, our results extend this initial observation to other viral miRNAs. Grey et al. (16) suggested that prolonged cycloheximide treatment could deplete the cells of factors required for processing of mature miRNAs, such as Dicer. Our results are in favor of this hypothesis, as we noticed a reduction in the levels of some cellular mature miRNAs in cycloheximide-treated cells (data not shown). However, this cannot explain the accumulation of viral pre-miRNAs, as they also require processing by the cellular factor Drosha. This contradiction might be explained by the fact that the half-life of the Drosha-containing complex may be higher than that of the Dicer-containing complex. It will be of interest to confirm this hypothesis by analyzing Dicer and Drosha expression upon cycloheximide treatment.

Interestingly, not all miRNAs encoded by MCMV followed the same pattern of accumulation. Indeed, the accumulation of both arms of miR-M23-1 was inversely correlated to that of all other miRNAs. We observed that the cloning frequency of miR-M23-1-5p and -3p dropped significantly from 24 to 72 hpi and that both sequences seemed to undergo 3' polyuridylation (Fig. 3B and C). Additionally, three other miRNAs, miR-m21-1, miR-m22-1, and miR-M23-2, showed the addition of one extra U at their 3' end (Table 2). The addition of nontemplated adenosine and uridine has been also reported for some cellular miRNAs, although to a more moderate extent (24). In plants, miRNAs are known to be protected at their 3' end by a methyl group added by the methyltransferase HEN1 (27). HEN1 homologues have been identified in mouse and Drosophila (21, 42), but they act on Piwi-interacting RNAs, not miRNAs. In Arabidopsis hen1 mutants, miRNAs are not protected and undergo polyuridylation followed by degradation. Similarly, we hypothesize that the polyuridylation of miR-M23-1-5p and -3p might constitute a prerequisite for their subsequent degradation, which would readily explain the reduction in clone numbers in the libraries over time. At present, it is unclear whether this process reflects a deliberate viral strategy, for instance, to fine-tune the accumulation of some of its miRNAs, or whether it represents a host-directed defense response targeted at pathogenic small RNAs. Nonetheless, this finding might shed light on a novel mechanism whereby miRNAs accumulation might be controlled in animal cells.

About 40% of all clones from the MCMV miRNA library represented a single miRNA, miR-m01-4, which is derived from a pre-miRNA located in the 3'-UTR of the m01 transcript. Additionally, miR-m01-4 accumulates to detectable levels in vivo (Fig. 4). To test whether this miRNA is dispensable for viral growth in fibroblasts, we created a knockout MCMV mutant for miR-m01-4. Despite the high abundance of miR-m01-4 in lytically infected fibroblasts, the deletion mutant grew as the wild-type virus did, even under multistep growth conditions. Previously, we created a deletion mutant involving the predicted coding regions of m01 to m16, thereby also deleting miR-m01-1, miR-m01-2, and miR-m01-3, but not miR-m01-4 (M. Popa and Z. Ruzsics, unpublished data). This virus also grew like wild-type virus on MEFs. Together with the results we obtained with the miR-m01-4 mutant, this indicates that, despite their abundance, all four miRNAs derived from the m01 transcript are dispensable for efficient MCMV replication in fibroblasts in vitro.

In a recent study, the m01 transcript was hardly detectable by microarray and reverse transcription-PCR analysis (48), and a protein product corresponding to the m01 ORF has not been identified yet. We found four pre-miRNAs to be expressed from the m01 locus with three of them (miR-m01-2, -3, and -4) clustering within 450 bp, thereby significantly interfering with the detection of the m01 transcript by PCR. Using PCR primers located just 5' of pre-miR-m01-2, we were able to detect high levels of m01 transcripts comparable to those of IE1 at 24, 48, and 72 hpi (Fig. 5D). Thus, we cannot exclude the possibility that m01 may exert functions other than solely encoding for viral miRNAs. However, the high abundance of miR-m01-4, miR-m01-2, and miR-m01-3 in MCMV-infected NIH 3T3 fibroblasts (together they contribute almost 50% of clones in our miRNA libraries) indicates that a large number of these transcripts are utilized for miRNA synthesis. This is reminiscent of observations made with other viruses, e.g., the BART transcript of EBV or the intronic cluster of miRNAs in KSHV (36, 38). The observation that the m01 transcript is so abundant in infected cells supports the finding that miR-m01-4 and the other m01-derived miRNAs were cloned so often. However, it raises the intriguing possibility that some viral miRNAs are processed nonspecifically, similar to the observation made with adenovirus virus-associated RNAs (3, 29). Thus, there could be some miRNAs expressed from the viral genome that are of little use to the virus, and some that may be more ancient and confer a significant advantage. This is illustrated by the fact that in EBV, the strain B95.8 is deleted of a large number of miRNAs (17) without being especially affected compared to a nondeleted strain. The analysis of the phenotype of our deletion mutants in vivo will help sort out the functionally important miRNAs from the others.

Two additional deletion mutants were generated and characterized in vitro; one mutant was deleted of both miR-M23-2 and miR-m21-1, due to their genomic location, and the other was deleted of miR-M44-1. Although we confirmed that these mutants readily lacked expression of the aforementioned miRNAs (Fig. 5A), their replication phenotype was not clearly affected (Fig. 5C). A slight reduction in virus titers could be observed, but we cannot rule out the possibility that this is due to perturbation of expression of the neighboring genes. The absence of a phenotype in fibroblasts in vitro does not preclude a function in vivo, as MCMV infects a number of different cell types and encounters an array of antiviral defense mechanisms. For instance, mutation of the SV40 miR-S1 had no effect on single-step virus growth but had important implications in enhancing the recognition of infected cells by cytotoxic T cells because early gene transcripts are normally rapidly cleared by the action of miR-S1 (47). Likewise, genes located in the vicinity of m01 (m02, m04, and m06) have all been implicated in interfering with the host immune response in vivo. Therefore, the biological function of this and the other MCMV miRNAs requires additional studies that should include immune response analyses. Interestingly, we observed a strong correlation of viral miRNA expression and titers of infectious virus in the livers, lungs, and spleens of infected animals at 3 and 5 days postinfection (Fig. 4). Thereby, we provide the first evidence that miRNA expression is also an important feature of productive viral infection in vivo, and the use of the mutants that we generated will prove useful to assess their role.

Few MCMV miRNAs are located in transcripts with a well-defined function. The only genes that have an assigned role are M44, which encodes a DNA binding protein, a cofactor of DNA polymerase (28); and M55, which encodes glycoprotein B (39). M23 is a member of the US22 family, but its precise function is unknown (31). In addition, none of the miRNAs identified here show significant conservation with HCMV miRNAs (16, 36), which might be explained by the fact that the two viruses are evolutionary distant. More puzzling, however, is the fact that, with one exception, their genomic localization is very different in the two viruses. Indeed, only miRNAs in the M23 region are in a region similar to HCMV miR-UL22A-1 (36). This observation agrees with previous findings that viral miRNAs are often localized in fast-evolving regions of the genome (33). The lack of conservation between sequence and location of the various miRNAs in cytomegaloviruses strongly suggests that host rather than viral genome regulatory purposes primarily drive herpesvirus miRNA evolution and function.


arrow
ACKNOWLEDGMENTS
 
We thank A. H. Buck and P. Ghazal for sharing unpublished observations while we were preparing the manuscript. We thank Bernd Raedle for his excellent technical assistance.

This work was supported by funds from CNRS and the Schlumberger Foundation for Education and Research, by the European Commission FP6 Integrated Project SIROCCO LSHG-CT-2006-037900 to S.P. and O.V., and by an NGFN grant 01GS0405 to L.D. and U.K.

All animal experiments were performed according to the institution policy and were approved under protocol 55.2-1-54-2531-75-06.

Jürgen Soutschek has competing financial interests, as in the past 4 years, he has received salary and holds stock from Alnylam (Regulus Therapeutics is a joint venture between Isis and Alnylam Pharmaceuticals), an organization that may gain or lose financially from the publication of this article, either now or in the future.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: IBMP-CNRS, 12, rue du Général Zimmer, 67084 Strasbourg Cedex, France. Phone: 33 3 88 41 72 60. Fax: 33 3 88 61 44 42. E-mail: sebastien.pfeffer{at}ibmp-ulp.u-strasbg.fr Back

{triangledown} Published ahead of print on 17 October 2007. Back

{dagger} Present address: Roche Kulmbach GmbH, Fritz-Hornschuch-Str. 9, D-95326 Kulmbach, Germany. Back

{ddagger} Present address: Regulus Therapeutics, 1896 Rutherford Road, Carlsbad, CA 92008-7208. Back


arrow
REFERENCES
 
    1
  1. Ambros, V. 2004. The functions of animal microRNAs. Nature 431:350-355.[CrossRef][Medline]
  2. 2
  3. Andersson, M. G., P. C. Haasnoot, N. Xu, S. Berenjian, B. Berkhout, and G. Akusjarvi. 2005. Suppression of RNA interference by adenovirus virus-associated RNA. J. Virol. 79:9556-9565.[Abstract/Free Full Text]
  4. 3
  5. Aparicio, O., N. Razquin, M. Zaratiegui, I. Narvaiza, and P. Fortes. 2006. Adenovirus virus-associated RNA is processed to functional interfering RNAs involved in virus production. J. Virol. 80:1376-1384.[Abstract/Free Full Text]
  6. 4
  7. Bartel, D. P. 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116:281-297.[CrossRef][Medline]
  8. 5
  9. Burnside, J., E. Bernberg, A. Anderson, C. Lu, B. C. Meyers, P. J. Green, N. Jain, G. Isaacs, and R. W. Morgan. 2006. Marek's disease virus encodes microRNAs that map to meq and the latency-associated transcript. J. Virol. 80:8778-8786.[Abstract/Free Full Text]
  10. 6
  11. Cai, X., S. Lu, Z. Zhang, C. M. Gonzalez, B. Damania, and B. R. Cullen. 2005. Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells. Proc. Natl. Acad. Sci. USA 102:5570-5575.[Abstract/Free Full Text]
  12. 7
  13. Cai, X., A. Schafer, S. Lu, J. P. Bilello, R. C. Desrosiers, R. Edwards, N. Raab-Traub, and B. R. Cullen. 2006. Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed. PLoS Pathog. 2:e23.[CrossRef][Medline]
  14. 8
  15. Cherepanov, P. P., and W. Wackernagel. 1995. Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene 158:9-14.[CrossRef][Medline]
  16. 9
  17. Cui, C., A. Griffiths, G. Li, L. M. Silva, M. F. Kramer, T. Gaasterland, X. J. Wang, and D. M. Coen. 2006. Prediction and identification of herpes simplex virus 1-encoded microRNAs. J. Virol. 80:5499-5508.[Abstract/Free Full Text]
  18. 10
  19. Cullen, B. R. 2004. Transcription and processing of human microRNA precursors. Mol. Cell 16:861-865.[CrossRef][Medline]
  20. 11
  21. DeMarchi, J. M., C. A. Schmidt, and A. S. Kaplan. 1980. Patterns of transcription of human cytomegalovirus in permissively infected cells. J. Virol. 35:277-286.[Abstract/Free Full Text]
  22. 12
  23. Du, T., and P. D. Zamore. 2005. microPrimer: the biogenesis and function of microRNA. Development 132:4645-4652.[Abstract/Free Full Text]
  24. 13
  25. Dunn, W., P. Trang, Q. Zhong, E. Yang, C. van Belle, and F. Liu. 2005. Human cytomegalovirus expresses novel microRNAs during productive viral infection. Cell. Microbiol. 7:1684-1695.[CrossRef][Medline]
  26. 14
  27. Ebeling, A., G. M. Keil, E. Knust, and U. H. Koszinowski. 1983. Molecular cloning and physical mapping of murine cytomegalovirus DNA. J. Virol. 47:421-433.[Abstract/Free Full Text]
  28. 15
  29. Filipowicz, W. 2005. RNAi: the nuts and bolts of the RISC machine. Cell 122:17-20.[CrossRef][Medline]
  30. 16
  31. Grey, F., A. Antoniewicz, E. Allen, J. Saugstad, A. McShea, J. C. Carrington, and J. Nelson. 2005. Identification and characterization of human cytomegalovirus-encoded microRNAs. J. Virol. 79:12095-12099.[Abstract/Free Full Text]
  32. 17
  33. Grundhoff, A., C. S. Sullivan, and D. Ganem. 2006. A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses. RNA 12:733-750.[Abstract/Free Full Text]
  34. 18
  35. Gupta, A., J. J. Gartner, P. Sethupathy, A. G. Hatzigeorgiou, and N. W. Fraser. 2006. Anti-apoptotic function of a microRNA encoded by the HSV-1 latency-associated transcript. Nature 442:82-85.[Medline]
  36. 19
  37. Gutermann, A., A. Bubeck, M. Wagner, U. Reusch, C. Menard, and U. H. Koszinowski. 2002. Strategies for the identification and analysis of viral immune-evasive genes—cytomegalovirus as an example. Curr. Top. Microbiol. Immunol. 269:1-22.[Medline]
  38. 20
  39. Hengel, H., U. Reusch, A. Gutermann, H. Ziegler, S. Jonjic, P. Lucin, and U. H. Koszinowski. 1999. Cytomegaloviral control of MHC class I function in the mouse. Immunol. Rev. 168:167-176.[CrossRef][Medline]
  40. 21
  41. Kirino, Y., and Z. Mourelatos. 2007. The mouse homolog of HEN1 is a potential methylase for Piwi-interacting RNAs. RNA 13:1397-1401.[Abstract/Free Full Text]
  42. 22
  43. Kloosterman, W. P., and R. H. Plasterk. 2006. The diverse functions of microRNAs in animal development and disease. Dev. Cell 11:441-450.[CrossRef][Medline]
  44. 23
  45. Lagos-Quintana, M., R. Rauhut, W. Lendeckel, and T. Tuschl. 2001. Identification of novel genes coding for small expressed RNAs. Science 294:853-858.[Abstract/Free Full Text]
  46. 24
  47. Landgraf, P., M. Rusu, R. Sheridan, A. Sewer, N. Iovino, A. Aravin, S. Pfeffer, A. Rice, A. Silva, M. Landthaler, N. D. Socci, L. Hermida, V. Fulci, J. Schliwka, U. Fuchs, A. Novosel, R. Ulrich-Müller, J. Inman, Q. Phan, M. Chien, D. B. Weir, R. Choksi, G. De Vita, H. I. Trompeter, V. Hornung, G. Teng, G. Hartmann, M. Palkovits, R. Di Lauro, P. Wernet, G. Macino, C. E. Rogler, J. J. Russo, J. Ju, F. N. Papavasiliou, T. Benzing, P. Lichter, W. Tam, M. J. Brownstein, A. Borkhardt, C. Sander, M. Zavolan, and T. Tuschl. 2007. A mammalian microRNA expression atlas based on small RNA library sequencing. Cell 129:1401-1414.[CrossRef][Medline]
  48. 25
  49. Lau, N. C., L. P. Lim, E. G. Weinstein, and D. P. Bartel. 2001. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294:858-862.[Abstract/Free Full Text]
  50. 26
  51. Lee, R. C., and V. Ambros. 2001. An extensive class of small RNAs in Caenorhabditis elegans. Science 294:862-864.[Abstract/Free Full Text]
  52. 27
  53. Li, J., Z. Yang, B. Yu, J. Liu, and X. Chen. 2005. Methylation protects miRNAs and siRNAs from a 3'-end uridylation activity in Arabidopsis. Curr. Biol. 15:1501-1507.[CrossRef][Medline]
  54. 28
  55. Loh, L. C., W. J. Britt, C. Raggo, and S. Laferte. 1994. Sequence analysis and expression of the murine cytomegalovirus phosphoprotein pp50, a homolog of the human cytomegalovirus UL44 gene product. Virology 200:413-427.[CrossRef][Medline]
  56. 29
  57. Lu, S., and B. R. Cullen. 2004. Adenovirus VA1 noncoding RNA can inhibit small interfering RNA and microRNA biogenesis. J. Virol. 78:12868-12876.[Abstract/Free Full Text]
  58. 30
  59. Meister, G., and T. Tuschl. 2004. Mechanisms of gene silencing by double-stranded RNA. Nature 431:343-349.[CrossRef][Medline]
  60. 31
  61. Ménard, C., M. Wagner, Z. Ruzsics, K. Holak, W. Brune, A. E. Campbell, and U. H. Koszinowski. 2003. Role of murine cytomegalovirus US22 gene family members in replication in macrophages. J. Virol. 77:5557-5570.[Abstract/Free Full Text]
  62. 32
  63. Mocarski, E. S., and C. T. Courcelle. 2001. Cytomegaloviruses and their replication, p. 2629-2673. In B. N. Fields, D. M. Knipe, P. M. Howley, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman, and S. E. Straus (ed.), Fields virology, 4th ed., vol. 2. Lippincott, Williams & Wilkins, Philadelphia, PA.
  64. 33
  65. Neilson, J. R., and P. A. Sharp. 2005. Herpesviruses throw a curve ball: new insights into microRNA biogenesis and evolution. Nat. Methods 2:252-254.[CrossRef][Medline]
  66. 34
  67. Omoto, S., and Y. R. Fujii. 2005. Regulation of human immunodeficiency virus 1 transcription by nef microRNA. J. Gen. Virol. 86:751-755.[Abstract/Free Full Text]
  68. 35
  69. Pfeffer, S. 2007. Identification of virally encoded microRNAs. Methods Enzymol. 427:51-63.[Medline]
  70. 36
  71. Pfeffer, S., A. Sewer, M. Lagos-Quintana, R. Sheridan, C. Sander, F. A. Grasser, L. F. van Dyk, C. K. Ho, S. Shuman, M. Chien, J. J. Russo, J. Ju, G. Randall, B. D. Lindenbach, C. M. Rice, V. Simon, D. D. Ho, M. Zavolan, and T. Tuschl. 2005. Identification of microRNAs of the herpesvirus family. Nat. Methods 2:269-276.[CrossRef][Medline]
  72. 37
  73. Pfeffer, S., and O. Voinnet. 2006. Viruses, microRNAs and cancer. Oncogene 25:6211-6219.[CrossRef][Medline]
  74. 38
  75. Pfeffer, S., M. Zavolan, F. A. Grasser, M. Chien, J. J. Russo, J. Ju, B. John, A. J. Enright, D. Marks, C. Sander, and T. Tuschl. 2004. Identification of virus-encoded microRNAs. Science 304:734-736.[Abstract/Free Full Text]
  76. 39
  77. Rapp, M., M. Messerle, B. Buhler, M. Tannheimer, G. M. Keil, and U. H. Koszinowski. 1992. Identification of the murine cytomegalovirus glycoprotein B gene and its expression by recombinant vaccinia virus. J. Virol. 66:4399-4406.[Abstract/Free Full Text]
  78. 40
  79. Reddehase, M. J., F. Weiland, K. Munch, S. Jonjic, A. Luske, and U. H. Koszinowski. 1985. Interstitial murine cytomegalovirus pneumonia after irradiation: characterization of cells that limit viral replication during established infection of the lungs. J. Virol. 55:264-273.[Abstract/Free Full Text]
  80. 41
  81. Reinhart, B. J., E. G. Weinstein, M. W. Rhoades, B. Bartel, and D. P. Bartel. 2002. MicroRNAs in plants. Genes Dev. 16:1616-1626.[Abstract/Free Full Text]
  82. 42
  83. Saito, K., Y. Sakaguchi, T. Suzuki, T. Suzuki, H. Siomi, and M. C. Siomi. 2007. Pimet, the Drosophila homolog of HEN1, mediates 2'-O-methylation of Piwi-interacting RNAs at their 3' ends. Genes Dev. 21:1603-1608.[Abstract/Free Full Text]
  84. 43
  85. Samols, M. A., J. Hu, R. L. Skalsky, and R. Renne. 2005. Cloning and identification of a microRNA cluster within the latency-associated region of Kaposi's sarcoma-associated herpesvirus. J. Virol. 79:9301-9305.[Abstract/Free Full Text]
  86. 44
  87. Schafer, A., X. Cai, J. P. Bilello, R. C. Desrosiers, and B. R. Cullen. 2007. Cloning and analysis of microRNAs encoded by the primate gamma-herpesvirus rhesus monkey rhadinovirus. Virology 364:21-27.[CrossRef][Medline]
  88. 45
  89. Seitz, H., and P. D. Zamore. 2006. Rethinking the microprocessor. Cell 125:827-829.[CrossRef][Medline]
  90. 46
  91. Stern-Ginossar, N., N. Elefant, A. Zimmermann, D. G. Wolf, N. Saleh, M. Biton, E. Horwitz, Z. Prokocimer, M. Prichard, G. Hahn, D. Goldman-Wohl, C. Greenfield, S. Yagel, H. Hengel, Y. Altuvia, H. Margalit, and O. Mandelboim. 2007. Host immune system gene targeting by a viral miRNA. Science 317:376-381.[Abstract/Free Full Text]
  92. 47
  93. Sullivan, C. S., A. T. Grundhoff, S. Tevethia, J. M. Pipas, and D. Ganem. 2005. SV40-encoded microRNAs regulate viral gene expression and reduce susceptibility to cytotoxic T cells. Nature 435:682-686.[CrossRef][Medline]
  94. 48
  95. Tang, Q., E. A. Murphy, and G. G. Maul. 2006. Experimental confirmation of global murine cytomegalovirus open reading frames by transcriptional detection and partial characterization of newly described gene products. J. Virol. 80:6873-6882.[Abstract/Free Full Text]
  96. 49
  97. Tang-Feldman, Y. J., A. Wojtowicz, G. R. Lochhead, M. A. Hale, Y. Li, and C. Pomeroy. 2006. Use of quantitative real-time PCR (qRT-PCR) to measure cytokine transcription and viral load in murine cytomegalovirus infection. J. Virol. Methods 131:122-129.[CrossRef][Medline]
  98. 50
  99. Voinnet, O. 2005. Induction and suppression of RNA silencing: insights from viral infections. Nat. Rev. Genet. 6:206-220.[CrossRef][Medline]
  100. 51
  101. Wagner, M., A. Gutermann, J. Podlech, M. J. Reddehase, and U. H. Koszinowski. 2002. Major histocompatibility complex class I allele-specific cooperative and competitive interactions between immune evasion proteins of cytomegalovirus. J. Exp. Med. 196:805-816.[Abstract/Free Full Text]
  102. 52
  103. Wagner, M., S. Jonjic, U. H. Koszinowski, and M. Messerle. 1999. Systematic excision of vector sequences from the BAC-cloned herpesvirus genome during virus reconstitution. J. Virol. 73:7056-7060.[Abstract/Free Full Text]
  104. 53
  105. Wang, X. H., R. Aliyari, W. X. Li, H. W. Li, K. Kim, R. Carthew, P. Atkinson, and S. W. Ding. 2006. RNA interference directs innate immunity against viruses in adult Drosophila. Science 312:452-454.[Abstract/Free Full Text]
  106. 54
  107. Wienholds, E., and R. H. Plasterk. 2005. MicroRNA function in animal development. FEBS Lett. 579:5911-5922.[CrossRef][Medline]
  108. 55
  109. Yao, Y., Y. Zhao, H. Xu, L. P. Smith, C. H. Lawrie, A. Sewer, M. Zavolan, and V. Nair. 2007. Marek's disease virus type 2 (MDV-2)-encoded microRNAs show no sequence conservation with those encoded by MDV-1. J. Virol. 81:7164-7170.[Abstract/Free Full Text]
  110. 56
  111. Zuker, M. 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31:3406-3415.[Abstract/Free Full Text]


Journal of Virology, December 2007, p. 13771-13782, Vol. 81, No. 24
0022-538X/07/$08.00+0     doi:10.1128/JVI.01313-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Stern-Ginossar, N., Saleh, N., Goldberg, M. D., Prichard, M., Wolf, D. G., Mandelboim, O. (2009). Analysis of Human Cytomegalovirus-Encoded MicroRNA Activity during Infection. J. Virol. 83: 10684-10693 [Abstract] [Full Text]  
  • Umbach, J. L., Cullen, B. R. (2009). The role of RNAi and microRNAs in animal virus replication and antiviral immunity. Genes Dev. 23: 1151-1164 [Abstract] [Full Text]  
  • Ghosh, Z., Mallick, B., Chakrabarti, J. (2009). Cellular versus viral microRNAs in host-virus interaction. Nucleic Acids Res 37: 1035-1048 [Abstract] [Full Text]  
  • Hussain, M., Taft, R. J., Asgari, S. (2008). An Insect Virus-Encoded MicroRNA Regulates Viral Replication. J. Virol. 82: 9164-9170 [Abstract] [Full Text]  
  • Buck, A. H., Santoyo-Lopez, J., Robertson, K. A., Kumar, D. S., Reczko, M., Ghazal, P. (2007). Discrete Clusters of Virus-Encoded MicroRNAs Are Associated with Complementary Strands of the Genome and the 7.2-Kilobase Stable Intron in Murine Cytomegalovirus. J. Virol. 81: 13761-13770 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dölken, L.
Right arrow Articles by Pfeffer, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dölken, L.
Right arrow Articles by Pfeffer, S.