This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Martínez-Sobrido, L.
Right arrow Articles by de la Torre, J. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Martínez-Sobrido, L.
Right arrow Articles by de la Torre, J. C.

 Previous Article  |  Next Article 

Journal of Virology, November 2007, p. 12696-12703, Vol. 81, No. 22
0022-538X/07/$08.00+0     doi:10.1128/JVI.00882-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Differential Inhibition of Type I Interferon Induction by Arenavirus Nucleoproteins{triangledown}

Luis Martínez-Sobrido,1,2 Panagiotis Giannakas,1,3 Beatrice Cubitt,4 Adolfo García-Sastre,1,2 and Juan Carlos de la Torre4*

Department of Microbiology,1 Emerging Pathogens Institute,2 Microbiology Graduate Training Program, Mount Sinai School of Medicine, One Gustave L. Levy Place, New York, New York 10029,3 Molecular Integrative Neuroscience Department (MIND), The Scripps Research Institute, La Jolla, California 920374

Received 24 April 2007/ Accepted 27 August 2007


arrow
ABSTRACT
 
We have documented that the nucleoprotein (NP) of the prototypic arenavirus lymphocytic choriomeningitis virus is an antagonist of the type I interferon response. In this study we tested the ability of NPs encoded by representative arenavirus species from both Old World and New World antigenic groups to inhibit production of interferon. We found that, with the exception of Tacaribe virus (TCRV), all NPs tested inhibited activation of beta interferon and interferon regulatory factor 3 (IRF-3)-dependent promoters, as well as the nuclear translocation of IRF-3. Consistent with this observation, TCRV-infected cells also failed to inhibit interferon production.


arrow
TEXT
 
The family Arenaviridae consists of 1 unique genus (Arenavirus) that contains more than 20 recognized virus species (8), which are classified into 2 distinct groups: Old World (OW) and New World (NW) arenaviruses. This classification was originally established based on serological cross-reactivity, but it is well supported by recent sequence-based phylogenetic studies. Genetically, OW arenaviruses constitute a single lineage, while NW arenaviruses segregate into clades A, B, and C (8).

Arenaviruses cause chronic infections of rodents with a worldwide distribution. Each arenavirus species is associated mainly with a particular rodent host species, except for the NW Tacaribe virus (TCRV), which has been isolated only from fruit-eating bats in Trinidad (9). Asymptomatically infected rodents move freely in their natural habitat and may invade human dwellings. Humans are most likely infected through mucosal exposure to aerosols or by direct contact between infectious materials and abraded skin. Arenavirus infections of humans are common and in some cases are associated with severe disease. Thus, the OW Lassa virus (LASV) and several NW South America arenaviruses cause hemorrhagic fever (HF) disease in humans, which represents a serious public health problem (8, 19, 30). Moreover, evidence indicates that the prototypic arenavirus lymphocytic choriomeningitis virus (LCMV) might be a neglected human pathogen of clinical significance (2-4, 20). Notably, transplant-associated infections by LCMV with a fatal outcome have been recently documented in the United States (11, 31).

The viral genetic determinants contributing to pathogenesis in humans associated with some arenavirus infections remain largely unknown. We have shown that LCMV inhibits type I interferon (alpha/beta interferon [IFN-{alpha}/ß]) production in response to different stimuli, and this inhibition is caused by an early blockade in the IFN regulatory factor 3 (IRF-3) activation pathway (18). The transcription factor IRF-3 is present in an inactive state in the cytoplasm, but in response to specific stimuli, including viral infection, IRF-3 is activated via hyperphosphorylation of its carboxy-terminal domain. Hyperphosphorylation of IRF-3 is thought to induce IRF-3 dimerization and its subsequent nuclear accumulation, resulting, via interaction with CBP/p300, in transcriptional activation (16, 22). Some of the IRF-3-induced genes, including type I IFN genes, play a central role in the innate immune response constituting one of the host's first lines of defense against microbial infections. Notably, a variety of RNA and DNA viruses express gene products capable of blocking IRF-3 activation, inhibiting production of IFN-{alpha}/ß during viral infection (14). We have identified the LCMV nucleoprotein (NP) as the first known viral IFN antagonist protein in arenaviruses (18). This finding led us to investigate whether the ability of the LCMV NP to counteract the IFN-{alpha}/ß response is conserved among different arenaviruses. To address this question, we examined the abilities of the NPs of different arenaviruses, including the OW LASV, as well as representative members of the three existing NW arenavirus lineages to inhibit IFN-{alpha} induction.

For these studies, we used reverse transcription-PCR (RT-PCR) procedures and RNA from infected cells to generate full-length cDNAs of the NPs from the two OW arenaviruses (LASV and LCMV) and NW arenaviruses from clade A (Whitewater Arroyo virus [WWAV] and Pichinde virus [PICV]), clade B (Junin virus [JUNV], Machupo virus [MACV], and TCRV), and clade C (Latino virus). To facilitate the detection of the different NPs using the same antibody reagent, we cloned the corresponding NP cDNAs into a pCAGGs expression plasmid that incorporated a hemagglutinin (HA) tag at the C terminus of the cloned cDNA (25). LCMV NP tagged at its C terminus with an HA epitope retains wild-type NP activity with respect to its anti-IFN-{alpha}/ß production and ability to support replication and expression of an LCMV minigenome (data not shown).

To examine the ability of these arenaviral NP-HA proteins to block IRF-3 activation and counteract the IFN-{alpha}/ß response, we monitored the effects of NP expression on nuclear translocation and transcriptional activity of IRF-3, including activation of the beta IFN (IFN-ß) promoter, in response to Sendai virus (SeV) infection (6).

To determine the effect of the different arenaviral NPs in SeV-induced nuclear accumulation of IRF-3, we transfected Vero cells with pEGFP-C1 IRF-3 (5), together with a plasmid encoding the indicated arenavirus NP (Fig. 1). At 24 h posttransfection, cells were infected with SeV, and 16 h later we determined the subcellular localization of IRF-3 (green) and NP (red) using fluorescence microscopy. Expression of the different NP (red) correlated with inhibition of nuclear accumulation of IRF-3 (green), while nuclear accumulation of IRF-3 was readily detected in cells with undetectable levels of NP expression (Fig. 1). A notable exception was observed with TCRV NP, whose expression did not interfere with SeV-induced nuclear accumulation of IRF-3 (Fig. 1). Cells transfected with TCRV NP and the other arenaviral NPs were similarly susceptible to SeV infection (not shown), indicating that differences among arenavirus NPs in their ability to prevent nuclear accumulation of IRF-3 could not be explained based on differences in the magnitude of the stimulus provided by SeV infection.


Figure 1
View larger version (45K):
[in this window]
[in a new window]

 
FIG. 1. NPs of LCMV, LASV, WWAV, PICV, JUNV, and MACV but not of TCRV inhibited nuclear translocation of IRF-3. Vero cells were cotransfected with a GFP-tagged IRF-3 expression plasmid (green) together with the indicated HA-tagged arenavirus NP expression plasmid (red). Twenty-four hours posttransfection, cells were infected with SeV, and at 16 h postinfection, the subcellular localization of IRF-3 was assessed based on GFP fluorescence. As a control, cells were also transfected with an expression plasmid encoding influenza A NS1 (FLU NS1), which is known to inhibit IRF-3 nuclear translocation. NP expression was determined by IF using a polyclonal antibody to HA. Nuclear localization of GFP-tagged IRF-3 was mainly restricted to cells lacking detectable NP expression levels (arrowheads).

We next examined whether the NP-mediated inhibition of IRF-3 nuclear accumulation correlated with decreased levels of IRF-3 transcriptional activation. For this we cotransfected 293T cells with increasing amounts (50, 250, 500, and 2,000 ng) of plasmids expressing the different arenavirus NPs together with 0.5 µg of pIFNß-GFP/CAT (21), p55C1B-FF (35), and 0.1 µg of a Renilla luciferase expression plasmid under a simian virus 40 promoter to normalize transfection efficiencies (Fig. 2). We used a CaPO4-based transfection protocol to prevent IFN-{alpha} production and a subsequent antiviral state frequently associated with liposome-based transfection protocols (17). At 24 h posttransfection, cells were infected with SeV (multiplicity of infection [MOI] = 2), and at 24 h postinfection, we prepared cell lysates for firefly luciferase (IRF-3-dependent promoter 55C1B) (Fig. 2A) and CAT (IFN-ß promoter) (Fig. 2B) assays, as well as for NP detection by Western blotting (Fig. 2C). We used an empty pCAGGs expression plasmid (26) as a negative control. Consistent with our previous findings, expression of LCMV NP blocked the activation of both IFN-ß and IRF-3-dependent promoters (18). Notably, with the exception of TCRV NP, all arenavirus NPs tested inhibited similarly and very significantly the activation of these two promoters, using as little as 50 ng of the corresponding NP-expressing plasmid in the transfection assay. In contrast, similar levels of inhibition of promoter activation by TCRV NP were observed only when we used 40-fold-higher amounts (2,000 ng) of the TCRV NP-expressing plasmid in the transfection assay. All NPs, including TCRV NP, could be expressed at similar levels, but we observed some variability in terms of the relationship between the amount of DNA used in the transfection and levels of NP expression as determined by Western blotting (Fig. 2C). This finding indicated that the failure of TCRV NP to inhibit these promoters was not due to a defect in TCRV NP synthesis. We cannot formally rule out the possibility that the presence of the HA tag affected the activity of the TCRV NP and thereby its ability to counteract the type I IFN response in transfected cells. This, however, seems to be highly unlikely considering that the LCMV NP tagged in the same way was not affected in its ability to promote virus RNA replication and transcription and formation of infectious virus particles.


Figure 2
View larger version (35K):
[in this window]
[in a new window]

 
FIG. 2. NPs of LCMV, LASV, WWAV, PICV, JUNV, and MACV but not of TCRV inhibited SeV-mediated activation of IRF-3-dependent and IFN-ß promoters. 293T cells were cotransfected with 0.5 µg of an IRF-3-dependent (p55C1B-FF luciferase) (A) or an IFN-ß (IFN-ß GFP-CAT) (B) promoter expression plasmid together with the indicated amounts of arenavirus NP expression constructs and 0.1 µg of a simian virus 40-Renilla expression vector to normalize transfection efficiencies. Twenty-four hours posttransfection, cells were infected with SeV (MOI = 2), and 16 h later, cell lysates were prepared to measure activation of the promoters. E, pCAGGS (pC) empty plasmid-transfected cells mock infected (–) or infected with SeV (+). Expression levels of the different arenavirus NPs were detected by Western blotting using a polyclonal rabbit serum for HA (C).

We next determined whether the inability of TCRV NP to inhibit the transcriptional activity of IRF-3 and therefore production of IFN-ß in transfection-based assays correlated with the situation found in TCRV-infected cells. For this we employed a previously described IFN bioassay (18). This assay is based on assessing the effect of Lipofectamine (LF)-based DNA transfection on replication in human A549 cells of a recombinant Newcastle disease virus (NDV) expressing a green fluorescence protein (rNDV-GFP). The rationale for this assay is that the robust type I IFN response induced by liposome-based DNA transfection (29) inhibits replication of rNDV-GFP because of its high susceptibility to type I IFN (18). This inhibitory effect, however, can be prevented if the transfected cells are expressing a viral IFN-counteracting protein, such as the NS1 protein of influenza virus (21) or the NP of LCMV (18).

We first verified that A549 cells could support TCRV infection. For this, we infected A549 cells with TCRV (MOI = 2), and at 72 h postinfection we examined the cells for viral antigen expression by using immunofluorescence (IF) and the presence of replicating infectious TCRV by using an infectious center assay. The majority of cells in the TCRV-infected A549 cell population expressed detectable levels of viral antigen and harbored infectious TCRV (Fig. 3A). We then compared levels of rNDV-GFP replication between TCRV- and LCMV-infected A549 cells that had been transfected with LF/DNA 20 h prior infection with rNDV-GFP. Consistent with our previous findings, both nontransfected and transfected LCMV-infected cells supported similarly high levels of NDV-GFP replication relative to those for uninfected and no-transfection A549 cells (Fig. 3B). In contrast, TCRV-infected cells, both nontransfected or transfected, exhibited a very significant inhibition of rNDV-GFP replication. These findings suggested that induction of IFN-{alpha} in response to LF/DNA transfection was not blocked in TCRV-infected cells, a finding consistent with the lack of inhibition of IFN-ß promoter activation by the NP of TCRV. Moreover, TCRV-infected cells appeared to exhibit an antiviral state that interfered with NDV multiplication. The antiviral state observed in TCRV-infected A549 cells was likely mediated mainly, or solely, by IFN based on the observation that uninfected and TCRV-infected Vero cells, which are unable to produce IFN (23), were equally susceptible to infection by rNDV-GFP (Fig. 3D). The results described above led us to hypothesize that IFN-{alpha}/ß production was not impaired in TCRV-infected cells, and we therefore predicted that tissue culture supernatants (TCS) from TCRV-infected cells would contain levels of IFN-{alpha}/ß capable of inducing an antiviral stage in A549 cells. To test this possibility, we treated Vero cells with TCS that had been previously subjected to UV treatment to inactivate TCRV, and 24 h later we examined the susceptibility of these cells to infection by vesicular stomatitis virus (VSV) expressing GFP (rVSV-GFP), a virus known to be highly susceptible to type I IFN (33). Consistent with our previous observations, Vero cells treated with TCS from LCMV-infected A549 cells, either nontransfected or LF/DNA transfected, allowed replication of rVSV-GFP (Fig. 3C). In contrast, Vero cells treated with TCS from TCRV-infected A549 cells, either nontransfected or LF/DNA transfected, did not allow replication of the IFN-sensitive rVSV-GFP (Fig. 3C), suggesting the presence of type I IFN in these TCS. These data further supported the view that TCRV NP and TCRV infection lack the ability to counteract the induction of IFN. To further support this conclusion, we compared LCMV- and TCRV-infected cells with respect to levels of SeV-induced nuclear translocation of IRF-3 and levels of IFN-ß and IFN-stimulated gene (ISG) mRNAs upon stimulation by LF/DNA transfection. Consistent with our previous findings (18), we observed that SeV-induced nuclear translocation of IRF-3 was inhibited in LCMV-infected cells. In contrast, mock- and TCRV-infected cells exhibited similar levels of IRF-3 nuclear translocation upon SeV infection (Fig. 4A). Furthermore, we were able to detect nuclear translocation of the GFP-tagged transcription factor in TCRV-infected cells in the absence of SeV infection. Likewise, as we previously reported (18), infection with LCMV inhibited induction of IFN-ß and ISG mRNAs characteristically observed in A549 cells upon transfection with LF/DNA (Fig. 4Bi). In contrast, LF/DNA transfection of TCRV-infected cells resulted in increased levels of IFN-ß and ISGs of similar magnitude to those observed in transfected mock-infected cells (Fig. 4Bi). Moreover, TCRV-infected cells induce IFN-ß and ISG mRNAs in the absence of LF/DNA transfection. RT-PCR analysis confirmed the presence of LCMV and TCRV NP sequences in the corresponding infected cells (Fig. 4Bii).


Figure 3
View larger version (73K):
[in this window]
[in a new window]

 
FIG. 3. Induction of type I IFN is not inhibited in TCRV-infected A549 cells. (A) A549 cells are susceptible to TCRV infection. A549 cells were infected with either LCMV or TCRV at a MOI of 2, and 72 h later, cells were examined for expression of viral antigen and cell-associated infectious virus by IF and infectious center (IC) assays, respectively. (i) Detection of viral antigen by IF was done using monoclonal antibody (Ab {alpha} virus) to either LCMV NP or TCRV glycoprotein (GP). (ii) Percentages of cells expressing viral antigen (Ag+) and harboring infectious virus as determined by IF and IC assay, respectively. The percentage of IC was determined as described previously (10). (B) Uninfected A549 cells or A549 cells infected with either LCMV or TCRV were mock transfected or transfected with 2 µg of empty pC plasmid (Tx) (5). Twenty-four hours posttransfection, cells were infected with rNDV-GFP (MOI = 2), and at 24 h postinfection, GFP expression was assessed. (C) Vero cells were treated (12 h) with TCS from uninfected A549 cells or A549 cells infected with either LCMV or TCRV and mock transfected or transfected with empty plasmid (Tx). Prior to being used to treat Vero cells, TCS were subjected to UV treatment to inactivate infectious LCMV and TCRV. Virus inactivation was verified by using UV-treated TCS in virus titration assays (data not shown). TCS-treated Vero cells were infected with rVSV-GFP (MOI = 2) and the percentage of GFP-positive cells determined at 20 h postinfection. Treatment with human IFN-ß (huIFNß) (500, 100, and 20 IU/ml) was used as a control. (D) TCRV- and mock-infected Vero cells are equally susceptible to rNDV-GFP. Vero cells were mock infected, infected with TCRV (MOI = 2) or rNDV-GFP (MOI = 2), or infected first with TCRV and 24 h later with rNDV-GFP, both at a MOI of 2. At 72 h postinfection, TCRV-infected cells were fixed and examined by IF using a monoclonal antibody to TCRV GP and an anti-mouse immunoglobulin G conjugated to Alexa 568 to detect TCRV-infected cells (red), while expression of GFP (green) revealed rNDV-GFP-infected cells.


Figure 4
View larger version (34K):
[in this window]
[in a new window]

 
FIG. 4. SeV-induced nuclear translocation of IRF-3 and transfection-mediated induction of type I IFN and ISG mRNAs are not inhibited in TCRV-infected cells. (A) LCMV- and TCRV-infected Vero cells, as well as mock-infected controls, were transfected with GFP-IRF3 and 24 h later infected, or not, with SeV. At 16 h post-infection with SeV, we examined the subcellular distribution of GFP-IRF3. (Bi) LCMV- and TCRV-infected A549 cells, as well as mock-infected controls, were transfected, or not, with LF/DNA and 20 h later total cellular RNA isolated and analyzed by RT-quantitative PCR to assess mRNA levels for IFN-ß, RANTES, MxA, RIG-I, MDA5, and ISG54 as described previously (18). (Bii) Detection of LCMV and TCRV NP sequences in LCMV- and TCRV-infected cells, respectively. RNA from the same samples as for panel Bi was used for RT-PCR with specific primers for either LCMV (AATTGAATTCACCATGTCCTTGTCTAAGGAAGTTAAG, LCMV/EcoRI/5', and AATTGGTACCTTGAGTGTCACAACATTTGGGCCTCT, LCMV/KpnI/3') or TCRV (AATTGAATTCACCATGGCTCAATCCAAGGAAGTGCCA, TCRV/EcoRI/5', and AATTCCCGGGCAGTGCAAAAGCTGTTTTGGG, TCRV/SmaI/3').

Arenaviruses merit significant attention both as tractable model systems for studying acute and persistent viral infections (27, 36) and as clinically important human pathogens, including several causative agents of severe HF, chiefly LASV, the causative agent of Lassa fever (7, 13, 19).

Individuals succumbing to Lassa fever generate only minimal or no anti-LASV immune responses (19). Moreover, histological examination of Lassa fever patients shows surprisingly little cellular damage and only a modest or negligible infiltration of inflammatory cells (34). These findings support the view that morbidity and lethality associated with LASV, and likely other HF arenavirus infections, is due to the host's inability to mount an effective antiviral immune response. Consistent with this view, the extent of viremia is a highly predictive factor for the outcome of LASV infection (19). The mechanisms by which LASV and other arenaviruses overcome the initial host defense response remain little understood, but evidence suggests that virally mediated impairment of dendritic cell function and altered innate immunity are contributing factors (1, 28). In this regard, counteracting the type I IFN response has been described as an important determinant for viral pathogenesis, which is reflected in the attenuated phenotype exhibited, in both cell culture and whole organisms, by viruses with altered IFN antagonist proteins (14).

Among the arenavirus NP proteins we examined, only the one from TCRV was unable to inhibit efficiently IFN-{alpha}/ß induction. Phylogenetically, TCRV belongs to clade B of NW arenaviruses, which also contains several HF arenaviruses, including JUNV and MACV, whose NPs were able to counteract IFN-ß induction. Due to the requirement of BSL4 conditions, we could not determine whether this induction was also impaired in MACV- or JUNV-infected cells. The differences between TCRV and the HF MACV and JUNV regarding the inhibitory properties of their respective NPs on the type I IFN system would suggest a possible correlation with the virus pathogenic potential. However, PICV NP was able to interfere with the induction of type I IFN while remaining nonpathogenic for nonhuman primates. Moreover, several laboratory-related infections of humans have been documented without any associated clinical symptoms (30). As with the situation encountered with many other viruses, arenavirus virulence is likely to be a polygenic trait. Therefore, the ability of the viral NP to interfere with induction of the type I IFN system may be a necessary but not sufficient factor in arenavirus virulence. Arenaviruses are maintained in their natural reservoirs mainly as long-term chronic infections characterized by relatively high levels of virus replication in most organs. It is therefore plausible that an IFN-counteracting activity associated with the virus NP could help to prevent high levels of IFN-{alpha}/ß, expected to be triggered by an active virus replication, which could have deleterious effects on the host physiology. In this respect, TCRV appears to represent a unique case in arenavirus epidemiology because it was not isolated from a rodent species but rather from fruit-eating bats in Trinidad in the late 1950s (9), but the actual natural reservoir and host range of TCRV remain a subject of debate. In contrast to other arenaviruses, TCRV does not appear to be capable of establishing persistence in rodents. Whether the reduced ability of TCRV NP to counteract induction of type I IFN contributes to this feature remains to be determined. The biological implications of the widely shared property among arenavirus NPs of counteracting the IFN-{alpha} response and the mechanisms underlying the NP's ability to counteract the induction of type I IFN warrant further investigation.

A recent report has documented that LASV or LCMV infection of FrhK-4 and Huh-7 cells does not cause increased levels of IFN-ß mRNA compared to results with mock-infected cells (24), a finding consistent with our reporter gene expression results in LASV NP-transfected cells (Fig. 2). However, increased levels of IFN-ß mRNA were observed in LASV-infected Huh-7 cells upon transfection with poly(I:C) (24). These apparently contradictory findings could reflect that production of type I IFN in poly(I:C)-transfected cells may be mediated by a cellular sensor (such as RIG-I or MDA-5) whose activity is not blocked by LASV NP. Evidence indicates that RIG-I and MDA-5 recognize different types of RNA viruses (15). Whether arenavirus NPs inhibit induction of type I IFN mediated by cytoplasmic helicases in infected cells remains to be determined. However, since arenavirus NP inhibit Sendai virus-mediated induction of IRF-3 (Fig. 1), which is known to be dependent of RIG-I (15), our results would favor the hypothesis that arenaviral NPs inhibit the induction of IFN {alpha} mediated by RIG-I.

The ability to rescue infectious LCMV entirely from cloned cDNAs (12, 32) should permit the generation of recombinant LCMV carrying NPs with mutations affecting its anti-IFN function. The biological characterization of these recombinant viruses in their natural host, the mouse, should help to determine whether the NP-mediated inhibition of type I IFN influences the manifestations of the infection, including its virulence.


arrow
ACKNOWLEDGMENTS
 
We thank R. Cadagan for excellent technical support and T. Fujita for the p55C1B-FF plasmid.

This work was partly supported by Department of Defense grant W81XWH-07-2-0028, by CIVIA, an NIAID-funded Center to Investigate Virus Immunity and Antagonism grant (U19 AI62623) to A.G.-S., and by NIH grant AI47140 to J.C.D.L.T.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Molecular Integrative Neuroscience Department, The Scripps Research Institute, La Jolla, California 92037. Phone: (858) 784-9462. Fax: (858) 784-9981. E-mail: juanct{at}scripps.edu Back

{triangledown} Published ahead of print on 5 September 2007. Back


arrow
REFERENCES
 
    1
  1. Baize, S., D. Pannetier, C. Faure, P. Marianneau, I. Marendat, M. C. Georges-Courbot, and V. Deubel. 2006. Role of interferons in the control of Lassa virus replication in human dendritic cells and macrophages. Microbes Infect. 8:1194-1202.[CrossRef][Medline]
  2. 2
  3. Barton, L. L., and M. B. Mets. 2001. Congenital lymphocytic choriomeningitis virus infection: decade of rediscovery. Clin. Infect. Dis. 33:370-374.[CrossRef][Medline]
  4. 3
  5. Barton, L. L., and M. B. Mets. 1999. Lymphocytic choriomeningitis virus: pediatric pathogen and fetal teratogen. Pediatr. Infect. Dis. J. 18:540-541.[CrossRef][Medline]
  6. 4
  7. Barton, L. L., M. B. Mets, and C. L. Beauchamp. 2002. Lymphocytic choriomeningitis virus: emerging fetal teratogen. Am. J. Obstet. Gynecol. 187:1715-1716.[CrossRef][Medline]
  8. 5
  9. Basler, C. F., A. Mikulasova, L. Martinez-Sobrido, J. Paragas, E. Muhlberger, M. Bray, H. D. Klenk, P. Palese, and A. Garcia-Sastre. 2003. The Ebola virus VP35 protein inhibits activation of interferon regulatory factor 3. J. Virol. 77:7945-7956.[Abstract/Free Full Text]
  10. 6
  11. Basler, C. F., X. Wang, E. Muhlberger, V. Volchkov, J. Paragas, H. D. Klenk, A. Garcia-Sastre, and P. Palese. 2000. The Ebola virus VP35 protein functions as a type I IFN antagonist. Proc. Natl. Acad. Sci. USA 97:12289-12294.[Abstract/Free Full Text]
  12. 7
  13. Bray, M. 2005. Pathogenesis of viral hemorrhagic fever. Curr. Opin. Immunol. 17:399-403.[CrossRef][Medline]
  14. 8
  15. Buchmeier, M. J., C. J. Peters, and J. C. de la Torre. 2007. Arenaviridae: the viruses and their replication, p. 1792-1827. In D. M. Knipe and P. M. Holey (ed.), Fields virology, 5th ed., vol. 2. Lippincott Williams & Wilkins, Philadelphia, PA.
  16. 9
  17. Downs, W., C. R. Anderson, L. Spence, T. Aitken, and A. H. Greenhal. 1963. Tacaribe virus, a new agent isolated from Artibeus bats and mosquitos in Trinidad, West Indies. Am. J. Trop. Med. Hyg. 12:640-646.[Abstract/Free Full Text]
  18. 10
  19. Doyle, M. V., and M. B. Oldstone. 1978. Interactions between viruses and lymphocytes. I. In vivo replication of lymphocytic choriomeningitis virus in mononuclear cells during both chronic and acute viral infections. J. Immunol. 121:1262-1269.[Abstract/Free Full Text]
  20. 11
  21. Fischer, S. A., M. B. Graham, M. J. Kuehnert, C. N. Kotton, A. Srinivasan, F. M. Marty, J. A. Comer, J. Guarner, C. D. Paddock, D. L. DeMeo, W. J. Shieh, B. R. Erickson, U. Bandy, A. DeMaria, Jr., J. P. Davis, F. L. Delmonico, B. Pavlin, A. Likos, M. J. Vincent, T. K. Sealy, C. S. Goldsmith, D. B. Jernigan, P. E. Rollin, M. M. Packard, M. Patel, C. Rowland, R. F. Helfand, S. T. Nichol, J. A. Fishman, T. Ksiazek, and S. R. Zaki. 2006. Transmission of lymphocytic choriomeningitis virus by organ transplantation. N. Engl. J. Med. 354:2235-2249.[Abstract/Free Full Text]
  22. 12
  23. Flatz, L., A. Bergthaler, J. C. de la Torre, and D. D. Pinschewer. 2006. Recovery of an arenavirus entirely from RNA polymerase I/II-driven cDNA. Proc. Natl. Acad. Sci. USA 103:4663-4668.[Abstract/Free Full Text]
  24. 13
  25. Geisbert, T. W., and P. B. Jahrling. 2004. Exotic emerging viral diseases: progress and challenges. Nat. Med. 10:S110-S121.[CrossRef][Medline]
  26. 14
  27. Haller, O., G. Kochs, and F. Weber. 2006. The interferon response circuit: induction and suppression by pathogenic viruses. Virology 344:119-130.[CrossRef][Medline]
  28. 15
  29. Kato, H., O. Takeuchi, S. Sato, M. Yoneyama, M. Yamamoto, K. Matsui, S. Uematsu, A. Jung, T. Kawai, K. J. Ishii, O. Yamaguchi, K. Otsu, T. Tsujimura, C. S. Koh, C. Reis e Sousa, Y. Matsuura, T. Fujita, and S. Akira. 2006. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 441:101-105.[CrossRef][Medline]
  30. 16
  31. Lin, R., C. Heylbroeck, P. M. Pitha, and J. Hiscott. 1998. Virus-dependent phosphorylation of the IRF-3 transcription factor regulates nuclear translocation, transactivation potential, and proteasome-mediated degradation. Mol. Cell. Biol. 18:2986-2996.[Abstract/Free Full Text]
  32. 17
  33. Martinez-Sobrido, L., and A. Garcia-Sastre. Virus complementation assays to identify interferon antagonists. In R. O. Donis and J. M. Katz (ed.), Viral immunity: methods and protocols, in press. Humana Press, Totowa, NJ.
  34. 18
  35. Martinez-Sobrido, L., E. I. Zuniga, D. Rosario, A. Garcia-Sastre, and J. C. de la Torre. 2006. Inhibition of the type I interferon response by the nucleoprotein of the prototypic arenavirus lymphocytic choriomeningitis virus. J. Virol. 80:9192-9199.[Abstract/Free Full Text]
  36. 19
  37. McCormick, J. B., and S. P. Fisher-Hoch. 2002. Lassa fever, p. 75-110. In M. B. Oldstone (ed.), Arenaviruses I, vol. 262. Springer-Verlag, Berlin, Germany.
  38. 20
  39. Mets, M. B., L. L. Barton, A. S. Khan, and T. G. Ksiazek. 2000. Lymphocytic choriomeningitis virus: an underdiagnosed cause of congenital chorioretinitis. Am. J. Ophthalmol. 130:209-215.[CrossRef][Medline]
  40. 21
  41. Mibayashi, M., L. Martinez-Sobrido, Y. M. Loo, W. B. Cardenas, M. Gale, Jr., and A. Garcia-Sastre. 2007. Inhibition of retinoic acid-inducible gene I-mediated induction of beta interferon by the NS1 protein of influenza A virus. J. Virol. 81:514-524.[Abstract/Free Full Text]
  42. 22
  43. Mori, M., M. Yoneyama, T. Ito, K. Takahashi, F. Inagaki, and T. Fujita. 2004. Identification of Ser-386 of interferon regulatory factor 3 as critical target for inducible phosphorylation that determines activation. J. Biol. Chem. 279:9698-9702.[Abstract/Free Full Text]
  44. 23
  45. Mosca, J. D., and P. M. Pitha. 1986. Transcriptional and posttranscriptional regulation of exogenous human beta interferon gene in simian cells defective in interferon synthesis. Mol. Cell. Biol. 6:2279-2283.[Abstract/Free Full Text]
  46. 24
  47. Muller, S., R. Geffers, and S. Gunther. 2007. Analysis of gene expression in Lassa virus-infected HuH-7 cells. J. Gen. Virol. 88:1568-1575.[Abstract/Free Full Text]
  48. 25
  49. Munoz-Jordan, J. L., M. Laurent-Rolle, J. Ashour, L. Martinez-Sobrido, M. Ashok, W. I. Lipkin, and A. Garcia-Sastre. 2005. Inhibition of alpha/beta interferon signaling by the NS4B protein of flaviviruses. J. Virol. 79:8004-8013.[Abstract/Free Full Text]
  50. 26
  51. Niwa, H., K. Yamamura, and J. Miyazaki. 1991. Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108:193-199.[CrossRef][Medline]
  52. 27
  53. Oldstone, M. B. 2002. Biology and pathogenesis of lymphocytic choriomeningitis virus infection, p. 83-118. In M. B. Oldstone (ed.), Arenaviruses, vol. 263. Springer-Verlag, Berlin, Germany.
  54. 28
  55. Pannetier, D., C. Faure, M. C. Georges-Courbot, V. Deubel, and S. Baize. 2004. Human macrophages, but not dendritic cells, are activated and produce alpha/beta interferons in response to Mopeia virus infection. J. Virol. 78:10516-10524.[Abstract/Free Full Text]
  56. 29
  57. Park, M. S., M. L. Shaw, J. Munoz-Jordan, J. F. Cros, T. Nakaya, N. Bouvier, P. Palese, A. Garcia-Sastre, and C. F. Basler. 2003. Newcastle disease virus (NDV)-based assay demonstrates interferon-antagonist activity for the NDV V protein and the Nipah virus V, W, and C proteins. J. Virol. 77:1501-1511.[CrossRef][Medline]
  58. 30
  59. Peters, C. J. 2002. Human infection with arenaviruses in the Americas, p. 65-74. In M. B. Oldstone (ed.), Arenaviruses I, vol. 262. Springer-Verlag, Berlin, Germany.
  60. 31
  61. Peters, C. J. 2006. Lymphocytic choriomeningitis virus—an old enemy up to new tricks. N. Engl. J. Med. 354:2208-2211.[Free Full Text]
  62. 32
  63. Sanchez, A. B., and J. C. de la Torre. 2006. Rescue of the prototypic arenavirus LCMV entirely from plasmid. Virology 350:370-380.[CrossRef][Medline]
  64. 33
  65. Stojdl, D. F., B. D. Lichty, B. R. tenOever, J. M. Paterson, A. T. Power, S. Knowles, R. Marius, J. Reynard, L. Poliquin, H. Atkins, E. G. Brown, R. K. Durbin, J. E. Durbin, J. Hiscott, and J. C. Bell. 2003. VSV strains with defects in their ability to shutdown innate immunity are potent systemic anti-cancer agents. Cancer Cell 4:263-275.[CrossRef][Medline]
  66. 34
  67. Walker, D. H., J. B. McCormick, K. M. Johnson, P. A. Webb, G. Komba-Kono, L. H. Elliott, and J. J. Gardner. 1982. Pathologic and virologic study of fatal Lassa fever in man. Am. J. Pathol. 107:349-356.[Abstract]
  68. 35
  69. Yoneyama, M., and T. Fujita. 2004. RIG-I: critical regulator for virus-induced innate immunity. Tanpakushitsu Kakusan Koso. 49:2571-2578.[Medline]
  70. 36
  71. Zinkernagel, R. M. 2002. Lymphocytic choriomeningitis virus and immunology. Curr. Top. Microbiol. Immunol. 263:1-5.[Medline]


Journal of Virology, November 2007, p. 12696-12703, Vol. 81, No. 22
0022-538X/07/$08.00+0     doi:10.1128/JVI.00882-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Lee, L. N., Burke, S., Montoya, M., Borrow, P. (2009). Multiple Mechanisms Contribute to Impairment of Type 1 Interferon Production during Chronic Lymphocytic Choriomeningitis Virus Infection of Mice. J. Immunol. 182: 7178-7189 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Martínez-Sobrido, L.
Right arrow Articles by de la Torre, J. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Martínez-Sobrido, L.
Right arrow Articles by de la Torre, J. C.