Journal of Virology, November 2007, p. 11640-11649, Vol. 81, No. 21
0022-538X/07/$08.00+0 doi:10.1128/JVI.01475-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Induction of CD8+ Cells Able To Suppress CCR5-Tropic Simian Immunodeficiency Virus SIVmac239 Replication by Controlled Infection of CXCR4-Tropic Simian-Human Immunodeficiency Virus in Vaccinated Rhesus Macaques
Tetsuo Tsukamoto,1,2,
Mitsuhiro Yuasa,1,
Hiroyuki Yamamoto,1
Miki Kawada,1,2
Akiko Takeda,1
Hiroko Igarashi,2 and
Tetsuro Matano1,2,3,4*
International Research Center for Infectious Diseases, The Institute of Medical Science, The University of Tokyo, 4-6-1 Shirokanedai, Minato-Ku, Tokyo 108-8639, Japan,1
Graduate School of Medicine, The University of Tokyo, 7-3-1 Hongo, Bunkyo-Ku, Tokyo 113-0033, Japan,2
AIDS Research Center, National Institute of Infectious Diseases, 1-23-1 Toyama, Shinjuku-ku, Tokyo 162-8640, Japan,3
Tsukuba Primate Research Center, National Institute of Biomedical Innovation, 1 Hachimandai, Tsukuba, Ibaraki 305-0843, Japan4
Received 5 July 2007/
Accepted 16 August 2007
 |
ABSTRACT
|
|---|
Recent recombinant viral vector-based AIDS vaccine trials inducing cellular immune responses have shown control of CXCR4-tropic simian-human immunodeficiency virus (SHIV) replication but difficulty in containment of pathogenic CCR5-tropic simian immunodeficiency virus (SIV) in rhesus macaques. In contrast, controlled infection of live attenuated SIV/SHIV can confer the ability to contain SIV superchallenge in macaques. The specific immune responses responsible for this control may be induced by live virus infection but not consistently by viral vector vaccination, although those responses have not been determined. Here, we have examined in vitro anti-SIV efficacy of CD8+ cells in rhesus macaques that showed prophylactic viral vector vaccine-based control of CXCR4-tropic SHIV89.6PD replication. Analysis of the effect of CD8+ cells obtained at several time points from these macaques on CCR5-tropic SIVmac239 replication in vitro revealed that CD8+ cells in the chronic phase after SHIV challenge suppressed SIV replication more efficiently than those before challenge. SIVmac239 superchallenge of two of these macaques at 3 or 4 years post-SHIV challenge was contained, and the following anti-CD8 antibody administration resulted in transient CD8+ T-cell depletion and appearance of plasma SIVmac239 viremia in both of them. Our results indicate that CD8+ cells acquired the ability to efficiently suppress SIV replication by controlled SHIV infection, suggesting the contribution of CD8+ cell responses induced by controlled live virus infection to containment of HIV/SIV superinfection.
 |
INTRODUCTION
|
|---|
Live attenuated immunodeficiency virus infection can induce effective immune responses against pathogenic human immunodeficiency virus type 1 (HIV-1) and simian immunodeficiency virus (SIV) replication, although concerns about conditions necessary for its safety as an AIDS vaccine have not been satisfied at present (3, 13, 19). In macaque AIDS models, infection of live attenuated viruses such as SIVmac239
nef, SIVmac239
3, and simian-human immunodeficiency virus (SHIV) 89.6 have been shown to confer potent immune responses resulting in control of SIV superchallenge (7, 14, 35, 53). While involvement of virus-specific CD8+ cytotoxic T-lymphocyte (CTL) responses has been indicated, it has remained unclear what immune responses play a key role in this control (19, 34).
Virus-specific cellular immune responses are crucial for control of HIV-1 and SIV infections (1, 4, 5, 10, 12, 20, 29, 38, 41, 42). Recombinant viral vector-based vaccines efficiently eliciting virus-specific cellular immune responses have been developed as promising AIDS vaccine candidates (32). These prophylactic vaccine trials in rhesus macaques have shown viral control and prevention of acute CD4+ T-cell depletion after CXCR4-tropic SHIV challenge (2, 27, 36, 37, 40, 46). Unfortunately, however, trials of these vaccines have shown difficulty in containment of CCR5-tropic SIV infection that induces acute, massive depletion of CCR5+ CD4+ memory T cells and chronic disease progression like HIV-1 infection in humans (6, 8, 11, 21, 23, 28, 30, 31, 39, 49, 50, 52). Possibly, the specific immune responses responsible for SIV control might be induced by live SIV/SHIV infection but not consistently by recombinant viral vector vaccination. Previous CD8+ cell-depletion experiments in macaques using a monoclonal anti-CD8 antibody have indicated the importance of CD8+ cells in SIV control (12, 29, 42), but differences in antiviral efficacy between live SIV/SHIV infection-induced and recombinant viral vector vaccination-induced CD8+ cells have not been determined.
Our previous trials of a prophylactic vaccine using a Gag-expressing Sendai virus (SeV-Gag) vector have shown control of CXCR4-tropic SHIV89.6PD replication in vaccinated rhesus macaques (27, 47). While this vaccination did not always result in CCR5-tropic SIVmac239 control (28), it was speculated that, after SHIV challenge, these vaccinees may possibly acquire the potential for controlling SIVmac239 superchallenge. In the present study, we have examined whether these SHIV controllers acquired CD8+ cells effective against SIVmac239 replication. Our analyses have suggested that CD8+ cell responses capable of suppressing SIVmac239 replication in vitro were induced by controlled SHIV infection and that these responses might be crucial for control of superchallenged SIVmac239 replication.
 |
MATERIALS AND METHODS
|
|---|
Animal experiments.
Four Burmese rhesus macaques (Macaca mulatta) used in this study (Table 1) were maintained in accordance with the Guides for Animal Experiments Performed at National Institute of Infectious Diseases (35a). Blood collection, vaccination, virus challenge, and antibody administration were performed under ketamine anesthesia. These macaques received prophylactic vaccination and SHIV89.6PD challenge as described in our previous studies (27, 47). Macaque R00-017 was vaccinated intranasally with 1 x 108 cell infectious units (CIU) of replication-competent SeV-Gag vector (15, 16), whereas macaques R00-020, R00-023, and R00-024 were primed intramuscularly with 5 mg of cytomegalovirus (CMV)-SHIVdEN DNA and then boosted intranasally with 6 x 109 CIU of replication-defective F-deleted SeV-Gag vector (22). The CMV-SHIVdEN DNA was constructed from an env- and nef-deleted SHIVMD14YE molecular clone DNA (45) and has the genes encoding SIVmac239 Gag, Pol, Vif, and Vpx; SIVmac239-HIV-1DH12 chimeric Vpr; and HIV-1DH12 Tat and Rev as described previously (28, 47). These vaccinees were challenged intravenously with 10 50% tissue culture infective doses (TCID50) of SHIV89.6PD (25) 13 weeks (in R00-020, R00-023, and R00-024) or 14 weeks (in R00-017) after SeV-Gag vaccination.
Macaques R00-023 and R00-024 were euthanized around 2 years after SHIV89.6PD challenge, while macaques R00-017 and R00-020 were followed up for more than 2 years. The latter two animals received monoclonal anti-CD20 antibody administration for CD20+ cell depletion (starting at week 166 in R00-017 and week 140 in R00-020), intravenous superchallenge with 1,000 TCID50 of SIVmac239 (18) (at week 203 in R00-017 and week 151 in R00-020), and monoclonal anti-CD8 antibody administration for CD8+ cell depletion (starting at week 209 in R00-017 and week 163 in R00-020) (Table 1). For CD20+ cell depletion, animals were inoculated intravenously with 10 mg/kg of monoclonal anti-CD20 antibody (Rituximab; Zenyaku Kogyo, Tokyo, Japan) four times every other week. Peripheral B-cell depletion was confirmed by immunostaining using anti-human CD19 antibody and anti-human CD20 antibody (Becton Dickinson, Tokyo, Japan). For CD8+ cell depletion, animals received a single subcutaneous inoculation of 10 mg/kg of monoclonal anti-CD8 antibody (cM-T807) provided by Centocor (Malvern, PA) followed by three intravenous inoculations of 5 mg/kg cM-T807 on days 3, 7, and 10 after the first inoculation. Peripheral CD8+ T-cell depletion was confirmed by immunostaining using anti-human CD8 antibody (DK25; Dako, Kyoto, Japan). Macaques R00-017 and R00-020 were euthanized 3 months after the anti-CD8 antibody administration.
Quantitation of plasma viral loads.
Plasma RNA was extracted using the High Pure viral RNA kit (Roche Diagnostics, Tokyo, Japan). For quantitation of plasma SIV/SHIV RNA levels, serial fivefold dilutions of RNA samples were amplified in quadruplicate by reverse transcription (RT) and nested PCR to determine the endpoint. SIV gag-specific primers (AGAAACTCCGTCTTGTCAGG and TGATAATCTGCATAGCCGC for the first RT-PCR and GATTAGCAGAAAGCCTGTTGG and TGCAACCTTCTGACAGTGC for the second DNA PCR) (Sigma-Aldrich, Tokyo, Japan) that recognize the gag region shared by SHIV89.6PD and SIVmac239 were used. Plasma SIV/SHIV RNA levels were calculated according to the Reed-Muench method as described previously (28). The lower limit of detection in this assay is approximately 4 x 102 copies/ml. After SIVmac239 superchallenge, plasma SIVmac239 RNA levels were measured by the LightCycler system (Roche Diagnostics) using SIVmac239 env-specific primers (AAGAATTGTTGCGACTGACC and CAGTAGTGTGGCAGACTTGTC) and probes (CATTCAGCTGCGCCTGGTCCTTTAAGTAC-Flu and LcRed-TCTTCGATGGCAGTGACCCTAGTCTGGAGG) (Nihon Gene Research Laboratories, Inc., Sendai, Japan) that recognize SIVmac239 env but not SHIV89.6PD env. SHIV89.6PD RNA levels were also measured using SHIV89.6PD env-specific primers (GGATGTTGATGATCTGTAGTGC and CCAATACTACTTCTTGTGGGTT) and probes (CAGTCTATTATGGGGTACCTGTGTGGAGAGAAGCA-Flu and LcRed-CCACCACTCTATTTTGTGCATCAGATGCTAAAGCC) that recognize SHIV89.6PD env but not SIVmac239 env. The lower limit of detection in this assay is approximately 1 x 103 copies/ml.
In vitro viral suppression assay.
We examined SIVmac239 replication on CD8-depleted peripheral blood mononuclear cells (PBMCs) in the presence of CD8+ cells positively selected from PBMCs. Macaque PBMCs prepared from blood at several time points were frozen and stored until use. Thawed PBMCs were separated into CD8+ cells and CD8– cells by using MACS CD8 MicroBeads (Miltenyi Biotec, Tokyo, Japan). The purity of the former was more than 96%, while the latter included less than 3% of CD8+ cells. To prepare target cells, one fifth of CD8– cells negatively selected from PBMCs obtained before SHIV89.6PD challenge were infected with SIVmac239 at a multiplicity of infection (MOI) of 1:104, and these infected cells and the remaining uninfected CD8– cells were cultured separately in the presence of 2 µg/ml phytohemagglutinin-L (Roche Diagnostics). After a 48-h culture, both infected and uninfected CD8– cells were collected, washed three times, and mixed to be used as target cells. Then, 4 x 105 target cells were cultured alone or cocultured with 4 x 105 (effector/target [E:T] ratio of 1:1) or 4 x 104 (E:T ratio of 1:10) CD8+ effector cells positively selected from PBMCs in a well of 96-well flat-bottom plate and the culture supernatants were harvested every other day for measurement of SIV Gag CA p27 concentration by SIV core antigen enzyme-linked immunosorbent assay (ELISA) (Beckman Coulter, Tokyo, Japan). RPMI 1640 medium (Invitrogen, Tokyo, Japan) supplemented with 10% heat-inactivated fetal bovine serum (HyClone, Logan, UT) and 20 IU/ml recombinant human interleukin-2 (Roche Diagnostics) were used for cell culture. All of the cocultures were in duplicate, and the mean value of p27 concentrations at each time point is shown.
Measurement of virus-specific CD8+ T-cell responses.
We measured virus-specific T-cell levels by flow cytometric analysis of gamma interferon (IFN-
) induction after specific stimulation as described previously (27, 28). PBMCs were cocultured with autologous herpesvirus papio-immortalized B-lymphoblastoid cell lines (B-LCL) (51) infected with vesicular stomatitis virus G (VSV-G)-pseudotyped SIVGP1 for SIVGP1-specific stimulation. The VSV-G-pseudotyped SIVGP1 was obtained by cotransfection of COS-1 cells with pVSV-G (Clontech, Otsu, Japan) and SIVGP1, an env- and nef-deleted SHIVMD14 molecular clone DNA (28, 45). Intracellular IFN-
staining was performed using a Cytofix-Cytoperm kit (Becton Dickinson). Peridinin chlorophyll-conjugated anti-human CD8, allophycocyanin-conjugated anti-human CD3, and phycoerythrin-conjugated anti-human IFN-
antibodies (Becton Dickinson) were used. Specific T-cell levels were calculated by subtracting the IFN-
T-cell frequencies after nonspecific stimulation from those after SIVGP1-specific stimulation.
Measurement of virus-specific neutralizing titers.
We measured virus-specific neutralizing titers as described previously (17, 44). Serial twofold dilutions of heat-inactivated plasma were prepared in duplicate and mixed with 10 TCID50 of SIVmac239 or SHIV89.6PD. In each mixture, 5 µl of diluted plasma was incubated with 5 µl of virus. After a 45-min incubation at room temperature, each 10-µl mixture was added to 5 x 104 MT-4 cells in a well of a 96-well flat-bottom plate. After 12 days of culture, supernatants were harvested. Progeny virus production in the supernatants was examined by SIV core antigen ELISA for detection of SIV p27 to determine the 100% neutralizing end point. The lower limit of detection is a titer of 1:2.
 |
RESULTS
|
|---|
Potency of CD8+ cells post-SHIV challenge for suppressing SIVmac239 replication in vitro.
We established a method for examining SIVmac239 replication in vitro in the presence of CD8+ cells and evaluated the effect of CD8+ cells on SIVmac239 replication in vitro in four rhesus macaques that showed vaccine-based containment of SHIV89.6PD challenge (Table 1). One of them (R00-017) received a single intranasal SeV-Gag vaccination, while the other three (R00-020, R00-023, and R00-024) received a single intramuscular DNA priming followed by a single intranasal SeV-Gag booster before SHIV89.6PD challenge as described previously (27, 47). All four of these macaques controlled viral replication with undetectable plasma viremia after the acute phase for more than 2 years post-SHIV89.6PD challenge (54).
From each animal, we prepared four groups of bulk CD8+ cells obtained prevaccination, post-SeV-Gag vaccination (pre-SHIV challenge), in the early phase post-SHIV challenge (weeks 3 to 8), and in the chronic phase post-SHIV challenge (weeks 30 to 67). These groups of effector CD8+ cells were cocultured with SIVmac239-infected autologous target CD8– cells at the E:T ratio of 1:1, and p27 concentrations in the culture supernatants were measured for evaluation of SIVmac239 production (Fig. 1). Reduction in SIVmac239 production by addition of each group of CD8+ cells was shown as reduction (fold) in p27 concentration compared to that in the supernatant from the SIVmac239-infected CD8– cell culture without CD8+ cells (Fig. 2A).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 1. SIVmac239 replication in vitro in the absence or the presence of CD8+ cells in macaques R00-017 (A), R00-020 (B), R00-023 (C), and R00-024 (D). PBMC-derived CD8– (target) cells infected with SIVmac239 were cultured alone (no CD8) or cocultured with autologous PBMC-derived CD8+ (effector) cells obtained prevaccination (pre-vaccination CD8), postvaccination and pre-SHIV challenge (post-vaccination CD8), in the early phase post-SHIV challenge (early post-challenge CD8), or in the chronic phase post-SHIV challenge (chronic post-challenge CD8) at an E:T ratio of 1:1. A representative result of two sets of experiments with similar patterns is shown in panels A and D, whereas the result of a single experiment is shown in panels B and C. Postvaccination and postchallenge CD8+ cells were prepared from PBMCs obtained at different time points, as shown in the bottom table (weeks before [shown by minus] or after SHIV challenge), because of a limitation of available samples. SeV-Gag vaccination was performed 13 weeks (in R00-020, R00-023, and R00-024) or 14 weeks (in R00-017) before SHIV challenge. In some groups, CD8+ cells at two time points were mixed to prepare enough cells. p27 concentrations in the culture supernatants were examined by ELISA.
|
|

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 2. Reduction in SIVmac239 production by addition of CD8+ cells. The reduction (fold) in p27 concentration in the supernatant from coculture of SIV-infected CD8– cells with each group of CD8+ cells compared to that from SIV-infected CD8– cell culture without CD8+ cells is shown. (A) Reduction in p27 concentration on days 4, 6, and 8 of coculture at an E:T ratio of 1:1 (calculated from the data in Fig. 1). (B) Reduction in p27 concentration on day 8 of coculture at an E:T ratio of 1:1 (black bars) or 1:10 (dotted bars). pre-V, prevaccination CD8; post-V, postvaccination CD8; early, early postchallenge CD8; chronic, chronic postchallenge CD8 as described in the legend to Fig. 1. ND, not determined.
|
|
Even addition of prevaccination CD8+ cells resulted in reduction of SIV production. Especially, prevaccination CD8+ cells derived from macaque R00-017 efficiently suppressed SIV replication, showing an approximately 20-fold reduction in viral production at day 8 of culture. In other three macaques, however, the reduction in SIV production by addition of prevaccination CD8+ cells was less than threefold. In macaque R00-020, postvaccination/prechallenge CD8+ cells suppressed SIV replication more efficiently than prevaccination ones, but in the other three macaques, the levels of suppression by postvaccination/prechallenge CD8+ cells were not more than those by prevaccination cells.
In contrast, CD8+ cells in the early phase postchallenge showed an efficient suppressive effect on SIV replication in all four macaques. Maximum reduction (fold) in SIV production by addition of these CD8+ cells was more than 7 x 102. Addition of CD8+ cells in the chronic phase postchallenge also resulted in efficient reduction of SIV production. The levels of reduction were lower than those by CD8+ cells in the early phase postchallenge but higher than those by prechallenge CD8+ cells. Thus, all four vaccinees, after SHIV challenge, acquired CD8+ cells able to suppress SIVmac239 replication in vitro efficiently. Efficient reduction by early postchallenge CD8+ cells was observed in some animals even at the E:T ratio of 1:10 (Fig. 2B).
We then measured SIVGP1-specific CD8+ T-cell frequencies in PBMCs by detection of IFN-
induction after stimulation with B-LCL expressing an env- and nef-deleted SHIV molecular clone (SIVGP1) DNA (27, 28) (Fig. 3). In all four macaques, SIVGP1-specific CD8+ T-cell levels peaked during the acute phase post-SHIV challenge and gradually decreased after the set point. SIVGP1-specific CD8+ T-cell frequencies after the acute phase were higher in macaques R00-017 and R00-023 compared to those post-SeV-Gag vaccination (prechallenge) but interestingly lower in macaque R00-020.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 3. SIVGP1-specific CD8+ T-cell frequencies in macaques before and after SHIV89.6PD challenge. Frequencies of CD8+ T cells showing SIVGP1-specific IFN- induction per total CD8+ T cells in PBMCs are shown. The first time point prechallenge is 10 weeks before challenge.
|
|
CD20 depletion and SIVmac239 superchallenge in the SHIV controllers.
Macaques R00-017 and R00-020 were further followed up and received monoclonal anti-CD20 antibody administration at week 166 (R00-017) or week 140 (R00-020) and SIVmac239 superchallenge at week 203 (R00-017) or week 151 (R00-020) (Table 1). Viral control was not abrogated, and plasma viremia remained undetectable after anti-CD20 antibody administration (Fig. 4). In both macaques, SHIV89.6PD-specific neutralizing antibodies (NAbs) were induced efficiently after SHIV89.6PD challenge and maintained at high levels in the chronic phase (54). The monoclonal anti-CD20 antibody administration resulted in rapid and prolonged depletion of peripheral CD20+ lymphocytes, and more than a few months later, an approximately fourfold reduction in SHIV-specific NAb levels was observed (Fig. 5).

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 4. Plasma viral loads (SIV gag RNA copies/ml plasma) in macaques R00-017 (upper panel) and R00-020 (lower panel) after week 120 post-SHIV challenge. aCD20 and aCD8, anti-CD20 and anti-CD8, respectively.
|
|

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 5. Changes in SHIV89.6PD-specific NAb levels after monoclonal anti-CD20 antibody administration at week 166 in macaque R00-017 (left panels) and at week 140 in macaque R00-020 (right panels). (A) Peripheral CD20+ cell counts (per µl). (B) SHIV89.6PD-specific neutralizing titers in plasma. aCD20 and aCD8, anti-CD20 and anti-CD8, respectively.
|
|
The following SIVmac239 superchallenge was contained in both macaques (Fig. 4). Macaque R00-017 did not show detectable plasma viremia even after SIVmac239 superchallenge, and macaque R00-020 showed only transient appearance of plasma viremia 1 week after SIVmac239 superchallenge. SIVmac239 env RNA but not SHIV89.6PD env RNA was detected in the transient plasma viremia (Fig. 6). SIVGP1-specific CD8+ T-cell frequencies were at marginal levels just before SIVmac239 superchallenge but increased after the superchallenge (Fig. 7).

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 6. SIVmac239 superchallenge and CD8+ cell depletion in macaques R00-017 and R00-020. Macaque R00-017 received SIVmac239 superchallenge at week 203 and monoclonal anti-CD8 (aCD8) antibody administration starting at week 209, while macaque R00-020 received superchallenge at week 151 and anti-CD8 at week 163. (A) Peripheral CD8+ T-cell counts (per µl) in macaques R00-017 (left panel) and R00-020 (right panel). (B) Plasma viral loads (copies/ml plasma) in macaques R00-017 (left panel) and R00-020 (right panel). In addition to SIV gag RNA levels, levels of SIV env RNA and SHIV env RNA at several time points are shown.
|
|

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 7. SIVGP1-specific CD8+ T-cell frequencies in macaques R00-017 (left panel) and R00-020 (right panel) before and after SIVmac239 superchallenge. Frequencies of CD8+ T cells showing SIVGP1-specific IFN- induction per total CD8+ T cells in PBMCs are shown. aCD8, anti-CD8.
|
|
CD8 depletion after SIVmac239 superchallenge.
Macaques R00-017 and R00-020 received monoclonal anti-CD8 antibody administration at week 209 (6 weeks after superchallenge) and week 163 (12 weeks after superchallenge), respectively (Table 1). Both macaques showed transient depletion of peripheral CD8+ T lymphocytes and appearance of plasma viremia after the anti-CD8 antibody administration (Fig. 6).
In macaque R00-020, exhibiting a shorter period of CD8+ T-lymphocyte depletion, plasma viremia was transient and detectable only at weeks 164 and 165, 1 and 2 weeks after the initial anti-CD8 antibody treatment. SIVmac239 env RNA but not SHIV89.6PD env RNA was detected in the transient plasma viremia. In macaque R00-017, exhibiting a longer period of CD8+ T-lymphocyte depletion, plasma viremia appeared at week 210, 1 week after the initial anti-CD8 antibody treatment, and remained detectable during the observation period of 3 months. Interestingly, both SIVmac239 env RNA and SHIV89.6PD env RNA were detected; the former became detectable at week 210 and was detected during the observation period, whereas the latter was detected only at weeks 211 and 212. The former SIVmac239 env RNA levels peaked at week 213, and the latter SHIV89.6PD env RNA levels peaked at week 211.
SIVmac239-specific NAb responses were undetectable even after SIVmac239 superchallenge and CD8 depletion in both of the macaques (data not shown). SHIV89.6PD-specific NAb titers increased after the CD8 depletion not only in macaque R00-017 showing SHIV89.6PD viremia but also in macaque R00-020 without SHIV89.6PD viremia (Fig. 5). Both macaques showed increases in SIVGP1-specific CD8+ T-cell frequencies after recovery from peripheral CD8+ T-lymphocyte depletion (Fig. 7).
 |
DISCUSSION
|
|---|
Previous CD8+ cell depletion experiments in macaques using a monoclonal anti-CD8 antibody have indicated the importance of CD8+ cell responses in SIV control in vivo (12, 29, 42). The present study evaluated the anti-SIV efficacy of these bulk CD8+ cells in the vaccinated macaques that exhibited prophylactic SeV-Gag vaccine-based control of viral replication and showed induction of CD8+ cells able to efficiently suppress SIV replication in vitro after SHIV challenge in these macaques. The difference in anti-SIV efficacies between postvaccination/prechallenge and postchallenge CD8+ cells may explain why protective immune responses can be consistently induced not by current viral vector vaccination but by live virus infection.
These bulk CD8+ cells are considered to include CD8+ NK cells in addition to CD8+ T lymphocytes. While previous studies using bulk CD8+ cells or CTL clones (9, 24, 48, 55) have shown the importance of CTL activity on suppression of HIV/SIV replication, there may be a possibility that NK cells exert some suppressive effect on SIV replication, contributing to reductions in SIV production by prevaccination CD8+ cells in the present study. The suppressive effect of postvaccination/prechallenge CD8+ cells was not larger than that of prevaccination except for macaque R00-020. In contrast, postchallenge CD8+ cells suppressed SIV replication more efficiently than those prevaccination and postvaccination. In the in vitro assay of SIV replication, individual macaques showed different sensitivities of target CD8– cells to SIV infection and different patterns of SIV replication kinetics in the absence of CD8+ cells (Fig. 1). In macaque R00-023 showing higher levels of SIV production in the absence of CD8+ cells, SIV infection at a lower MOI might exhibit a larger reduction in SIV production by addition of postchallenge CD8+ cells.
Gag-specific CD8+ T-cell levels peaked around 1 week after SeV-Gag vaccination and then decreased in the late phase after that (28). To prepare postvaccination/prechallenge CD8+ cells, we used PBMCs in the late phase without those at week 1 post-SeV-Gag vaccination that include the peak levels of Gag-specific CD8+ T cells. Thus, we compared anti-SIV efficacy of CD8+ cells in the late phase postvaccination with that in the chronic phase post-SHIV challenge in this study. The postvaccination/prechallenge SIVGP1-specific CD8+ T-cell frequencies roughly reflect Gag-specific CD8+ T-cell ones because SIVGP1-specific CD8+ T-cell responses were undetectable before SeV-Gag vaccination (data not shown). On the other hand, the postchallenge SIVGP1-specific CD8+ T-cell responses are considered specific for SHIV antigens, including SIV-derived Gag, Pol, Vif, and partial Vpr. Therefore, our results shown in Fig. 3 suggest that SIV-specific CD8+ T-cell frequencies in the chronic phase post-SHIV challenge were less than those post-SeV-Gag vaccination (prechallenge) in macaque R00-020. Interestingly, however, such postchallenge CD8+ cells suppressed SIV replication more efficiently than postvaccination/prechallenge ones. Thus, SIV-specific CD8+ T-cell frequencies may not always correlate with anti-SIV efficacy in vitro. It may be because postchallenge-induced, certain epitope-specific CD8+ T cells may have higher anti-SIV efficacy in vitro than postvaccination/prechallenge CD8+ T cells in this macaque. There may be a possibility of augmentation of anti-SIV efficacy by induction of broader CD8+ T-cell responses after SHIV challenge.
A previous CD8+ cell depletion study in macaques infected with live attenuated SIV has shown partial loss of superchallenged SIVmac251 control by monoclonal anti-CD8 antibody administration at the superchallenge and has suggested involvement of both cellular and humoral immune responses in this control (43). On the other hand, administration of monoclonal anti-CD8 antibody to macaques infected with live attenuated SIVmac239
nef after SIVmac251 superchallenge resulted in the appearance of SIVmac239
nef viremia without detectable SIVmac251 viremia (33). In contrast, the present study showed the appearance of superchallenged SIVmac239 viremia by monoclonal anti-CD8 antibody administration after superchallenge, suggesting that CD8+ cells were crucial for the control of superchallenged SIVmac239 replication. It can be speculated that, in SIVmac239
nef-infected animals, live virus replication levels before superchallenge were higher, resulting in more strict containment of superchallenge than that in our study. Additionally, neutralizing antibody responses may be involved in the containment of superchallenge in SIVmac239
nef-infected animals but not in SHIV-infected ones. Thus, our results imply a more profound contribution of CD8+ cells to control of SIV superchallenge in the absence of NAb help.
More than a few months after the anti-CD20 antibody administration, both macaques R00-017 and R00-020 showed fourfold reductions in SHIV-specific neutralizing titers, although it is unclear if these reductions were due to the CD20+ cell depletion. Macaque R00-017 with a lower neutralizing titer showed transient appearance of SHIV viremia by CD8+ cell depletion, but macaque R00-020 with a higher titer did not. These results were consistent with the previous study indicating involvement of humoral as well as cellular immune responses in the CXCR4-tropic SHIV control (26).
In summary, our results indicate that CD8+ cells acquired the ability to efficiently suppress CCR5-tropic SIV replication in vitro by controlled CXCR4-tropic SHIV infection. While the levels of in vitro anti-SIV efficacy resulting in SIV control in vivo have not been determined, our results imply that such CD8+ cell responses may be crucial for live attenuated vaccine-based containment of HIV/SIV superinfection.
 |
ACKNOWLEDGMENTS
|
|---|
This work was supported by a grant from the Ministry of Education, Culture, Sports, Science, and Technology; grants from the Japan Health Sciences Foundation; and grants from the Ministry of Health, Labor, and Welfare in Japan.
The animal experiments were conducted through the Cooperative Research Program at the Tsukuba Primate Research Center, National Institute of Biomedical Innovation, with the help of the Corporation for Production and Research of Laboratory Primates. We thank Centocor, Inc., and K. A. Reimann for providing cM-T807 and M. Takiguchi, F. Ono, K. Komatsuzaki, A. Hiyaoka, A. Oyama, K. Oto, H. Akari, K. Terao, M. Miyazawa, A. Kimura, K. Mori, N. Yamamoto, T. Sata, T. Kurata, Y. Nagai, and A. Nomoto for their help.
 |
FOOTNOTES
|
|---|
* Corresponding author. Mailing address: International Research Center for Infectious Diseases, The Institute of Medical Science, The University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108-8639, Japan. Phone: 81-3-6409-2078. Fax: 81-3-6409-2076. E-mail: matano{at}m.u-tokyo.ac.jp 
Published ahead of print on 29 August 2007. 
T.T. and M.Y. contributed equally to this work. 
 |
REFERENCES
|
|---|
- Altfeld, M., and E. S. Rosenberg. 2000. The role of CD4+ T helper cells in the cytotoxic T lymphocyte response to HIV-1. Curr. Opin. Immunol. 12:375-380.[CrossRef][Medline]
- Amara, R. R., F. Villinger, J. D. Altman, S. L. Lydy, S. P. O'Neil, S. I. Staprans, D. C. Montefiori, Y. Xu, J. G. Herndon, L. S. Wyatt, M. A. Candido, N. L. Kozyr, P. L. Earl, J. M. Smith, H. L. Ma, B. D. Grimm, M. L. Hulsey, J. Miller, H. M. McClure, J. M. McNicholl, B. Moss, and H. L. Robinson. 2001. Control of a mucosal challenge and prevention of AIDS in rhesus macaques by a multiprotein DNA/MVA vaccine. Science 292:69-74.[CrossRef][Medline]
- Baba, T. W., Y. S. Jeong, D. Pennick, R. Bronson, M. F. Greene, and R. M. Ruprecht. 1995. Pathogenicity of live, attenuated SIV after mucosal infection of neonatal macaques. Science 267:1820-1825.[Abstract/Free Full Text]
- Borrow, P., H. Lewicki, B. H. Hahn, G. M. Shaw, and M. B. A. Oldstone. 1994. Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. J. Virol. 68:6103-6110.[Abstract/Free Full Text]
- Brander, C., and B. D. Walker. 1999. T lymphocyte responses in HIV-1 infection: implication for vaccine development. Curr. Opin. Immunol. 11:451-459.[CrossRef][Medline]
- Casimiro, D. R., F. Wang, W. A. Schleif, X. Liang, Z.-Q. Zhang, T. W. Tobery, M.-E. Davies, A. B. McDermott, D. H. O'Connor, A. Fridman, A. Bagchi, L. G. Tussey, A. J. Bett, A. C. Finnefrock, T.-M. Fu, A. Tang, K. A. Wilson, M. Chen, H. C. Perry, G. J. Heidecker, D. C. Freed, A. Carella, K. S. Punt, K. J. Sykes, L. Huang, V. I. Ausensi, M. Bachinsky, U. Sadasivan-Nair, D. I. Watkins, E. A. Emini, and J. W. Shiver. 2005. Attenuation of simian immunodeficiency virus SIVmac239 infection by prophylactic immunization with DNA and recombinant adenoviral vaccine vectors expressing Gag. J. Virol. 79:15547-15555.[Abstract/Free Full Text]
- Daniel, M. D., F. Kirchhoff, S. C. Czajak, P. K. Sehgal, and R. C. Desrosiers. 1992. Protective effects of a live attenuated SIV vaccine with a deletion in the nef gene. Science 258:1938-1941.[Abstract/Free Full Text]
- Feinberg, M. B., and J. P. Moore. 2002. AIDS vaccine models: challenging challenge viruses. Nat. Med. 8:207-210.[CrossRef][Medline]
- Gauduin, M.-C., R. L. Glickman, R. Means, and R. P. Johnson. 1998. Inhibition of simian immunodeficiency virus (SIV) replication by CD8+ T lymphocytes from macaques immunized with live attenuated SIV. J. Virol. 72:6315-6324.[Abstract/Free Full Text]
- Goulder, P. J., and D. I. Watkins. 2004. HIV and SIV CTL escape: implications for vaccine design. Nat. Rev. Immunol. 4:630-640.[CrossRef][Medline]
- Horton, H., T. U. Vogel, D. K. Carter, K. Vielhuber, D. H. Fuller, T. Shipley, J. T. Fuller, K. J. Kunstman, G. Sutter, D. C. Montefiori, V. Erfle, R. C. Desrosiers, N. Wilson, L. J. Picker, S. M. Wolinsky, C. Wang, D. B. Allison, and D. I. Watkins. 2002. Immunization of rhesus macaques with a DNA prime/modified vaccinia virus Ankara boost regimen induces broad simian immunodeficiency virus (SIV)-specific T-cell responses and reduces initial viral replication but does not prevent disease progression following challenge with pathogenic SIVmac239. J. Virol. 76:7187-7202.[Abstract/Free Full Text]
- Jin, X., D. E. Bauer, S. E. Tuttleton, S. Lewin, A. Gettie, J. Blanchard, C. E. Irwin, J. T. Safrit, J. Mittler, L. Weinberger, L. G. Kostrikis, L. Zhang, A. S. Perelson, and D. D. Ho. 1999. Dramatic rise in plasma viremia after CD8+ T cell depletion in simian immunodeficiency virus-infected macaques. J. Exp. Med. 189:991-998.[Abstract/Free Full Text]
- Johnson, R. P., and R. C. Desrosiers. 1998. Protective immunity induced by live attenuated simian immunodeficiency virus. Curr. Opin. Immunol. 10:436-443.[CrossRef][Medline]
- Johnson, R. P., J. D. Lifson, S. C. Czajak, K. S. Cole, K. H. Manson, R. Glickman, J. Yang, D. C. Montefiori, R. Montelaro, M. S. Wyand, and R. C. Desrosiers. 1999. Highly attenuated vaccine strains of simian immunodeficiency virus protect against vaginal challenge: inverse relationship of degree of protection with level of attenuation. J. Virol. 73:4952-4961.[Abstract/Free Full Text]
- Kano, M., T. Matano, A. Kato, H. Nakamura, A. Takeda, Y. Suzaki, Y. Ami, K. Terao, and Y. Nagai. 2002. Primary replication of a recombinant Sendai virus vector in macaques. J. Gen. Virol. 83:1377-1386.[Abstract/Free Full Text]
- Kato, A., Y. Sakai, T. Shioda, T. Kondo, M. Nakanishi, and Y. Nagai. 1996. Initiation of Sendai virus multiplication from transfected cDNA or RNA with negative or positive sense. Genes Cells 1:569-579.[Abstract]
- Kawada, M., T. Tsukamoto, H. Yamamoto, A. Takeda, H. Igarashi, D. I. Watkins, and T. Matano. 2007. Long-term control of simian immunodeficiency virus replication with central memory CD4+ T-cell preservation after nonsterile protection by a cytotoxic T-lymphocyte-based vaccine. J. Virol. 81:5202-5211.[Abstract/Free Full Text]
- Kestler, H. W., III, D. J. Ringler, K. Mori, D. L. Panicali, P. K. Sehgal, M. D. Daniel, and R. C. Desrosiers. 1991. Importance of the nef gene for maintenance of high virus loads and for development of AIDS. Cell 65:651-662.[CrossRef][Medline]
- Koff, W. C., P. R. Johnson, D. I. Watkins, D. R. Burton, J. D. Lifson, K. J. Hasenkrug, A. B. McDermott, A. Schultz, T. J. Zamb, R. Boyle, and R. C. Desrosiers. 2006. HIV vaccine design: insights from live attenuated SIV vaccines. Nat. Immunol. 7:19-23.[CrossRef][Medline]
- Koup, R. A., J. T. Safrit, Y. Cao, C. A. Andrews, G. McLeod, W. Borkowsky, C. Farthing, and D. D. Ho. 1994. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. J. Virol. 68:4650-4655.[Abstract/Free Full Text]
- Letvin, N. L., J. R. Mascola, Y. Sun, D. A. Gorgone, A. P. Buzby, L. Xu, Z. Y. Yang, B. Chakrabarti, S. S. Rao, J. E. Schmitz, D. C. Montefiori, B. R. Barker, F. L. Bookstein, and G. J. Nabel. 2006. Preserved CD4+ central memory T cells and survival in vaccinated SIV-challenged monkeys. Science 312:1530-1533.[Abstract/Free Full Text]
- Li, H.-O., Y.-F. Zhu, M. Asakawa, H. Kuma, T. Hirata, Y. Ueda, Y.-S. Lee, M. Fukumura, A. Iida, A. Kato, Y. Nagai, and M. Hasegawa. 2000. A cytoplasmic RNA vector derived from nontransmissible Sendai virus with efficient gene transfer and expression. J. Virol. 74:6564-6569.[Abstract/Free Full Text]
- Li, Q., L. Duan, J. D. Estes, Z. M. Ma, T. Rourke, Y. Wang, C. Reilly, J. Carlis, C. J. Miller, and A. T. Haase. 2005. Peak SIV replication in resting memory CD4+ T cells depletes gut lamina propria CD4+ T cells. Nature 434:1148-1152.[Medline]
- Loffredo, J. T., E. G. Rakasz, J. P. Giraldo, S. P. Spencer, K. K. Grafton, S. R. Martin, G. Napoé, L. J. Yant, N. A. Wilson, and D. I. Watkins. 2005. Tat28-35SL8-specific CD8+ T lymphocytes are more effective than Gag181-189CM9-specific CD8+ T lymphocytes at suppressing simian immunodeficiency virus replication in a functional in vitro assay. J. Virol. 79:14986-14991.[Abstract/Free Full Text]
- Lu, Y., C. D. Pauza, X. Lu, D. C. Montefiori, and C. J. Miller. 1998. Rhesus macaques that become systemically infected with pathogenic SHIV 89.6-PD after intravenous, rectal, or vaginal inoculation and fail to make an antiviral antibody response rapidly develop AIDS. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 19:6-18.[Medline]
- Mao, H., B. A. P. Lafont, T. Igarashi, Y. Nishimura, C. Brown, V. Hirsch, A. Buckler-White, R. Sadjadpour, and M. A. Martin. 2005. CD8+ and CD20+ lymphocytes cooperate to control acute simian immunodeficiency virus/human immunodeficiency virus chimeric virus infections in rhesus monkeys: modulation by major histocompatibility complex genotype. J. Virol. 79:14887-14898.[Abstract/Free Full Text]
- Matano, T., M. Kano, H. Nakamura, A. Takeda, and Y. Nagai. 2001. Rapid appearance of secondary immune responses and protection from acute CD4 depletion after a highly pathogenic immunodeficiency virus challenge in macaques vaccinated with a DNA prime/Sendai viral vector boost regimen. J. Virol. 75:11891-11896.[Abstract/Free Full Text]
- Matano, T., M. Kobayashi, H. Igarashi, A. Takeda, H. Nakamura, M. Kano, C. Sugimoto, K. Mori, A. Iida, T. Hirata, M. Hasegawa, T. Yuasa, M. Miyazawa, Y. Takahashi, M. Yasunami, A. Kimura, D. H. O'Connor, D. I. Watkins, and Y. Nagai. 2004. Cytotoxic T lymphocyte-based control of simian immunodeficiency virus replication in a preclinical AIDS vaccine trial. J. Exp. Med. 199:1709-1718.[Abstract/Free Full Text]
- Matano, T., R. Shibata, C. Siemon, M. Connors, H. C. Lane, and M. A. Martin. 1998. Administration of an anti-CD8 monoclonal antibody interferes with the clearance of chimeric simian/human immunodeficiency virus during primary infections of rhesus macaques. J. Virol. 72:164-169.[Abstract/Free Full Text]
- Mattapallil, J. J., D. C. Douek, A. Buckler-White, D. C. Montefiori, N. L. Letvin, G. J. Nabel, and M. Roederer. 2006. Vaccination preserves CD4 memory T cells during acute simian immunodeficiency virus challenge. J. Exp. Med. 203:1533-1541.[Abstract/Free Full Text]
- Mattapallil, J. J., D. C. Douek, B. Hill, Y. Nishimura, M. A. Martin, and M. Roederer. 2005. Massive infection and loss of memory CD4+ T cells in multiple tissues during acute SIV infection. Nature 434:1093-1097.[CrossRef][Medline]
- McMichael, A. J., and T. Hanke. 2003. HIV vaccines 1983-2003. Nat. Med. 9:874-880.[CrossRef][Medline]
- Metzner, K. J., X. Jin, F. V. Lee, A. Gettie, D. E. Bauer, M. D. Mascio, A. S. Perelson, P. A. Marx, D. D. Ho, L. G. Kostrikis, and R. I. Connor. 1999. Effects of in vivo CD8+ T cell depletion on virus replication in rhesus macaques immunized with a live, attenuated simian immunodeficiency virus vaccine. J. Exp. Med. 191:1921-1932.[Abstract/Free Full Text]
- Miller, C. J., and K. Abel. 2005. Immune mechanisms associated with protection from vaginal SIV challenge in rhesus monkeys infected with virulence-attenuated SHIV 89.6. J. Med. Primatol. 34:271-281.[CrossRef][Medline]
- Miller, C. J., M. B. McChesney, X. Lü, P. J. Dailey, C. Chutkowski, D. Lu, P. Brosio, B. Roberts, and Y. Lu. 1997. Rhesus macaques previously infected with simian/human immunodeficiency virus are protected from vaginal challenge with pathogenic SIVmac239. J. Virol. 71:1911-1921.[Abstract]
- National Institute of Infectious Diseases. 2007. Guides for animal experiments performed at National Institute of Infectious Diseases. National Institute of Infectious Diseases, Tokyo, Japan. (In Japanese).
- Nishimura, Y., C. R. Brown, J. J. Mattapallil, T. Igarashi, A. Buckler-White, B. A. Lafont, V. M. Hirsch, M. Roederer, and M. A. Martin. 2005. Resting naive CD4+ T cells are massively infected and eliminated by X4-tropic simian-human immunodeficiency viruses in macaques. Proc. Natl. Acad. Sci. USA 102:8000-8005.[Abstract/Free Full Text]
- Nishimura, Y., T. Igarashi, O. K. Donau, A. Buckler-White, C. Buckler, B. A. Lafont, R. M. Goeken, S. Goldstein, V. M. Hirsch, and M. A. Martin. 2004. Highly pathogenic SHIVs and SIVs target different CD4+ T cell subsets in rhesus monkeys, explaining their divergent clinical courses. Proc. Natl. Acad. Sci. USA 101:12324-12329.[Abstract/Free Full Text]
- Ogg, G. S., X. Jin, S. Bonhoeffer, P. R. Dunbar, M. A. Nowak, S. Monard, J. P. Segal, Y. Cao, S. L. Rowland-Jones, V. Cerundolo, A. Hurley, M. Markowitz, D. D. Ho, D. F. Nixon, and A. J. McMichael. 1998. Quantitation of HIV-1-specific cytotoxic T lymphocytes and plasma load of viral RNA. Science 279:2103-2106.[Abstract/Free Full Text]
- Picker, L. J., and D. I. Watkins. 2005. HIV pathogenesis: the first cut is the deepest. Nat. Immunol. 6:430-432.[CrossRef][Medline]
- Rose, N. F., P. A. Marx, A. Luckay, D. F. Nixon, W. J. Moretto, S. M. Donahoe, D. Montefiori, A. Roberts, L. Buonocore, and J. K. Rose. 2001. An effective AIDS vaccine based on live attenuated vesicular stomatitis virus recombinants. Cell 106:539-549.[CrossRef][Medline]
- Rosenberg, E. S., J. M. Billingsley, A. M. Caliendo, S. L. Boswell, P. E. Sax, S. A. Kalams, and B. D. Walker. 1997. Vigorous HIV-1-specific CD4+ T cell responses associated with control of viremia. Science 278:1447-1450.[Abstract/Free Full Text]
- Schmitz, J. E., M. J. Kuroda, S. Santra, V. G. Sasseville, M. A. Simon, M. A. Lifton, P. Racz, K. Tenner-Racz, M. Dalesandro, B. J. Scallon, J. Ghrayeb, M. A. Forman, D. C. Montefiori, E. P. Rieber, N. L. Letvin, and K. A. Reimann. 1999. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science 283:857-860.[Abstract/Free Full Text]
- Schmitz, J. E., R. P. Johnson, H. M. McClure, K. H. Manson, M. S. Wyand, M. J. Kuroda, M. A. Lifton, R. S. Khunkhun, K. J. McEvers, J. Gillis, M. Piatak, J. D. Lifson, G. Grosschupff, P. Racz, K. Tenner-Racz, E. P. Rieber, K. Kuus-Reichel, R. S. Gelman, N. L. Letvin, D. C. Montefiori, R. M. Ruprecht, R. C. Desrosiers, and K. A. Reimann. 2005. Effect of CD8+ lymphocyte depletion on virus containment after simian immunodeficiency virus SIVmac251 challenge of live attenuated SIVmac239
3-vaccinated rhesus macaques. J. Virol. 79:8131-8141.[Abstract/Free Full Text] - Shibata, R., C. Siemon, S. C. Czajak, R. C. Desrosiers, and M. A. Martin. 1997. Live, attenuated simian immunodeficiency virus vaccines elicit potent resistance against a challenge with a human immunodeficiency virus type 1 chimeric virus. J. Virol. 71:8141-8148.[Abstract]
- Shibata, R., F. Maldarelli, C. Siemon, T. Matano, M. Parta, G. Miller, T. Fredrickson, and M. A. Martin. 1997. Infection and pathogenicity of chimeric simian-human immunodeficiency viruses in macaques: determinants of high virus loads and CD4 cell killing. J. Infect. Dis. 176:362-373.[Medline]
- Shiver, J. W., T. M. Fu, L. Chen, D. R. Casimiro, M. E. Davies, R. K. Evans, Z. Q. Zhang, A. J. Simon, W. L. Trigona, S. A. Dubey, L. Huang, V. A. Harris, R. S. Long, X. Liang, L. Handt, W. A. Schleif, L. Zhu, D. C. Freed, N. V. Persaud, L. Guan, K. S. Punt, A. Tang, M. Chen, K. A. Wilson, K. B. Collins, G. J. Heidecker, V. R. Fernandez, H. C. Perry, J. G. Joyce, K. M. Grimm, J. C. Cook, P. M. Keller, D. S. Kresock, H. Mach, R. D. Troutman, L. A. Isopi, D. M. Williams, Z. Xu, K. E. Bohannon, D. B. Volkin, D. C. Montefiori, A. Miura, G. R. Krivulka, M. A. Lifton, M. J. Kuroda, J. E. Schmitz, N. L. Letvin, M. J. Caulfield, A. J. Bett, R. Youil, D. C. Kaslow, and E. A. Emini. 2002. Replication-incompetent adenoviral vaccine vector elicits effective anti-immunodeficiency-virus immunity. Nature 415:331-335.[CrossRef][Medline]
- Takeda, A., H. Igarashi, H. Nakamura, M. Kano, A. Iida, T. Hirata, M. Hasegawa, Y. Nagai, and T. Matano. 2003. Protective efficacy of an AIDS vaccine, a single DNA priming followed by a single booster with a recombinant replication-defective Sendai virus vector, in a macaque AIDS model. J. Virol. 77:9710-9715.[Abstract/Free Full Text]
- Tomiyama, H., M. Fujiwara, S. Oka, and M. Takiguchi. 2005. Epitope-dependent effect of Nef-mediated HLA class I down-regulation on ability of HIV-1-specific CTLs to suppress HIV-1 replication. J. Immunol. 174:36-40.[Abstract/Free Full Text]
- Veazey, R. S., K. G. Mansfield, I. C. Tham, A. C. Carville, D. E. Shvetz, A. E. Forand, and A. A. Lackner. 2000. Dynamics of CCR5 expression by CD4+ T cells in lymphoid tissues during simian immunodeficiency virus infection. J. Virol. 74:11001-11007.[Abstract/Free Full Text]
- Veazey, R. S., M. DeMaria, L. V. Chalifoux, D. E. Shvetz, D. R. Pauley, H. L. Knight, M. Rosenzweig, R. P. Johnson, R. C. Desrosiers, and A. A. Lackner. 1998. Gastrointestinal tract as a major site of CD4+ T cell depletion and viral replication in SIV infection. Science 280:427-431.[Abstract/Free Full Text]
- Voss, G., S. Nick, C. Stahl-Hennig, K. Ritter, and G. Hunsmann. 1992. Generation of macaque B lymphoblastoid cell lines with simian Epstein-Barr-like viruses: transformation procedure, characterization of the cell lines and occurrence of simian foamy virus. J. Virol. Methods 39:185-195.[CrossRef][Medline]
- Wilson, N. A., J. Reed, G. S. Napoe, S. Piaskowski, A. Szymanski, J. Furlott, E. J. Gonzalez, L. J. Yant, N. J. Maness, G. E. May, T. Soma, M. R. Reynolds, E. Rakasz, R. Rudersdorf, A. B. McDermott, D. H. O'Connor, T. C. Friedrich, D. B. Allison, A. Patki, L. J. Picker, D. R. Burton, J. Lin, L. Huang, D. Patel, G. Heindecker, J. Fan, M. Citron, M. Horton, F. Wang, X. Liang, J. W. Shiver, D. R. Casimiro, and D. I. Watkins. 2006. Vaccine-induced cellular immune responses reduce plasma viral concentrations after repeated low-dose challenge with pathogenic simian immunodeficiency virus SIVmac239. J. Virol. 80:5875-5885.[Abstract/Free Full Text]
- Wyand, M. S., K. H. Manson, M. Garcia-Moll, D. C. Montefiori, and R. C. Desrosiers. 1996. Vaccine protection by a triple deletion mutant of simian immunodeficiency virus. J. Virol. 70:3724-3733.[Abstract]
- Yamamoto, H., M. Kawada, T. Tsukamoto, A. Takeda, H. Igarashi, M. Miyazawa, T. Naruse, M. Yasunami, A. Kimura, and T. Matano. 2007. Vaccine-based, long-term, stable control of simian/human immunodeficiency virus 89.6PD replication in rhesus macaques. J. Gen. Virol. 88:652-659.[Abstract/Free Full Text]
- Yang, O. O., S. A. Kalams, A. Trocha, H. Cao, A. Luster, R. P. Johnson, and B. D. Walker. 1997. Suppression of human immunodeficiency virus type 1 replication by CD8+ cells: evidence for HLA class I-restricted triggering of cytolytic and noncytolytic mechanisms. J. Virol. 71:3120-3128.[Abstract]
Journal of Virology, November 2007, p. 11640-11649, Vol. 81, No. 21
0022-538X/07/$08.00+0 doi:10.1128/JVI.01475-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.