JVI Try JB online
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
JVI.02863-06v1
81/22/12189    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pandey, K. K.
Right arrow Articles by Grandgenett, D. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pandey, K. K.
Right arrow Articles by Grandgenett, D. P.
Journal of Virology, November 2007, p. 12189-12199, Vol. 81, No. 22
0022-538X/07/$08.00+0     doi:10.1128/JVI.02863-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Inhibition of Human Immunodeficiency Virus Type 1 Concerted Integration by Strand Transfer Inhibitors Which Recognize a Transient Structural Intermediate{triangledown}

Krishan K. Pandey,1,{dagger} Sibes Bera,1,{dagger} Jacob Zahm,1,{dagger} Ajaykumar Vora,1,{dagger} Kara Stillmock,2 Daria Hazuda,2 and Duane P. Grandgenett1*

Institute for Molecular Virology, Saint Louis University Health Sciences Center, St. Louis, Missouri 63110,1 Department of Antiviral Research, Merck Research Laboratories, West Point, Pennsylvania 194662

Received 27 December 2006/ Accepted 24 August 2007


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Human immunodeficiency virus type 1 (HIV-1) integrase (IN) inserts the viral DNA genome into host chromosomes. Here, by native agarose gel electrophoresis, using recombinant IN with a blunt-ended viral DNA substrate, we identified the synaptic complex (SC), a transient early intermediate in the integration pathway. The SC consists of two donor ends juxtaposed by IN noncovalently. The DNA ends within the SC were minimally processed (~15%). In a time-dependent manner, the SC associated with target DNA and progressed to the strand transfer complex (STC), the nucleoprotein product of concerted integration. In the STC, the two viral DNA ends are covalently attached to target and remain associated with IN. The diketo acid inhibitors and their analogs effectively inhibit HIV-1 replication by preventing integration in vivo. Strand transfer inhibitors L-870,810, L-870,812, and L-841,411, at low nM concentrations, effectively inhibited the concerted integration of viral DNA donor in vitro. The inhibitors, in a concentration-dependent manner, bound to IN within the SC and thereby blocked the docking onto target DNA, which thus prevented the formation of the STC. Although 3'-OH recessed donor efficiently formed the STC, reactions proceeding with this substrate exhibited marked resistance to the presence of inhibitor, requiring significantly higher concentrations for effective inhibition of all strand transfer products. These results suggest that binding of inhibitor to the SC occurs prior to, during, or immediately after 3'-OH processing. It follows that the IN-viral DNA complex is "trapped" by the strand transfer inhibitors via a transient intermediate within the cytoplasmic preintegration complex.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The human immunodeficiency virus type 1 (HIV-1) life cycle involves the reverse transcription of the viral RNA genome into cDNA and subsequent integration of the viral DNA by integrase (IN) into the host chromosomes. Although the amino acid sequences of INs differ significantly between viruses, INs share three conserved structural domains and their associated functions (13). The N-terminal domain (~50 residues) contains a zinc-binding region (7), promotes multimerization (46), and is necessary for 3'-OH processing and strand transfer. The catalytic core domain (CCD) (~162 residues) contains the highly conserved acidic D, D-35-E motif (27) that is involved in coordinating Mg2+ for 3'-OH processing and strand transfer activities (4, 13). The catalytic core is also involved in target binding for strand transfer (3, 20, 26, 40). The C-terminal domain (~35 residues) binds to the viral DNA ~6 to 9 bp from the long terminal repeat (LTR) end (15); the C-terminus and CCD are also involved in IN multimerization (1, 24, 29a).

IN, along with the reverse transcriptase and protease, is an antiretroviral target (2, 35, 38). Highly active antiretroviral therapy, consisting of various combinations of reverse transcriptase and protease inhibitors, has significantly decreased HIV-1 replication in humans. The emergence of multidrug-resistant HIV-1 mutants and undesirable side effects associated with certain drug combinations necessitates continuing efforts to develop novel and effective combinational therapies. The addition of inhibitors of HIV-1 IN function would enhance highly active antiretroviral therapy. Raltegravir (MK-0518), an analog of the strand transfer inhibitor L-870,810 used in this report, is in phase III human clinical trials (18, 33).

Oligonucleotide-based assays in vitro have identified a large number of compounds that inhibit HIV-1 IN activities in vitro (25), the majority of which are ineffective at preventing HIV-1 replication in cell culture. The "strand transfer inhibitors" were identified as being effective against recombinant IN, suppressed HIV-1 replication in cell culture and in vivo, and were so named because of their selectivity in both cases towards inhibiting strand transfer over 3'-OH processing (14, 16, 21, 22, 38). The first generation of strand transfer inhibitors possessed a 1,3-diketo acid (DKA) pharmacophore, which served as a template in the development of the naphthyridine carboxamide inhibitors. They are structurally analogous to and function identically to DKA inhibitors but exhibit improved metabolic and pharmacokinetic properties and are represented here by compounds L-870,810 and L-870,812 (21, 23). DKA-mediated inhibition is accomplished by the contact of the DKA moiety with the divalent metal ion in the CCD of IN (19, 38), and efficient inhibitor binding occurs only with IN bound to the viral DNA substrate (14, 22, 38). DKAs interact with Mg2+ and purportedly stabilize the IN-DNA complex (19, 30) by capturing a 3'-OH processing intermediate (38), thus blocking the docking of the target and subsequent strand transfer activity.

Most of the past and current in vitro assays which evaluate HIV-1 IN inhibitors use ~20-bp oligonucleotides containing LTR sequences (22, 31). We investigated the mechanism of selective strand transfer inhibition within the HIV-1 synaptic complex (SC) (Fig. 1), which consists of two large-size donors with their LTR ends juxtaposed by IN. Upon addition of target, the SC carries out concerted or full-site (FS) integration. Substrates with blunt ends are favored over 3'-OH recessed ends by HIV-1 IN to produce FS products (28). The concerted insertion of viral DNA ends into a target results in the correct host site duplication at the site of insertion (29, 37, 41, 42, 45). Another intermediate in the integration pathway has been uncovered in addition to the SC assembled with purified virion or recombinant avian retrovirus IN (5, 45). The strand transfer complex (STC) (Fig. 1) consists of HIV-1 IN associated with covalently attached LTR donors and target as identified on 0.8% agarose gels containing 1 M urea (29). Other products include the insertion of a single donor LTR end into a circular target which yields a circular half-site product (CHS), donor end insertion into or near another donor LTR end (D-D), and Y-type structures (Fig. 1); the latter two products are similar to those observed in oligonucleotide assays.


Figure 1
View larger version (7K):
[in this window]
[in a new window]

 
FIG. 1. Model for assembly of the SC and STC for FS integration. The assembly of the SC and STC that produces the FS integration product is depicted. Other strand transfer reactions produced the CHS, D-D, and Y-type products.

 
Using a blunt-ended donor substrate (1.6 kbp) and HIV-1 IN at low nM concentrations, we demonstrated the efficient assembly of an ~3.4-kbp SC early in the reaction as detected by native agarose gel electrophoresis. Quantitative analysis of the assembly process suggested that the SC is the precursor to the STC. The two donor ends in the SC are juxtaposed by IN in a noncovalent fashion, as demonstrated by two-dimensional gel analysis. Minimal 3'-OH processing by IN is evident in the SC. We showed that one DKA and two 8-hydroxy (1,6)-naphthyridine-7-carboxamide derivative inhibitors (21, 23), in the low nM range, effectively and selectively inhibited FS integration. We determined, using a blunt-ended substrate, that the inhibitors effectively trapped the SC and thus prevent the formation of the STC. In contrast, reactions proceeding with a substrate containing a 3'-OH recessed end required significantly higher concentrations of inhibitors to prevent the formation of the STC and other strand transfer products. The results suggest that the inhibitors trap a structural intermediate prior to or during the 3'-OH processing step.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
DNA substrates. A linear 4.7-kbp DNA containing wild-type (wt) HIV-1 U3 and U5 LTR blunt ends was used for donor substrates. ScaI digestion of the plasmid produced a substrate containing HIV-1 natural DNA blunt ends (11). To obtain single-ended U5 and U3 blunt-end substrates, the ScaI-linearized and dephosphorylated plasmid was digested with NcoI to yield a 1.6-kbp U5 and 2.4-kbp U3 fragment. The DNA substrates were 5'-end labeled on the noncatalytic strand with [{gamma}-32P]ATP by T4 polynucleotide kinase. The specific activities were ~1,000 cpm (Cerenkov) per ng of single-end-labeled substrates. The DNA fragments were isolated from agarose gels and extracted using the Qiaquick gel extraction kit (QIAGEN, Valencia, CA) or electroelution. Preprocessed natural DNA fragments containing 5'-AC overhangs were constructed by ligation of 93-bp double-stranded oligonucleotides containing HIV-1 U5 LTR sequences to a pUC19-derived fragment. The ligated DNA fragments were purified by agarose gel electrophoresis and end labeled. The 3'-OH recessed fragment was 1.7 kbp in length, and the nonspecific end was blunt ended.

Purification of HIV-1 IN. IN (pNY clone) was expressed in Escherichia coli BL21(DE3) cells and purified to near homogeneity (41). Concentrations of HIV-1 IN were determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis using RSV IN as a standard (12), which are very similar to the concentration of HIV-1 IN determined using the molar extinction coefficient of 50,460 M–1 cm–1 at 280 nm (24).

Integration assay. The integration assay was performed as described previously (41). Briefly, IN was assembled with the donor substrate in presence of 20 mM HEPES (pH 7.0), 5 mM dithiothreitol, 10 mM MgCl2, 25 µM ZnCl2, 100 mM NaCl, and 10% polyethylene glycol (6,000 Da) at 14°C for 15 min. The IN and donor concentrations are described for each experiment. The standard reaction volume was 100 µl. The reactions were initiated by addition of supercoiled target DNA (1.5 nM) and incubated for 2 h at 37°C. pBSK2{Delta}-Zeo (2.69 kbp) (36) and pGEM-3 (2.86 kbp) were used as target DNAs. Aliquots were taken for native analysis (see below) prior to deproteinization. The remaining reactions were stopped by addition of EDTA, sodium dodecyl sulfate, and proteinase K to final concentrations of 25 mM, 0.5%, and 1 mg/ml, respectively. Equivalent quantities of each sample (~15,000 cpm) were subjected to either 0.7% or 1.5% agarose gel electrophoresis in Tris-borate-EDTA buffer for 10 to 16 h, respectively, at 100 V. (Please note that the CHS product migrates at different positions on the two different agarose gels.) The gels were dried and exposed to a PhosphorImager screen. DNA products were quantified using a Storm 860 system (Amersham Biosciences).

Analyses of native samples on agarose gels. In addition to the strand transfer analysis described above, aliquots were taken out of the reaction mixture for native analysis before deproteinization. The reactions were stopped by adding EDTA to 25 mM, and the samples were subjected to electrophoresis on either 0.7% or 0.8% native agarose gels in TBE buffer at 4°C (37). Two-dimensional gel electrophoresis of complexes separated on agarose gels was performed as previously described (29, 37).

Inhibitors. Inhibitors L-870,810, L-870,812, and L-841,411 (Diketo acid-2) were described previously (21, 23). Stocks (10 mM) of each inhibitor were made in 100% dimethyl sulfoxide and stored in small aliquots at –70°C. After assembly of the IN-DNA complexes and the addition of target at 14°C, inhibitors were added approximately ~20 s after the addition of target. The samples were immediately incubated for 2 h at 37°C.

Integration products. The analysis and sequencing of the FS integration products were previously described (37).


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
STCs are formed by HIV-1 IN at low nM concentrations using blunt-ended and 3'-OH recessed DNA substrates. STCs were formed at low IN concentrations and then subjected to native 0.8% agarose gel electrophoresis. STCs were initially observed at 5 nM IN with a 1.6-kbp blunt-ended donor (0.5 nM) after 2 h at 37°C, with maximum formation occurring at 15 nM IN (Fig. 2A, lanes 3 and 6, respectively). The CHS product on the native agarose gel also increases with IN concentrations (Fig. 2A). Some smeared products migrate above the STC on the native gel. A distinct band (marked by a dark circle) migrating above the STC band contains the FS product in addition to other captured minor products (see Fig. 4B). To eliminate these smeared products, reactions performed with 20 nM IN were subjected to electrophoresis on 0.7% agarose gels containing 1 M urea. The STC and CHS are essentially the only products that remained stable in the gel containing urea (29). The quantities of detectable STC with and without urea were nearly equivalent (37). Higher concentrations of IN (>40 nM) with 0.5 nM donor resulted in a significant decrease in STC formation and all forms of strand transfer products (data not shown).


Figure 2
View larger version (76K):
[in this window]
[in a new window]

 
FIG. 2. Identification of the STC formed with a blunt-ended DNA substrate at a low nM concentration of IN on a native agarose gel. (A) The 1.6-kbp U5 blunt-ended donor (0.5 nM) was assembled with various concentrations of IN (top) at 14°C for 15 min, followed by the addition of the target and incubation for 2 h at 37°C (lanes 2 to 9). An aliquot was layered on the native 0.8% agarose gel for STC analysis. The control (C) in lane 1 is without IN, and lane 10 contains a 1-kbp molecular size marker ladder (Promega). The STC, CHS, and 1.6-kbp donor are identified on the left. The band migrating (marked by dark circle) above the STC is two STCs bound noncovalently together by IN and mainly contains the FS product (see Fig. 4B). (B) The same samples were also deproteinized and subjected to 1.5% agarose gel electrophoresis. The CHS, FS, Y-type, and D-D products are indicated on the left.

 

Figure 4
View larger version (65K):
[in this window]
[in a new window]

 
FIG. 4. Two-dimensional gel electrophoresis of SC, H-SC, and STC. (A) HIV-1 IN (15 nM) was assembled with the 1.6-kbp blunt-ended donor followed by the target and incubation for only 30 min at 37°C. An aliquot was subjected to native gel electrophoresis (marked native on right) and then to two-dimensional analysis (strand transfer products on top). The arrows indicate the direction for electrophoresis. For easier identification, the native gel was placed adjacent to the 1.6-kbp free donor derived from the products on the native gel. The dark circle indicates the higher-order complexes. H-SC, STC, CHS, SC, and the 1.6-kbp donor are indicated on the right for the native gel, and the strand transfer products are indicated on the bottom. The first band on the diagonal pattern in the second dimension is the nonspecific DNA found in the control lane of the blunt-ended substrate (Fig. 3, lane 2) and is slightly visible below the synaptic complex on the native gel. (B) An independent reaction was performed for 120 min at 37°C and analyzed on native 0.7% agarose gels as described in panel A, except the concentration of IN was 30 nM. The labeling of complexes is on the right. As described in panel A, the sample was also subjected to two-dimensional gel electrophoresis. The dark circle indicates the higher-order STC, which contains FS and other products and free donor. The band migrating at 3.4 kbp contains free donor, the 3.2-kbp D-D product, and Y-type structures. The structure of a large-size product is unknown (Unkn.).

 
We analyzed the strand transfer products after deproteinization of the samples and electrophoresis on a 1.5% agarose gel. The incorporation of donor into the FS product was 34% at 5 nM IN, with maximum formation of 39% at 15 nM (Fig. 2B, lanes 3 and 6, respectively). The slower-migrating products above the CHS products on the 1.5% agarose gel are of unknown structure (Fig. 2B and 4B). The total amount of donor incorporated into all strand transfer products varied from 67% to 79% (Fig. 2B, lanes 3 and 6, respectively). Sequence analysis of 56 plasmid clones derived from U5-U5 and U5-U3 FS products demonstrated 76% and 88% fidelity, respectively, for the HIV-1 5-bp host site duplication (37). The other products possessed small-size deletions of target sequences (28, 37, 41, 42).

Another strand transfer product observed with the deproteinized samples, denoted as donor-donor (D-D) (Fig. 2B, lanes 3 to 9), is 3.2 kbp in length (twice the length of input donor) (41). This product, which constitutes 16% of the total products in lane 3, is the result of integration of two donor LTR ends into each other, at or near the LTR end (11, 17, 37, 42). Other Y-type structures (Fig. 1) produced with two donors are also evident as smeared products above the 3.2-kbp product (Fig. 2B) (11, 42). The IN-DNA complexes that produce the D-D product probably represent complexes possessing misaligned donor ends that are not capable of binding the target properly, in contrast to SCs that bind the target properly and produce FS products. These misaligned complexes are not readily detectable on the native agarose gel at ~3.4 kbp (Fig. 2A, lanes 3 to 9), suggesting that these complexes are either unstable or are a component of the IN-DNA complexes migrating as a smear above the STC (Fig. 2A). From kinetic data, these complexes do not appear to be precursors to either SC or STC (Fig. 3).


Figure 3
View larger version (70K):
[in this window]
[in a new window]

 
FIG. 3. The transient SC is identified on native agarose gels. (A) IN (20 nM) was assembled with the 1.6-kbp blunt-ended donor (0.5 nM) at 14°C and further incubated with the target at 37°C. Aliquots were taken at various time intervals (top) to detect the SC and the STC on a native 0.7% agarose gel (lanes 3 to 12). Lane 1 contains a 1-kbp molecular size marker (M) ladder, lane 2 is the control (C) without IN, and lanes 3 to lane 12 are with IN but were stopped with 25 mM EDTA at the indicated time points. The 20- and 30-min time points were duplicate experiments. The IN-DNA complexes and the donor are identified on the left. The CHS product is also marked. The dark circle on the right indicates a higher-order complex of the H-SC and STC. (B) Strand transfer analysis of the same samples shown in panel A on a 0.7% agarose gel. The products are identified on the left. At 120 min, the percentages of donor incorporated into FS, CHS, and Y-type/D-D products were 22, 8, and 12, respectively. (C) The relative proportions of each nucleoprotein complex identified on the native gel, including those in the H-SC, were calculated and plotted versus time of incubation.

 
Formation of the STC also occurred with a 1.7-kbp donor containing a single U5 3'-OH recessed end (see Fig. 9). A similar IN titration showed that the STC was formed at 5 nM IN and above, but STCs were less abundant than observed with the blunt-ended donor (Fig. 2A). The total incorporation of donor into the FS product (~14%) was essentially stable across the same range of IN used (Fig. 2A), with only the CHS products gradually increasing. In summary, IN effectively forms STC at low IN concentrations with donors containing either blunt or 3'-OH recessed LTR ends and the STC can be readily identified on native agarose gels.


Figure 9
View larger version (63K):
[in this window]
[in a new window]

 
FIG. 9. Higher concentrations of L-870,810 are required for inhibition of strand transfer activities with a 3'-OH recessed substrate. (A) IN (10 nM) was incubated with the 1.7-kbp 3'-OH recessed donor and target in the presence of increasing concentrations of inhibitor (lanes 3 to 13) (top) for 2 h at 37°C. Aliquots were subjected to 0.8% native gel electrophoresis. Lane 1 is without IN. Lanes 2 and 14 contain no inhibitor. In lanes 3 to 13, the inhibitor concentrations are 10, 50, 100, 100, 150, 200, 300, 500, 1,000, 1,500 and 2,000 nM, respectively. The 1-kbp molecular size marker (M) ladder is on the far left. C, control. (B) Strand transfer analysis of the same samples shown in panel A. The last four lanes (lanes 11 to 14) and the DNA ladder were of the same strand transfer analysis but were subjected to electrophoresis on another 1.5% agarose gel and positioned upon the same photograph.

 
Time-dependent formation of the SC and STC. IN was assembled with a 1.6-kbp donor substrate containing a single U5 blunt end for 15 min at 14°C prior to addition of circular target DNA and incubation at 37°C. The formation of the SC (~3.4 kbp) precedes that of the STC, as detected on a native agarose gel (Fig. 3A and C). Higher-order forms of the SC (H-SC) also appear on the native gels (Fig. 3A). The H-SC is formed presumably due to the ability of IN to loop DNA, as published earlier (11, 17). Both the SC and H-SC are efficiently formed without the presence of target (data not shown). The ratio between the SC and H-SC (Fig. 3C) varies in different experiments between ~3 to 1 and 1 to 1. A direct quantitative relationship exists between the disappearance of the SC and H-SC and the appearance of the STC on the native gel (Fig. 3A and C) and not to the CHS product. The formation of the STC has an ~10-min delay and proceeds in a linear fashion thereafter for ~1 h. A comparison between the formation of the FS product (Fig. 3B) and the formation of the STC (Fig. 3A and C) shows a direct quantitative relationship. The slower-migrating complexes on the native gel (Fig. 3A) are higher-order forms of both the SC and the STC, as shown by two-dimensional gel electrophoresis (Fig. 4). In summary, these results suggest that the in vitro FS integration pathway involves the formation of an SC which slowly progresses to the STC.

The SC migrates at ~3.4 kbp on the native gel (Fig. 3A). The SC essentially consists of free donor, as revealed by two-dimensional gel electrophoresis (Fig. 4A) of a 30-min native sample from the time course experiment (Fig. 3A). The H-SC also contains only free donor and no strand transfer products. An undefined small percentage of the 3.4-kbp nucleoprotein complexes do not associate with target but form Y-type structures (Fig. 3B and 4A). In addition, the kinetic profile indicates that the 3.2-kbp D-D product appearing in both the 60- and 120-min incubations (Fig. 3B, lanes 11 and 12) is apparently not derived from the SC which associates with the target to form the STC (Fig. 3A, lanes 3 to 12). The results suggest that one specific structural configuration of the SC associates with the target to form the STC.

The STC always contains a minor population of CHS product as well as the major FS product (Fig. 4A and B). The minor CHS product found in the STC may result from an infrequent, aberrant catalytic event in the FS pathway in which only one DNA end undergoes covalent joining to the target, or, possibly, the CHS is itself a precursor in the FS pathway (29). The latter would imply that a majority of concerted products result from the sequential joining of donors. Using two-dimensional gel analyses of samples at 20, 30, 60, and 120 min, the ratios of FS to CHS products within the STC were 3, 3.3, 6.1, and 24, respectively (Fig. 4A and 4B) (data not shown). The quantitative data do not clearly correlate either the appearance or disappearance of the CHS product associated with the STC to the appearance of the FS product within the STC.

Minimal 3'-OH processing by IN occurs in SC and H-SC. We wanted to determine the amount of 3'-OH processing that occurred on the blunt-ended DNA within the SC and H-SC. Minimal 3'-OH processing (~15%) was evident in the isolated SC and H-SC formed after only 20 min of incubation at 37°C (Fig. 5). No major quantities of strand transfer products are evident within the SC and H-SC (Fig. 4A), suggesting that these complexes are restrained from strand transfer activity in this transient configuration that contains both processed and unprocessed ends. Similar constraint for strand transfer activity is observed in cytoplasmic HIV preintegration complexes (PICs) which also contain processed and unprocessed ends (8-10).


Figure 5
View larger version (46K):
[in this window]
[in a new window]

 
FIG. 5. Minimal 3'-OH processing in the SC and H-SC. (A) Formation of the SC and H-SC was similar to that described in the legend to Fig. 3, except the amounts of 5'-end-labeled donor and IN were increased to 1 and 40 nM, respectively. The reaction was stopped after 20 min, and the samples were subjected to native gel analysis. The bands were identified on agarose gels by SYBR Gold (Invitrogen) staining, subjected to electroelution, concentrated, and digested by HindIII prior to 32P exchange reaction by T4 polynucleotide kinase. The internal labeling allowed identification of the processed strand. (B) On the left, the DNA sequence ladder was generated using a U5 LTR sequence (5' ACTGCTAGAGATTTTCCACACTGAC) as a primer with the 4.7-kbp plasmid containing the U5-U3 junction (11) as a template with Sequenase kit version 2.0 (USB). The markers and samples were subjected to electrophoresis on a denaturing 8% polyacrylamide gel. Lanes 1 and 4 contain donor DNA digested with HindIII, labeled on both strands. Lanes 2 and 3 contain the DNA derived from the H-SC and SC, respectively. The asterisk identifies the processed 103-nucleotide (nt) fragment. The quantity of the processed DNA was determined by PhosphorImager analysis. Coelectrophoresis of the samples with the markers verified the size of the processed DNA. Con., control.

 
Disparate IC50 values for inhibition of FS, CHS, and 3.2-kbp D-D products produced with blunt-ended substrates. We postulated that the three distinct strand transfer reactions, because each arises in a unique way, may each respond distinctly to the presence of inhibitor. Each mechanistically distinct reaction gives rise to different products (Fig. 1). A series of inhibitor titration experiments were performed with L-870,810 (Fig. 6A), L-870,812, and L-841,411 to determine the 50% inhibitory concentration (IC50) for FS, CHS, and 3.2-kbp D-D reactions at 10 nM IN. The concentrations of donor and target were 0.5 nM and 1.5 nM, respectively. The IC50 values vary significantly among different integration products: D-D < FS < CHS (Fig. 6B and Table 1). The IC50 (20 nM) for L-870,810 inhibition of the D-D reaction is very similar to that observed with LTR oligonucleotides with blunt ends (21) and that observed with other strand transfer inhibitors with analogous structures (2, 22). The IC50 associated with the biologically relevant FS integration reaction is 55 nM, while that for the CHS reaction is 245 nM. Titrations with L-870,812 and L-841,411 yielded similar differential IC50 values among the FS, CHS, and D-D products. However, for these inhibitors, the IC50 values fell at higher concentrations (Table 1). The data suggest that inhibition is critically dependent upon the structural context of the particular process at hand: i.e., whether the target is the donor itself (D-D product), whether the target is associated with a synaptic complex (FS product), or whether the target is associated with an IN-DNA complex capable of a single-ended insertion (CHS product). The IC50 values for the FS and D-D reactions run closely in parallel, while the IC50 values for the CHS reaction were between ~5- and 10-fold higher. In summary, this indicates structural similarities between the active-site configurations of IN-DNA complexes giving rise to FS and D-D products; the higher IC50 for the CHS reaction indicates a distinct and disparate active-site configuration associated with these IN-DNA complexes.


Figure 6
View larger version (48K):
[in this window]
[in a new window]

 
FIG. 6. Inhibition of different strand transfer activities by L-870,810 using a blunt-ended donor. (A) Strand transfer analyses were performed as described in the legend to Fig. 2 with IN at 10 nM in the presence of increasing concentrations of L-870,810 (top) for 2 h at 37°C (lanes 4 to 10). The samples were deproteinized and subjected to electrophoresis on a 1.5% agarose gel. Lane 1 contained the 1-kbp molecular size marker (M) ladder, and lane 2 is the control (C) without IN. The percentages of donor incorporated into the FS, CHS, and 3.2-kbp D-D products without inhibitor (lane 3) were 34, 8, and 6%, respectively. (B) Strand transfer reactions were performed at 10 nM IN as described above with increasing concentrations of inhibitor for 2 h at 37°C. The quantities of the D-D ({blacktriangledown}), FS (•), and CHS ({circ}) produced were plotted. The data are representative of several combined sets of individual experiments. The solid lines are the best nonlinear regression fit (sigmoidal logistic) using SigmaPlot V10.0 software. IC50 values were calculated from the best fitted curves. (C) IN at 10 nM (• and {circ}), 20 nM ({blacktriangledown} and {triangleup}), 30 nM ({blacksquare} and {square}), and 40 nM ({blacklozenge} and {diamond}) were incubated with the 1.6-kbp blunt-ended donor (0.5 nM) and target (1.5 nM) in the presence of increasing concentration of L-870,810 for 2 h at 37°C. The filled and open symbols represent the FS and CHS products, respectively, at the various IN concentrations. The percentages of donor incorporated into the FS products varied from 19% at 10 nM IN to 12% at 40 nM in the absence of inhibitor. The percentage of inhibition was calculated independently at each IN concentration.

 

View this table:
[in this window]
[in a new window]

 
TABLE 1. Significantly different IC50 values of IN inhibitors with blunt-ended and 3'-OH recessed substrates

 
We tested whether inhibition with L-870,810 was dependent upon IN concentration (Fig. 6C). In one set of experiments, the IN concentration was varied between 10 nM and 40 nM, under similar inhibitor titration conditions to those described in Fig. 6A. From 10 nM to 40 nM IN, the IC50 values for inhibition of FS activities were 59, 50, 45, and 35 nM, respectively. The values for CHS were 277, 261, 212, and 143 nM, respectively. The higher IC50 values which arise at lower IN concentrations suggest that more complexes are active at the lower concentration of IN. This observation is in accordance with the results obtained in Fig. 2B showing that maximum FS product formation (39%) is observed at an IN concentration of 15 nM. A greater number of active complexes require a higher concentration of inhibitor to achieve effective inhibition. The results also suggest that severe irreversible aggregation of complexes catalyzing both the FS and CHS reactions was minimal at the lower IN concentrations. In summary, the observed IC50 of L-870,810 is dependent on the IN concentration and presumably related to the number of active complexes at a given concentration.

L-870,810 traps the SC and thereby prevents the formation of the STC. The strand transfer inhibitors apparently interact near the target binding site on IN located in the CCD (14, 19) and therefore may trap the SC by preventing target binding and subsequent strand transfer. A different strand transfer inhibitor at 500 µM was effective in blocking the formation of the STC at 80 nM IN that resulted only in the accumulation of a stable SC upon electrophoresis in 0.8% agarose containing 1 M urea (29). It was previously suggested that strand transfer inhibitors presumably "trap" the IN-viral DNA complex by blocking the docking of the target (38).

We examined the effects of different L-870,810 concentrations on the accumulation of the "trapped" SC and H-SC with the disappearance of the STC upon electrophoresis on native agarose gels (Fig. 7). Without inhibitor, the assembly of the SC and H-SC proceeded normally with time, although this particular experiment yielded a high percentage of H-SC (Fig. 7, lanes 2 to 8). A normal amount of STC was evident after 2 h at 37°C (Fig. 7, lane 9). The formation of the STC was inhibited after 2 h of incubation at 37°C by increasing concentrations of L-870,810 (Fig. 7, lanes 11 to 16) while without inhibitor, STC production was normal (Fig. 7, lane 10). Inhibition of STC formation was evident at 20 nM inhibitor and was nearly complete at 750 nM. The "trapped" SC and H-SC were the major species in the presence of 750 nM L-870,810 (Fig. 7, lane 16). After deproteinization, the strand transfer products from the L-870,810 reactions (Fig. 7) were subjected to electrophoresis on a 0.7% agarose gel. Calculations from PhosphorImager data revealed that at 750 nM of inhibitor, the FS reaction was inhibited ~87%, which corresponded with a preponderance of trapped SC and H-SC on the native gel (Fig. 7, lane 16) (see Fig. 6A and Fig. 8). The trapped SC and H-SC are therefore not capable of producing FS products. STC formation was similarly inhibited after 2 h at 37°C under titrations with L-870,812 and L-841,411 but occurred at higher concentrations of inhibitor (data not shown). These concentration variations with which different inhibitors affect strand transfer suggest slightly different interactions within the same IN-DNA complexes. The different binding interactions of each inhibitor may play a role in specifying which drug resistance mutations arise in HIV-1 IN in vivo, as previously suggested (21, 23). In summary, the data suggest that the presence of inhibitor blocks the docking of the circular DNA target and thus prevents the formation of the STC and results in the accumulation of the trapped SC.


Figure 7
View larger version (79K):
[in this window]
[in a new window]

 
FIG. 7. L-870,810 traps the SC which prevents the formation of the STC. IN (20 nM) was assembled with the 1.6-kbp blunt-ended donor (0.5 nM) followed by incubation with the target for various times (top) at 37°C (lanes 3 to 9). Aliquots were subjected to 0.7% native gel electrophoresis. The STC, CHS, SC, and H-SC on the native gel are indicated on the left. Independently, parallel reactions were performed with increasing concentrations of L-870,810 (top) and incubated for 120 min at 37°C (lanes 10 to 16); lane 10 contains no inhibitor. M, molecular size marker ladder; C, control. The trapped SC and H-SC are indicated on the right. The dark circle indicates the higher-order complexes. In lane 10, the percentages of donor incorporated into the FS, CHS, and D-D products were 20, 7, and 15, respectively.

 

Figure 8
View larger version (65K):
[in this window]
[in a new window]

 
FIG. 8. Nonfunctional trapped SC and H-SC are produced by L-870,810, resulting in decreased STC formation. (A) HIV-1 IN (15 nM) was assembled with a 1.6-kbp blunt-ended donor followed by the target and incubation for 2 h at 37°C in the presence of 100 nM L-870,810. Aliquots were subjected to native gel electrophoresis (marked native) and two-dimensional analysis (strand transfer products). The arrows indicate the electrophoresis direction. For easier identification, the native gel was placed adjacent to the 1.6-kbp free donor derived from the products on the native gel. The higher-order complexes, trapped SC and H-SC, STC, CHS, and 1.6-kbp donor are indicated to the right for the native gel. The positions of the strand transfer products are indicated at the bottom. (B) The same experiment was performed as described for panel A, except the concentration of L-870,810 was 750 nM.

 
The nucleoprotein complexes formed in the presence of L-870,810 were subjected to two-dimensional gel electrophoresis. In independent experiments in the presence of either 100 or 750 nM of L-870,810, the amount of STC and its associated FS product decreased upon an increase in inhibitor concentration (Fig. 8A and B, respectively). Only free donor and no strand transfer products were observed with either the trapped SC or H-SC at both inhibitor concentrations. In summary, the results suggest that L-870,810 traps the SC, thus preventing any strand transfer reactions. Without inhibitor, SC is assembled independently and can associate readily with the target to form the STC (Fig. 7, lanes 3 to 9, and Fig. 3).

Reactions proceeding with a 3'-OH recessed substrate are resistant to inhibitors. IN processes the viral DNA blunt ends in the cytoplasmic PIC (8, 13, 22, 34). We tested L-870,810, L-870,812, and L-841,411 in terms of their ability to inhibit the formation of the STC with substrate with a recessed end as compared to a blunt end (Table 1). STCs were formed with the 1.7-kbp-recessed substrate in the presence of increasing concentrations of L-870,810, and the products were examined on both native 0.8% agarose (Fig. 9A) and 1.5% agarose gels following deproteinization (Fig. 9B). IN was present at 10 nM in the reaction mixture. In sharp contrast to the ability of L-870,810 to effectively inhibit FS integration at low nM concentrations with blunt-ended substrate, the IC50 for inhibition of FS integration using a 3'-OH recessed substrate is ~1,400 nM (Fig. 9B) (Table 1). Similar disparate IC50 values were also observed for the FS reaction when titrating with L-870,812 and L-841,411 (Table 1). In summary, the results suggest that IN effectively forms STC with 3'-OH recessed and blunt-ended substrates. However, the inhibitors are ineffective against FS integration carried out with a recessed donor, suggesting SC with blunt ends adopts a transient intermediate structure either prior to, during, or immediately after 3'-OH processing. This transient structure is essential for effective inhibition.


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Highly active HIV-1 IN produces a transient SC that progresses to the STC. Integration is a multistep process involving intermediates. Avian retrovirus IN efficiently assembles the SC in the absence of catalysis at 14°C using 3'-OH recessed donor substrates (5, 44, 45). Examination of HIV-1 IN-DNA complexes on native gels at various times during incubation at 37°C revealed the presence of the SC migrating at ~3.4 kbp (Fig. 3). The SC forms initially early in the course of the reaction, and the blunt ends are minimally processed (Fig. 5). The subsequent disappearance of the SC correlates quantitatively with the appearance of the STC; these kinetic data are highly suggestive of a precursor-product relationship.

Correlation of the efficacy of strand transfer inhibitors in vivo with inhibition of FS integration products produced with blunt-end substrate. L-870,810, L-870,812, and L-841,411 each prevent HIV-1 integration in virus-infected cells. We set out to develop a detailed mechanistic basis for the action of these drugs. Three major strand transfer products were produced with the U5 blunt-ended substrate by HIV-1 IN: the D-D, FS, and CHS products (Fig. 6). The IC50 values for these products using L-870,810 were 20, 55, and 245 nM, respectively (Table 1). The other two inhibitors followed a similar trend but with higher IC50 values. The standard 20-bp oligonucleotide assay containing a single U5 blunt end yields IC50 values of 8 to 15 nM for L-870,810, depending on target concentrations (21); this value falls within the range of those reported for other DKA analogs that are effective in vivo (22, 23).

STCs readily form using blunt-ended DNA (Fig. 2, 3, and 7) or a donor of equivalent size containing 3'-OH recessed ends (Fig. 9). However, for all inhibitors examined, the IC50 values associated with the FS reaction fall significantly further for reactions proceeding with the 3'-OH recessed substrate. Upon titration with L-870,810, the IC50 values associated with FS integration using blunt-ended and 3'-OH recessed donors are 55 and 1,400 nM, respectively. The monofunctional DKA L-708,906 is also ineffective (~10-fold) at inhibiting HIV-1 IN strand transfer activity with a 3'-OH recessed U5 oligonucleotide in comparison to a blunt-ended oligonucleotide (32). The combined data indicate that the strand transfer inhibitors bind with a lower affinity to IN-DNA complexes containing recessed ends. These results indicate that a structural intermediate forms prior to or during the 3'-OH processing step with blunt-ended substrates and that the formation of this intermediate is a prerequisite for effective inhibition.

The strand transfer inhibitors exhibit a preference towards inhibition of strand transfer over 3'-OH processing by multiple folds. With HIV-1 IN present at 80 nM under different assay conditions, ~40% of the viral DNA ends are processed and attached to the target in the STC after 30 min at 37°C (29). We demonstrated that processing in the SC and H-SC is ~15% after 20 min, and these complexes contain few or no strand transfer products (Fig. 4). These processing data suggest that the presence of one blunt end and one recessed end in the SC may represent the necessary and sufficient binding context in which strand transfer inhibitors effectively block circular target and thus prevent the formation of the STC. Preliminary studies also show that lower concentrations of L-870,810 (20 to 1,000 nM) do not inhibit 3'-OH processing of the blunt-ended DNA in the H-SC. Additional investigation is necessary to determine precisely if or how processing facilitates strand transfer inhibition. Our current studies suggest that binding of inhibitor to the IN-viral DNA complex within the PIC, containing one or two DNA blunt ends, may be the primary mode of inhibition.

Biological implications. Why do the potencies of L-870,810 and other DKA derivatives in vivo correlate with their potencies against strand transfer activity in vitro? According to the IC50 values, this correlation exists in two cases: when the in vitro recombination products are derived solely from blunt-ended oligonucleotide substrates, as previously mentioned, or when the products are either D-D or FS (Fig. 6). The correlation between 50% effective concentration values in vivo and IC50 in vitro would indicate that the inhibitor-trapped cytoplasmic PIC may bear structural analogy to the complexes seen in assays with LTR blunt-ended oligonucleotides, nucleoprotein complexes that produced the D-D products, and the trapped SC in vitro. Approximately 70 to 90% of the U3 and U5 viral ends are processed in the cytoplasmic PIC of HIV-1-infected cells by 8 h postinfection (6, 8-10, 22, 34). The fact that DKA inhibitors effectively block strand transfer only with blunt-ended substrates in vitro (Table 1), and presumably in vivo, would indicate that inhibition may not require 3'-OH processing. At low concentrations, the DKA inhibitors do not significantly inhibit 3'-OH processing in vivo or in vitro (21, 22, 43) (see above). However, as stated previously, these inhibitors may trap transient complexes which arise just before or upon processing of the viral DNA in the PIC. In support of this possibility, PIC purified from the cytoplasm of cells infected by HIV-1 for 5 h in the presence of L-731,988 lack concerted integration activity in vitro, in contrast to PIC purified from non-drug-treated cells (22). These combined results suggest that the IN-viral DNA complex is "trapped" by inhibitors within the PIC prior to nuclear transport. There is a significant increase in the viral two-LTR circular DNA generated by ligation of the viral ends in the nucleus of inhibitor-treated cells (22, 43). The junctions of the two-LTR circular DNA produced in inhibitor-treated cells either are the result of ligation of blunt ends, like that observed with 2-LTR circles in untreated cells, or the junctions contain small-size deletions, depending on what inhibitor is used (43). With strand transfer inhibitor L-708,906, the increase in two-LTR circles was essentially due to ligation of blunt-ended viral DNA (43). The blocking of strand transfer activity appears more likely to arise from trapping of viral DNA complex in the cytoplasmic PIC rather than viral DNA complex located in the nucleus containing 3'-OH recessed ends, which are ineffectively inhibited in vitro (Table 1). Possibly, prevention of integration of 3'-OH recessed viral DNA into host chromosomes would require increased efficiency in transport of strand transfer inhibitors across the nuclear membrane.


    ACKNOWLEDGMENTS
 
This work was supported by National Institutes of Allergy and Infectious Diseases grant AI31334 and by National Cancer Institute grant CA16312.


    FOOTNOTES
 
* Corresponding author. Mailing address: Institute for Molecular Virology, 3681 Park Avenue, Saint Louis University Health Sciences Center, St. Louis, MO 63110. Phone: (314) 977-8784. Fax: (314) 977-8798. E-mail: grandgdp{at}slu.edu Back

{triangledown} Published ahead of print on 5 September 2007. Back

{dagger} K.K.P., S.B., J.Z. and A.V. made equal contributions to this study. Back


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Andrake, M. D., and A. M. Skalka. 1995. Multimerization determinants reside in both the catalytic core and C terminus of avian sarcoma virus integrase. J. Biol. Chem. 270:29299-29306.[Abstract/Free Full Text]
  2. Anthony, N. J. 2004. HIV-1 integrase: a target for new AIDS chemotherapeutics. Curr. Top. Med. Chem. 4:979-990.[CrossRef][Medline]
  3. Appa, R. S., C. G. Shin, P. Lee, and S. A. Chow. 2001. Role of the nonspecific DNA-binding region and alpha helices within the core domain of retroviral integrase in selecting target DNA sites for integration. J. Biol. Chem. 276:45848-45855.[Abstract/Free Full Text]
  4. Asante-Appiah, E., S. H. Seeholzer, and A. M. Skalka. 1998. Structural determinants of metal-induced conformational changes in HIV-1 integrase. J. Biol. Chem. 273:35078-35087.[Abstract/Free Full Text]
  5. Bera, S., A. C. Vora, R. Chiu, T. Heyduk, and D. P. Grandgenett. 2005. Synaptic complex formation of two retrovirus DNA attachment sites by integrase: a fluorescence energy transfer study. Biochemistry 44:15106-15114.[CrossRef][Medline]
  6. Brown, H. E. V., H. Chen, and A. Engelman. 1999. Structure-based mutagenesis of the human immunodeficiency virus type 1 DNA attachment site: effects on integration and cDNA synthesis. J. Virol. 73:9011-9020.[Abstract/Free Full Text]
  7. Bushman, F. D., A. Engelman, I. Palmer, P. Wingfield, and R. Craigie. 1993. Domains of the integrase protein of human immunodeficiency virus type 1 responsible for polynucleotidyl transfer and zinc binding. Proc. Natl. Acad. Sci. USA 90:3428-3432.[Abstract/Free Full Text]
  8. Chen, H., and A. Engelman. 2001. Asymmetric processing of human immunodeficiency virus type 1 cDNA in vivo: implications for functional end coupling during the chemical steps of DNA transposition. Mol. Cell. Biol. 21:6758-6767.[Abstract/Free Full Text]
  9. Chen, H., and A. Engelman. 2000. Characterization of a replication-defective human immunodeficiency virus type 1 att site mutant that is blocked after the 3' processing step of retroviral integration. J. Virol. 74:8188-8193.[Abstract/Free Full Text]
  10. Chen, H., S. Q. Wei, and A. Engelman. 1999. Multiple integrase functions are required to form the native structure of the human immunodeficiency virus type I intasome. J. Biol. Chem. 274:17358-17364.[Abstract/Free Full Text]
  11. Cherepanov, P., D. Surratt, J. Toelen, W. Pluymers, J. Griffith, E. De Clercq, and Z. Debyser. 1999. Activity of recombinant HIV-1 integrase on mini-HIV DNA. Nucleic Acids Res. 27:2202-2210.[Abstract/Free Full Text]
  12. Chiu, R., and D. P. Grandgenett. 2003. Molecular and genetic determinants of Rous sarcoma virus integrase for concerted DNA integration. J. Virol. 77:6482-6492.[Abstract/Free Full Text]
  13. Craigie, R. 2002. Retroviral DNA integration, p. 613-630. In N. L. Craig, R. Craigie, M. Gellert, and A. M. Lambowitz (ed.), Mobile DNA II. ASM Press, Washington, DC.
  14. Espeseth, A. S., P. Felock, A. Wolfe, M. Witmer, J. Grobler, N. Anthony, M. Egbertson, J. Y. Melamed, S. Young, T. Hamill, J. L. Cole, and D. J. Hazuda. 2000. HIV-1 integrase inhibitors that compete with the target DNA substrate define a unique strand transfer conformation for integrase. Proc. Natl. Acad. Sci. USA 97:11244-11249.[Abstract/Free Full Text]
  15. Esposito, D., and R. Craigie. 1998. Sequence specificity of viral end DNA binding by HIV-1 integrase reveals critical regions for protein-DNA interaction. EMBO J. 17:5832-5843.[CrossRef][Medline]
  16. Goldgur, Y., R. Craigie, G. H. Cohen, T. Fujiwara, T. Yoshinaga, T. Fujishita, H. Sugimoto, T. Endo, H. Murai, and D. R. Davies. 1999. Structure of the HIV-1 integrase catalytic domain complexed with an inhibitor: a platform for antiviral drug design. Proc. Natl. Acad. Sci. USA 96:13040-13043.[Abstract/Free Full Text]
  17. Grandgenett, D. P., R. B. Inman, A. C. Vora, and M. L. Fitzgerald. 1993. Comparison of DNA binding and integration half-site selection by avian myeloblastosis virus integrase. J. Virol. 67:2628-2636.[Abstract/Free Full Text]
  18. Grinsztejn, B., B. Y. Nguyen, C. Katlama, J. M. Gatell, A. Lazzarin, D. Vittecoq, C. J. Gonzalez, J. Chen, C. M. Harvey, and R. D. Isaacs. 2007. Safety and efficacy of the HIV-1 integrase inhibitor raltegravir (MK-0518) in treatment-experienced patients with multidrug-resistant virus: a phase II randomised controlled trial. Lancet 369:1261-1269.[CrossRef][Medline]
  19. Grobler, J. A., K. Stillmock, B. Hu, M. Witmer, P. Felock, A. S. Espeseth, A. Wolfe, M. Egbertson, M. Bourgeois, J. Melamed, J. S. Wai, S. Young, J. Vacca, and D. J. Hazuda. 2002. Diketo acid inhibitor mechanism and HIV-1 integrase: implications for metal binding in the active site of phosphotransferase enzymes. Proc. Natl. Acad. Sci. USA 99:6661-6666.[Abstract/Free Full Text]
  20. Harper, A. L., M. Sudol, and M. Katzman. 2003. An amino acid in the central catalytic domain of three retroviral integrases that affects target site selection in nonviral DNA. J. Virol. 77:3838-3845.[Abstract/Free Full Text]
  21. Hazuda, D. J., N. J. Anthony, R. P. Gomez, S. M. Jolly, J. S. Wai, L. Zhuang, T. E. Fisher, M. Embrey, J. P. Guare, Jr., M. S. Egbertson, J. P. Vacca, J. R. Huff, P. J. Felock, M. V. Witmer, K. A. Stillmock, R. Danovich, J. Grobler, M. D. Miller, A. S. Espeseth, L. Jin, I. W. Chen, J. H. Lin, K. Kassahun, J. D. Ellis, B. K. Wong, W. Xu, P. G. Pearson, W. A. Schleif, R. Cortese, E. Emini, V. Summa, M. K. Holloway, and S. D. Young. 2004. A naphthyridine carboxamide provides evidence for discordant resistance between mechanistically identical inhibitors of HIV-1 integrase. Proc. Natl. Acad. Sci. USA 101:11233-11238.[Abstract/Free Full Text]
  22. Hazuda, D. J., P. Felock, M. Witmer, A. Wolfe, K. Stillmock, J. A. Grobler, A. Espeseth, L. Gabryelski, W. Schleif, C. Blau, and M. D. Miller. 2000. Inhibitors of strand transfer that prevent integration and inhibit HIV-1 replication in cells. Science 287:646-650.[Abstract/Free Full Text]
  23. Hazuda, D. J., S. D. Young, J. P. Guare, N. J. Anthony, R. P. Gomez, J. S. Wai, J. P. Vacca, L. Handt, S. L. Motzel, H. J. Klein, G. Dornadula, R. M. Danovich, M. V. Witmer, K. A. Wilson, L. Tussey, W. A. Schleif, L. S. Gabryelski, L. Jin, M. D. Miller, D. R. Casimiro, E. A. Emini, and J. W. Shiver. 2004. Integrase inhibitors and cellular immunity suppress retroviral replication in rhesus macaques. Science 305:528-532.[Abstract/Free Full Text]
  24. Jenkins, T. M., A. Engelman, R. Ghirlando, and R. Craigie. 1996. A soluble active mutant of HIV-1 integrase: involvement of both the core and carboxyl-terminal domains in multimerization. J. Biol. Chem. 271:7712-7718.[Abstract/Free Full Text]
  25. Johnson, A. A., C. Marchand, and Y. Pommier. 2004. HIV-1 integrase inhibitors: a decade of research and two drugs in clinical trial. Curr. Top. Med. Chem. 4:1059-1077.[CrossRef][Medline]
  26. Katzman, M., and M. Sudol. 1995. Mapping domains of retroviral integrase responsible for viral DNA specificity and target site selection by analysis of chimeras between human immunodeficiency virus type 1 and visna virus integrases. J. Virol. 69:5687-5696.[Abstract]
  27. Kulkosky, J., K. S. Jones, R. A. Katz, J. P. G. Mack, and A. M. Skalka. 1992. Residues critical for retroviral integrative recombination in a region that is highly conserved among retroviral/retrotransposon integrases and bacterial insertion sequence transposases. Mol. Cell. Biol. 12:2331-2338.[Abstract/Free Full Text]
  28. Li, M., and R. Craigie. 2005. Processing of viral DNA ends channels the HIV-1 integration reaction to concerted integration. J. Biol. Chem. 280:29334-29339.[Abstract/Free Full Text]
  29. Li, M., M. Mizuuchi, T. R. Burke, Jr., and R. Craigie. 2006. Retroviral DNA integration: reaction pathway and critical intermediates. EMBO J. 25:1295-1304.[CrossRef][Medline]
  30. Lutzke, R. A. P., and R. H. Plasterk. 1998. Structure-based mutational analysis of the C-terminal DNA-binding domain of human immunodeficiency virus type 1 integrase: critical residues for protein oligomerization and DNA binding. J. Virol. 72:4841-4848.[Abstract/Free Full Text]
  31. Marchand, C., A. A. Johnson, R. G. Karki, G. C. Pais, X. Zhang, K. Cowansage, T. A. Patel, M. C. Nicklaus, T. R. Burke, Jr., and Y. Pommier. 2003. Metal-dependent inhibition of HIV-1 integrase by beta-diketo acids and resistance of the soluble double-mutant (F185K/C280S). Mol. Pharmacol. 64:600-609.[Abstract/Free Full Text]
  32. Marchand, C., N. Neamati, and Y. Pommier. 2001. In vitro human immunodeficiency virus type 1 integrase assays. Methods Enzymol. 340:624-633.[Medline]
  33. Marchand, C., X. Zhang, G. C. Pais, K. Cowansage, N. Neamati, T. R. Burke, Jr., and Y. Pommier. 2002. Structural determinants for HIV-1 integrase inhibition by beta-diketo acids. J. Biol. Chem. 277:12596-12603.[Abstract/Free Full Text]
  34. Markowitz, M., J. O. Morales-Ramirez, B. Y. Nguyen, C. M. Kovacs, R. T. Steigbigel, D. A. Cooper, R. Liporace, R. Schwartz, R. Isaacs, L. R. Gilde, L. Wenning, J. Zhao, and H. Teppler. 2006. Antiretroviral activity, pharmacokinetics, and tolerability of MK-0518, a novel inhibitor of HIV-1 integrase, dosed as monotherapy for 10 days in treatment-naive HIV-1-infected individuals. J. Acquir. Immune Defic. Syndr. 43:509-515.[CrossRef][Medline]
  35. Miller, M. D., C. M. Farnet, and F. D. Bushman. 1997. Human immunodeficiency virus type 1 preintegration complexes: studies of organization and composition. J. Virol. 71:5382-5390.[Abstract]
  36. Mocroft, A., B. Ledergerber, C. Katlama, O. Kirk, P. Reiss, A. d'Arminio Monforte, B. Knysz, M. Dietrich, A. N. Phillips, and J. D. Lundgren. 2003. Decline in the AIDS and death rates in the EuroSIDA study: an observational study. Lancet 362:22-29.[CrossRef][Medline]
  37. Moreau, K., C. Faure, G. Verdier, and C. Ronfort. 2002. Analysis of conserved and non-conserved amino acids critical for ALSV (Avian leukemia and sarcoma viruses) integrase functions in vitro. Arch. Virol. 147:1761-1778.[CrossRef][Medline]
  38. Pandey, K. K., S. Sinha, and D. P. Grandgenett. 2007. Transcriptional coactivator LEDGF/p75 modulates human immunodeficiency virus type 1 integrase-mediated concerted integration. J. Virol. 81:3969-3979.[Abstract/Free Full Text]
  39. Pommier, Y., A. A. Johnson, and C. Marchand. 2005. Integrase inhibitors to treat HIV/AIDS. Nat. Rev. Drug Discov. 4:236-248.[CrossRef][Medline]
  40. Reference deleted.
  41. Shibagaki, Y., and S. A. Chow. 1997. Central core domain of retroviral integrase is responsible for target site selection. J. Biol. Chem. 272:8361-8369.[Abstract/Free Full Text]
  42. Sinha, S., and D. Grandgenett. 2005. Recombinant human immunodeficiency virus type 1 integrase exhibits a capacity for full-site integration in vitro that is comparable to that of purified preintegration complexes from virus-infected cells. J. Virol. 79:8208-8216.[Abstract/Free Full Text]
  43. Sinha, S., M. H. Pursley, and D. P. Grandgenett. 2002. Efficient concerted integration by recombinant human immunodeficiency virus type 1 integrase without cellular or viral cofactors. J. Virol. 76:3105-3113.[Abstract/Free Full Text]
  44. Svarovskaia, E. S., R. Barr, X. Zhang, G. C. G. Pais, C. Marchand, Y. Pommier, T. R. Burke, Jr., and V. K. Pathak. 2004. Azido-containing diketo acid derivatives inhibit human immunodeficiency virus type 1 integrase in vivo and influence the frequency of deletions at two-long-terminal-repeat-circle junctions. J. Virol. 78:3210-3222.[Abstract/Free Full Text]
  45. Vora, A., S. Bera, and D. Grandgenett. 2004. Structural organization of avian retrovirus integrase in assembled intasomes mediating full-site integration. J. Biol. Chem. 279:18670-18678.[Abstract/Free Full Text]
  46. Vora, A., and D. P. Grandgenett. 2001. DNase protection analysis of retrovirus integrase at the viral DNA ends for full-site integration in vitro. J. Virol. 75:3556-3567.[Abstract/Free Full Text]
  47. Zheng, R., T. M. Jenkins, and R. Craigie. 1996. Zinc folds the N-terminal domain of HIV-1 integrase, promotes multimerization, and enhances catalytic activity. Proc. Natl. Acad. Sci. USA 93:13659-13664.[Abstract/Free Full Text]


Journal of Virology, November 2007, p. 12189-12199, Vol. 81, No. 22
0022-538X/07/$08.00+0     doi:10.1128/JVI.02863-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
JVI.02863-06v1
81/22/12189    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pandey, K. K.
Right arrow Articles by Grandgenett, D. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pandey, K. K.
Right arrow Articles by Grandgenett, D. P.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. Mol. Cell. Biol. Microbiol. Mol. Biol. Rev.
Clin. Vaccine Immunol. ALL ASM JOURNALS