This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yu, X. G.
Right arrow Articles by Walker, B. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yu, X. G.
Right arrow Articles by Walker, B. D.

 Previous Article  |  Next Article 

Journal of Virology, November 2007, p. 12666-12669, Vol. 81, No. 22
0022-538X/07/$08.00+0     doi:10.1128/JVI.01450-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Random T-Cell Receptor Recruitment in Human Immunodeficiency Virus Type 1 (HIV-1)-Specific CD8+ T Cells from Genetically Identical Twins Infected with the Same HIV-1 Strain{triangledown}

Xu G. Yu,1 Mathias Lichterfeld,1 Katie L. Williams,1 Javier Martinez-Picado,2,3 and Bruce D. Walker1,4*

Partners AIDS Research Center, Massachusetts General Hospital and Harvard University Center for AIDS Research, Boston, Massachusetts,1 Fundació irsiCaixa, Hospital Universitari Germans Trias i Pujol, Barcelona, Spain,2 Institució Catalana de Recerca i Estudis Avançats (ICREA), Barcelona, Spain,3 Howard Hughes Medical Institute, Chevy Chase, Maryland4

Received 3 July 2007/ Accepted 20 August 2007


arrow
ABSTRACT
 
Human immunodeficiency virus type 1 (HIV-1) cytotoxic T-lymphocyte escape mutations represent both a major reason for loss of HIV immune control and a considerable challenge for HIV-1 vaccine design. Previous data suggest that initial HIV-1-specific CD8+ T-cell responses are determined largely by viral and host genetics, but the mechanisms influencing the subsequent viral evolution are unclear. Here, we show a random recruitment of T-cell receptor (TCR) alpha and beta clonotypes of the initial HIV-1-specific CD8+ T cells during primary infection in two genetically identical twins infected simultaneously with the same virus, suggesting that stochastic TCR recruitment of HIV-1-specific CD8+ T cells contributes to the diverse and unpredictable HIV-1 sequence evolution.


arrow
TEXT
 
Human immunodeficiency virus type 1 (HIV-1) can use its extraordinary genetic plasticity to evade HIV-1-specific immune recognition by amino acid substitutions in targeted CD8+ T-cell epitopes (2); however, the mechanisms that guide HIV-1 mutational escape and determine HIV sequence evolution are not well defined. To address this, a recent study longitudinally analyzed HIV-1-specific B- and T-cell immune responses as well as HIV sequence evolution in two genetically identical twins (twin 1 and twin 2) who were infected simultaneously (by intravenous drug abuse with needle sharing) with the same HIV-1 viral strain (1). These investigations revealed a surprisingly strong correlation in the magnitude, specificity, and immunodominance patterns of HIV-1-specific CD8+ T cells that were mounted during primary infection in these two individuals and thus suggested that host and viral genetics represent the primary determinants of the initial HIV-1-specific CD8+ T-cell response.

During the subsequent disease courses in these twins, epitope sequence evolution showed a mixed pattern, with partially concordant and partially discordant mutational escape in targeted CD8+ T-cell epitopes. Epitopes with concordant sequence evolution included the immunodominant B40-ILL9 epitope, which exhibited identical Q->E substitutions at position 6 in both study individuals, as well as the B40-KL9 epitope, which maintained its wild-type sequence in both twins. In contrast, discordant mutations were observed in the B40-IKL8 epitope, which mutated from I to D at position 2 in twin 1 and from P to R at position 5 in twin 2, as well as in epitope A2-SL9, which switched from T to L at position 5 in twin 1 but remained conserved in twin 2. Sequence discordance was also seen in the evolution of the A2-YV9 epitope, which maintained its wild-type sequence in twin 2 but developed a V->I substitution at position 9 in twin 1, although this mutation did not affect recognition by the respective CD8+ T-cell population. These data suggest that factors other than the sequence of the infecting viral strain and the host genetic background, including the cluster of HLA class I alleles, play a role in shaping viral sequence evolution.

One potential mechanism contributing to variable sequence evolution is the individual T-cell receptor (TCR) usage of HIV-1-specific CD8+ T cells. TCRs are generated by somatic gene rearrangement during T-cell development, followed by thymic selection and also selection at the periphery through interactions with antigen-presenting cells. Thus, even though recombination events are random, skewing of the TCR repertoire for specific antigens is observed. TCR usage in the context of genetically identical twins infected with identical pathogens has not been examined.

For further analysis, we extended the previous study by performing TCR alpha and beta chain repertoire analysis of these HIV-1-specific CD8+ T-cell populations whose targeted epitopes evolved discordantly or concordantly during the subsequent disease process in these two individuals. The TCR repertoire consists of individual TCR alpha and beta chain clonotypes that are generated during thymic selection and contain public (with interindividually identical CDR3 binding motifs) or private (with interindividually heterogeneous CDR3 binding motifs) TCR sequences or a combination of both (4-7). The specific setting of genetically identical twins infected with identical viral strains gave us the opportunity to determine to what degree TCR clonotype recruitment is determined by the genetic background of the hosts and whether discordant or concordant pathways of viral cytotoxic T-lymphocyte epitope escape in both twins correspond to homo- or heterogeneous HIV-1-specific CD8+ T-cell TCR recruitment patterns.

To sequence the TCR sequences of HIV-1-specific CD8+ T cells, peripheral blood mononuclear cell samples obtained at the earliest available time point after infection (6 months) were stained with phycoerythrin-labeled or allophycocyanin-labeled pentamers (ProImmune, Oxford, United Kingdom) as well as CD8 fluorescein isothiocyanate antibodies (Fig. 1). Subsequently, we live sorted the corresponding tetramer-positive CD8+ T-cell populations (at least 1,000 cells per population) by using a FACSAria instrument at 70 lb/in2, which resulted in the isolation of tetramer-positive CD8+ T cells with more than 98% purity. After we extracted RNA from the sorted cells by using the RNeasy mini kit (QIAGEN), we performed anchored reverse transcription-PCR by using a modified version of the SMART (switching mechanism at the 5' end of the RNA transcript) procedure and a TCR {alpha} or ß chain constant region 3' primer to obtain PCR products containing the V{alpha} or ß chain in addition to the CDR3 region, the J{alpha} region, and the beginning of the C{alpha}/ß region. Briefly, reverse transcription was carried out at 42°C for 90 min with primers provided for the 5' rapid amplification of cDNA ends (RACE) reaction in a SMART-RACE PCR kit (BD Biosciences). First- and second-round PCRs were then performed using a universal 5' end primer (5'-CTAATACGACTCACTATAGGGC-3') and nested gene-specific 3' end primers annealing to the constant region of the TCR {alpha} or ß chain (C{alpha} outer, GTCCATAGACCTCATGTCTAGCACAG, and C{alpha} inner, ATACACATCAGAATCCTTACTTTG, or Cß outer, 5'-TGTGGCCAGGCACACCAGTGTGGCC-3', and Cß inner, 5'-GGTGTGGGAGATCTCTGCTTCTGA-3', respectively). PCR conditions were as follows. The first run consisted of 95°C for 30 s and 72°C for 2 min for 5 cycles; 95°C for 30 s, 70°C for 30 s, and 72°C for 2 min for 5 cycles; and 95°C for 30 s, 60°C for 30 s, and 72°C for 1 min for 25 cycles. The second run consisted of 95°C for 30 s, 60°C for 30 s, and 72°C for 1 min for 30 cycles. The PCR product was ligated into the TOPO TA cloning vector (Invitrogen, Carlsbad, CA) and used to transform Escherichia coli (Mach1; Invitrogen). Colonies were selected, amplified by PCR with M13 primers, and sequenced by T7 or T3 primers on an ABI 3100 PRISM automated sequencer. Sequences were edited and aligned using Sequencher (Gene Codes Corp., Ann Arbor, MI) and Se-Al (University of Oxford, Oxford, United Kingdom) and were compared to sequences in the human TCR gene database (http://imgt.cines.fr/textes/IMGTrepertoire/). The TCR V{alpha}/ß chain classification system used was that of the international ImMunoGeneTics database (4).


Figure 1
View larger version (23K):
[in this window]
[in a new window]

 
FIG. 1. Representative dot plots reflecting the tetramer-positive CD8+ T-cell populations isolated by fluorescence-activated cell sorting. Plots indicate cell populations recognizing each of the epitopes under investigation in this study. APC-A, allophycocyanin A.

The obtained TCR sequences are summarized in Table 1. Overall, we found that the TCR alpha and beta chain repertoires for all five HIV-1-specific CD8+ T-cell populations analyzed were broadly heterogeneous, with up to five different beta chain clonotypes and up to three alpha chain clonotypes. Importantly, for the analyzed CD8+ T-cell populations, we did not observe the recruitment of identical clonotypes between the twins, nor did we find common CDR3 binding motifs that were shared by TCR clonotypes in the two study subjects. Instead, the TCR repertoires of HIV-1-specific CD8+ T cells were entirely different between the twins, regardless of whether there was subsequent concordant or discordant sequence evolution in the corresponding epitopes.


View this table:
[in this window]
[in a new window]

 
TABLE 1. TCR {alpha} and ß clonotype recruitment in the two twinsa

To our knowledge, this is the first study to analyze TCR clonotype sequences in epitope-specific CD8+ T cells of genetically identical individuals. Our results indicate that the initial TCR recruitment of pathogen-specific CD8+ T cells appears to be an entirely random process independent of the genetic backgrounds of the respective individuals. Although we did not have a chance to assess the individuals' patterns of cross-recognition of the sequenced TCR repertoires due to shortages of available peripheral blood mononuclear cell samples from the two individuals, it is quite likely that their cross-reactivity has a substantial impact on the evolution of the virus during the subsequent disease process and that discordant viral evolution reflected divergent patterns of cross-recognition of the corresponding TCR repertoires in the twins. However, it is important to mention that different pathways of viral evolution in our two study subjects might also reflect disproportionate acquisition of viral quasispecies during the process of infection as well as random HIV-1 sequence changes related to the high error rate of the viral reverse transcriptase.

These data are in line with a scenario in which the initial pattern of HIV-1-specific CD8+ T-cell responses during primary infection is determined largely by host and viral genetics, but the subsequent viral evolution occurs, at least in part, in a random fashion influenced by random TCR sequence recruitment of HIV-1-specific CD8+ T cells. The observation of random TCR recruitment in syngeneic twins contrasts with the recently reported recruitment of "public" and predictable TCR alpha and beta clonotypes, which has been documented for CD8+ T-cell populations recognizing a variety of different viral epitopes, including those encoded by cytomegalovirus, Epstein-Barr virus, simian immunodeficiency virus, influenza virus, and HIV-1 (3, 5, 6, 9). However, structural analysis of these epitopes suggests that "public" TCR recruitment seems to occur solely in the setting of specific cytotoxic T-lymphocyte epitopes that exhibit unusual three-dimensional structures of the presented antigenic peptide and are thus accessible only to highly selective TCR clonotypes with a particular CDR3 binding motif (7, 8). In contrast, the majority of HIV-1 CD8+ T-cell epitopes appear to be recognizable by a variety of different TCR clonotypes, which explains the substantial variety in the clonotypic composition of HIV-1-specific CD8+ T cells shown here. Overall, these data emphasize that random HIV-1-specific CD8+ T-cell recruitment occurs even in the setting of syngeneic twins and can contribute to individual pathways of HIV-1 sequence evolution.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Partners AIDS Research Center, Massachusetts General Hospital, 149 13th Street, Room 5212, Charlestown, MA 02129. Phone: (617) 724-8332. Fax: (617) 726-4691. E-mail: bwalker{at}partners.org Back

{triangledown} Published ahead of print on 5 September 2007. Back


arrow
REFERENCES
 
    1
  1. Draenert, R., T. M. Allen, Y. Liu, T. Wrin, C. Chappey, C. L. Verrill, et al. 2006. Constraints on HIV-1 evolution and immunodominance revealed in monozygotic adult twins infected with the same virus. J. Exp. Med. 203:529-539.[Abstract/Free Full Text]
  2. 2
  3. Goulder, P. J., and D. I. Watkins. 2004. HIV and SIV CTL escape: implications for vaccine design. Nat. Rev. Immunol. 4:630-640.[CrossRef][Medline]
  4. 3
  5. Kedzierska, K., S. J. Turner, and P. C. Doherty. 2004. Conserved T cell receptor usage in primary and recall responses to an immunodominant influenza virus nucleoprotein epitope. Proc. Natl. Acad. Sci. USA 101:4942-4947.[Abstract/Free Full Text]
  6. 4
  7. Lefranc, M. P., C. Pommie, M. Ruiz, V. Giudicelli, E. Foulquier, L. Truong, et al. 2003. IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains. Dev. Comp. Immunol. 27:55-77.[CrossRef][Medline]
  8. 5
  9. Price, D. A., S. M. West, M. R. Betts, L. E. Ruff, J. M. Brenchley, D. R. Ambrozak, et al. 2004. T cell receptor recognition motifs govern immune escape patterns in acute SIV infection. Immunity 21:793-803.[CrossRef][Medline]
  10. 6
  11. Trautmann, L., M. Rimbert, K. Echasserieau, X. Saulquin, B. Neveu, J. Dechanet, et al. 2005. Selection of T cell clones expressing high-affinity public TCRs within human cytomegalovirus-specific CD8 T cell responses. J. Immunol. 175:6123-6132.[Abstract/Free Full Text]
  12. 7
  13. Turner, S. J., K. Kedzierska, H. Komodromou, N. L. La Gruta, M. A. Dunstone, A. I. Webb, et al. 2005. Lack of prominent peptide-major histocompatibility complex features limits repertoire diversity in virus-specific CD8+ T cell populations. Nat. Immunol. 6:382-389.[CrossRef][Medline]
  14. 8
  15. Tynan, F. E., N. A. Borg, J. J. Miles, T. Beddoe, D. El-Hassen, S. L. Silins, et al. 2005. High resolution structures of highly bulged viral epitopes bound to major histocompatibility complex class I. Implications for T-cell receptor engagement and T-cell immunodominance. J. Biol. Chem. 280:23900-23909.[Abstract/Free Full Text]
  16. 9
  17. Yu, X. G., M. Lichterfeld, S. Chetty, K. L. Williams, S. K. Mui, T. Miura, et al. 2007. Mutually exclusive T-cell receptor induction and differential susceptibility to human immunodeficiency virus type 1 mutational escape associated with a two-amino-acid difference between HLA class I subtypes. J. Virol. 81:1619-1631.[Abstract/Free Full Text]


Journal of Virology, November 2007, p. 12666-12669, Vol. 81, No. 22
0022-538X/07/$08.00+0     doi:10.1128/JVI.01450-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Smith, M. Z., Asher, T. E., Venturi, V., Davenport, M. P., Douek, D. C., Price, D. A., Kent, S. J. (2008). Limited Maintenance of Vaccine-Induced Simian Immunodeficiency Virus-Specific CD8 T-Cell Receptor Clonotypes after Virus Challenge. J. Virol. 82: 7357-7368 [Abstract] [Full Text]  
  • Schneidewind, A., Brockman, M. A., Sidney, J., Wang, Y. E., Chen, H., Suscovich, T. J., Li, B., Adam, R. I., Allgaier, R. L., Mothe, B. R., Kuntzen, T., Oniangue-Ndza, C., Trocha, A., Yu, X. G., Brander, C., Sette, A., Walker, B. D., Allen, T. M. (2008). Structural and Functional Constraints Limit Options for Cytotoxic T-Lymphocyte Escape in the Immunodominant HLA-B27-Restricted Epitope in Human Immunodeficiency Virus Type 1 Capsid. J. Virol. 82: 5594-5605 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yu, X. G.
Right arrow Articles by Walker, B. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yu, X. G.
Right arrow Articles by Walker, B. D.