Previous Article
Journal of Virology, October 2007, p. 11549-11552, Vol. 81, No. 20
0022-538X/07/$08.00+0 doi:10.1128/JVI.00960-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Human Immunodeficiency Virus Type 1 Derivative with 7% Simian Immunodeficiency Virus Genetic Content Is Able To Establish Infections in Pig-Tailed Macaques
Tatsuhiko Igarashi,1
Ranjini Iyengar,1
Russel A. Byrum,2
Alicia Buckler-White,1
Robin L. Dewar,3
Charles E. Buckler,1
H. Clifford Lane,4
Kazuya Kamada,5
Akio Adachi,5 and
Malcolm A. Martin1*
Laboratory of Molecular Microbiology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland 20892,1
Bioqual, Rockville, Maryland 20850,2
Science Applications International Corporation—Frederick, Inc., Frederick, Maryland 21702,3
Laboratory of Immunoregulation, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland 20892,4
Department of Virology, Institute of Health Biosciences, The University of Tokushima Graduate School, Tokushima-shi, Tokushima 770-8503, Japan5
Received 3 May 2007/
Accepted 23 July 2007
 |
ABSTRACT
|
|---|
A human immunodeficiency virus type 1 (HIV-1) derivative (HIVNL-DT5R) containing sequences encoding a 7-amino-acid segment of CA and the entire vif gene from simian immunodeficiency virus (SIV) was previously shown to establish spreading infections in cultured macaque peripheral blood mononuclear cells. To assess its replicative and disease-inducing properties in vivo, HIVNL-DT5R was inoculated into pig-tailed macaques. HIVNL-DT5R generated plasma viremia in all five of the monkeys and elicited humoral responses against all of the HIV-1 structural proteins but did not cause CD4+ T-lymphocyte depletion or clinical disease. Additional adaptation will be required to optimize infectivity in vivo.
 |
TEXT
|
|---|
Because the host range of human immunodeficiency virus type 1 (HIV-1) is restricted to chimpanzees and humans, alternative systems such as the simian immunodeficiency virus (SIV) and simian/human immunodeficiency virus (SHIV)/macaque models have been developed and used extensively for vaccine and pathogenesis studies. However, both of these HIV-1 surrogates have shortcomings that diminish their usefulness as substitutes for HIV-1 in vivo. For example, although SIV has a genomic organization very similar to that of HIV-1, it elicits distinctive cellular and humoral immune responses that are SIV specific and exhibits sensitivities to antiretroviral drugs that are not observed for HIV-1 (26). SHIVs, which contain the HIV-1 tat, rev, vpu, and env genes inserted into the SIV genetic background, have been utilized in vaccine experiments to evaluate cellular immune responses directed against SIV Gag and humoral responses directed against the HIV-1 envelope glycoprotein (1, 2, 17, 18). The absence of the other HIV-1 genes in SHIV genomes precludes an evaluation of these virus-encoded proteins during progeny virus production or as antiviral targets in vivo.
We recently reported the construction and characterization of an HIV-1 derivative, designated HIV-1NL-DT5R, which contains a 21-nucleotide SIV Gag CA element and the entire SIV vif gene inserted into the genetic background of HIV-1NL4-3 (12). HIV-1NL-DT5R was able to establish spreading infections in a cynomolgus monkey T-cell line and CD8-depleted peripheral blood mononuclear cells (PBMC) from pig-tailed macaques and rhesus monkeys. Those experiments indicated that the presence of a total of 666 SIV nucleotides (6.7%) at these two specific locations within the full-length 9,894-nucleotide HIV-1 genome was sufficient to counteract innate restriction factors residing in simian cells, such as APOBEC3 and TRIM5
family members, which otherwise block HIV-1 replication (23, 24). Another recently described HIV-1 derivative (stHIV-1), which contains the entire SIV CA and Vif coding sequences, exhibited similar replication properties in macaque PBMC (6).
To ascertain whether the observed infectivity of HIV-1NL-DT5R for cultured macaque PBMC could be extended to virus-inoculated monkeys, an animal challenge stock was first prepared from CD8+ T-cell-depleted pig-tailed macaque PBMC, infected with supernatant from 293T cells transfected with pNL-DT5R DNA (12). Virus released into the culture medium on days 8 and 9 postinfection (p.i.) was pooled, and the infectivity of the resulting HIV-1NL-DT5R stock was determined to be 1.9 x 105 50% tissue culture infective doses (TCID50)/ml, as measured in human T-lymphoid MT4 cells (5). Four pig-tailed macaques were inoculated intravenously with 1.9 x 106 TCID50 of virus. Animals were maintained in accordance with the guidelines of the Committee on Care and Use of Laboratory Animals (17a) and were housed in a biosafety level 2 facility; biosafety level 3 practices were followed. Two animals (A3P027 and A4P004) were treated with anti-human CD8 monoclonal antibody (MAb) cM-T807 on days 1 (10 mg/kg of body weight, subcutaneously), 4, and 7 (5 mg/kg, intravenously each day) p.i. to suppress the induction of early antiviral cellular immunity (21). Two monkeys (A3P017 and A3P023) were not treated with cM-T807. Virus replication was determined by measuring the levels of plasma HIV-1NL-DT5R RNA using real-time PCR with the following primers/probes specific for the HIV-1NL4-3 pol gene: PNLPOL1 forward primer (GCAGTTCATGTAGCCAGTGGATAT at 4455 to 4478), PNLPOL1 reverse primer (TGGTGAAATTGCTGCCATTG at 4596 to 4577), and PNLPOL1 probe (CAGAGACAGGGCAAGAAACAGCATACTTCC at 4501 to 4530) as previously described (3). The number of circulating CD4+ T cells was monitored as a marker for virus-induced pathogenesis as described previously (3).
HIV-1NL-DT5R productive infections were established in all four animals with peak plasma viral loads ranging from 5.6 x 103 to 3.5 x 104 RNA copies/ml (Fig. 1A). No substantial difference was observed in the levels of peak viremia in the untreated and anti-CD8 MAb-treated monkeys. Plasma viral loads declined rapidly in the two untreated macaques and became undetectable by week 5 p.i. Viremia in the two animals treated with the cM-T807 MAb was maintained until weeks 10 to 11 at which point it fell below the limits of detection (200 viral RNA copies/ml). The prolonged viremia in the anti-CD8 MAb-treated macaques did not appear to reflect protracted suppression of CD8+ T lymphocytes, since they returned to preinfection levels by week 2 postinoculation (data not shown). Although all four HIV-1NL-DT5R-infected monkeys experienced modest declines in the numbers of circulating CD4+ T lymphocytes during the initial weeks of the acute infection, presumably due to trafficking of T cells into lymphoid tissues, their levels rapidly returned to preinoculation values by week 5 p.i. (Fig. 1B). No evidence of clinical disease was observed in any of the virus-inoculated macaques during the first 6 months of their HIV-1NL-DT5R infections.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 1. Profiles of plasma viral RNA loads (A) and circulating CD4+ T lymphocytes (B) in four pig-tailed macaques inoculated intravenously with 1.9 x 106 TCID50 of HIV-1NL-DT5R and those of a single animal recipient of whole blood and lymph node cells prepared from the former four animals (C). The detection limit of our reverse transcription-PCR assay is 200 RNA copies/ml, and undetectable values are plotted as 100 RNA copies/ml of plasma.
|
|
Extensive passaging of primate lentiviruses with impaired infectivities, both in vitro or in vivo, has resulted in the acquisition of genetic changes conferring augmented replicative properties (4, 8, 11, 13, 19, 22, 25). As an initial step in such a process, a starting virus inoculum was prepared by collecting lymph node and peripheral blood samples from each of the four HIV-1NL-DT5R-infected monkeys at week 5 p.i. Lymph node cells (7.5 x 107 cells) were suspended in 20 ml of pooled whole blood, and the mixture was inoculated intravenously into another pig-tailed macaque (A3P024). This animal was treated with the anti-CD8 MAb on days 1, 4, and 7 at the same doses and routes as two of the monkeys in the initial infection. The plasma viral RNA levels in the recipient macaque peaked (1.9 x 104 RNA copies/ml) at week 2.4 p.i. and then rapidly declined, becoming undetectable at week 6 p.i. (Fig. 1C). The numbers of circulating CD4+ T lymphocytes did not change appreciably during the initial 20 weeks of infection, and macaque A3P024 has thus far remained asymptomatic.
The infected monkeys responded to HIV-1NL-DT5R challenge by producing virus-specific antibodies as measured by immunoblotting of plasma samples collected during the initial 24 weeks of infection (Fig. 2). Commercially available diagnostic HIV-1 Western blotting strips (Cambridge Biotech HIV-1 Western blot kit; Maxim Biomedical Inc., Rockville, MD) were employed, and a plasma sample from an HIV-1-infected individual served as a positive control. The use of a different production lot of blotting strips resulted in the variability observed with samples from monkey A3P017 (Fig. 2). All the HIVNL-DT5R-infected animals, regardless of anti-CD8 treatment, produced antibodies directed against HIV-1-encoded p17, p24, gp41, gp120, and gp160 (anti-gp160 as early as week 2 p.i. in macaque A4P004), and four of the five animals (A3P017, A3P027, A4P004, and A3P024) generated antibody against the HIV-1 p66 reverse transcriptase. In all five animals, the band intensities for each viral protein were maintained or increased over time, suggesting sustained virus replication, even after plasma viral RNA loads fell below the level of detection (Fig. 1). The weaker reactivity of plasma samples from monkey A3P023 was consistent with the lower values obtained with a commercially available enzyme-linked immunosorbent assay kit (Vironostika HIV-1 Microelisa system; bioMerieux Inc., Durham, NC) (data not shown).

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 2. Profiles of anti-HIV-1 antibody responses in pig-tailed macaques infected with HIV-1NL-DT5R. Commercially available diagnostic HIV-1 Western blotting strips (Cambridge Biotech Western blot kit) were employed using a 1:68 dilution of pig-tailed macaque plasma samples. Normal human plasma was used as a negative control. Plasma from an HIV-1-infected individual was used as a positive control. The positions of HIV-1 proteins are indicated to the right of the blots. WPl, weeks postinfection.
|
|
To ascertain whether HIVNL-DT5R had established persistent infections in the animals, PBMC-associated viral DNA levels were measured at 45 weeks p.i. for pig-tailed macaques A3P017, A3P023, A3P027, and A4P004, and at 38 weeks p.i. for A3P024, since proviral DNA in PBMC can be detected even after plasma viral RNA loads fall below the limits of detection in animals effectively controlling virus replication (18). The same primer/probe pair and amplification conditions used to measure plasma viral RNA were employed for the detection of proviral DNA. Low levels of PBMC-associated viral DNA were detected in samples from all five animals (0.36 copy/105 cells for A3P017, 0.14 copy for A3P023, 0.76 copy for A3P027, 0.70 copy for A4P004, and 0.21 copy for A3P024; the detection limit for this assay is 0.1 copy/105 cells). The proviral DNA loads measured in two of the anti-CD8-treated animals (A3P027 and A4P004) were somewhat higher than those in the untreated macaques (A3P017 and A3P023) and correlated with prolonged detection of plasma viremia in these monkeys. Taken together with the steady/increasing antibody responses and the presence of proviral DNA, these results indicate that HIVNL-DT5R is able to establish low-level persistent infections in pig-tailed macaques.
The results described in this report reinforce conclusions initially observed in transfection and single-cycle infectivity assays, which demonstrated that blocks to virus replication imposed by macaque TRIM5
and APOBEC3 cytidine deaminases markedly inhibited HIV-1 replication in simian cells (16, 24). We also reported that the restriction to the establishment of HIV-1 spreading infections in cultured monkey PBMC could be counteracted by HIV-1NL-DT5R, which carries a short SIV Gag element and the entire SIV vif gene, but not by wild-type HIV-1 (12). The results from the present study now extend the previous observations to the organismal level and show that HIV-1NL-DT5R can replicate in vivo.
Although HIV-1NL-DT5R was able to establish infections in pig-tailed macaques, its replicative properties are reminiscent of first-generation SHIVs (10, 14, 15, 20). The latter generated modest levels of peak viremia during acute infections of macaque monkeys that were rapidly and durably suppressed and failed to induce any disease. Serial passaging of these SHIVs or the administration of CD8+-T-cell-depleting MAbs during the primary virus infection resulted in the emergence of pathogenic virus, which replicated to high titers in infected animals and induced the systemic depletion of CD4+ T lymphocytes and development of immunodeficiency (9, 11, 19). In this regard, it has also been reported that passaging of minimally cytopathic SIVMneCl8 (13) or even the pathogenic SIVB670 (8) gave rise to SIV variants exhibiting more robust replication phenotypes and augmented pathogenic properties. One could envisage using a similar approach for generating more fit HIV-1NL-DT5R variants for infections of macaque monkeys, including some carrying CCR5-utilizing env genes. These new derivatives could be used for analyses of cell-mediated immune responses directed against Gag and Pol proteins or to assess patterns of antiviral drug resistance against HIV-1-encoded proteins, not presently possible with SIV or currently available SHIVs.
Although it might be considered a step backward, one could argue that the direct substitution of additional SIV-specific sequences into the genetic backbone of HIV-1NL-DT5R might markedly improve its infectivity in monkeys. For example, the SIV long terminal repeat contains one (not two) NF-
B binding site, four (not three) SP1 binding sites, and unique PuB2, SF1-3, and peri-xB binding sites relative to the HIV-1 long terminal repeat (7). Similarly, the significantly larger SIV nef gene and the presence of both vpr and vpx genes in the SIV genome (rather than the single vpr gene in HIV-1) would suggest that the acquisition of nonhuman primate species-specific cis-acting elements and coding sequences may optimize virus infectivity in vivo. Both direct replacement and serial passaging strategies are being used to obtain HIV-1NL-DT5R variants with improved replicative potential in monkeys.
 |
ACKNOWLEDGMENTS
|
|---|
The monoclonal anti-human CD8 antibody, cM-T807, used in this work was provided by the NIH Nonhuman Primate Reagent Resource (AI040101 and RR016001) and produced by the National Cell Culture Center.
This work was supported by the Intramural Research Program of the National Institute of Allergy and Infectious Diseases, National Institutes of Health.
 |
FOOTNOTES
|
|---|
* Corresponding author. Mailing address: Laboratory of Molecular Microbiology, NIAID, NIH, Bldg. 4, Room 315, 4 Center Drive, MSC 0460, Bethesda, MD 20892-0460. Phone: (301) 496-4012. Fax: (301) 402-0226. E-mail: malm{at}nih.gov 
Published ahead of print on 1 August 2007. 
 |
REFERENCES
|
|---|
- Amara, R. R., F. Villinger, J. D. Altman, S. L. Lydy, S. P. O'Neil, S. I. Staprans, D. C. Montefiori, Y. Xu, J. G. Herndon, L. S. Wyatt, M. A. Candido, N. L. Kozyr, P. L. Earl, J. M. Smith, H. L. Ma, B. D. Grimm, M. L. Hulsey, J. Miller, H. M. McClure, J. M. McNicholl, B. Moss, and H. L. Robinson. 2001. Control of a mucosal challenge and prevention of AIDS by a multiprotein DNA/MVA vaccine. Science 292:69-74.[CrossRef][Medline]
- Barouch, D. H., S. Santra, J. E. Schmitz, M. J. Kuroda, T. M. Fu, W. Wagner, M. Bilska, A. Craiu, X. X. Zheng, G. R. Krivulka, K. Beaudry, M. A. Lifton, C. E. Nickerson, W. L. Trigona, K. Punt, D. C. Freed, L. Guan, S. Dubey, D. Casimiro, A. Simon, M. E. Davies, M. Chastain, T. B. Strom, R. S. Gelman, D. C. Montefiori, M. G. Lewis, E. A. Emini, J. W. Shiver, and N. L. Letvin. 2000. Control of viremia and prevention of clinical AIDS in rhesus monkeys by cytokine-augmented DNA vaccination. Science 290:486-492.[Abstract/Free Full Text]
- Endo, Y., T. Igarashi, Y. Nishimura, C. Buckler, A. Buckler-White, R. Plishka, D. S. Dimitrov, and M. A. Martin. 2000. Short- and long-term clinical outcomes in rhesus monkeys inoculated with a highly pathogenic chimeric simian/human immunodeficiency virus. J. Virol. 74:6935-6945.[Abstract/Free Full Text]
- Freed, E. O., and M. A. Martin. 1996. Domains of the human immunodeficiency virus type 1 matrix and gp41 cytoplasmic tail required for envelope incorporation into virions. J. Virol. 70:341-351.[Abstract]
- Harada, S., Y. Koyanagi, and N. Yamamoto. 1985. Infection of HTLV-III/LAV in HTLV-I-carrying cells MT-2 and MT-4 and application in a plaque assay. Science 229:563-566.[Abstract/Free Full Text]
- Hatziioannou, T., M. Princiotta, M. Piatak, Jr., F. Yuan, F. Zhang, J. D. Lifson, and P. D. Bieniasz. 2006. Generation of simian-tropic HIV-1 by restriction factor evasion. Science 314:95.[Abstract/Free Full Text]
- Hiebenthal-Millow, K., S. Pohlmann, J. Munch, and F. Kirchhoff. 2004. Differential regulation of human immunodeficiency virus type 2 and simian immunodeficiency virus promoter activity. Virology 324:501-509.[CrossRef][Medline]
- Holterman, L., H. Niphuis, P. J. ten Haaft, J. Goudsmit, G. Baskin, and J. L. Heeney. 1999. Specific passage of simian immunodeficiency virus from end-stage disease results in accelerated progression to AIDS in rhesus macaques. J. Gen. Virol. 80:3089-3097.[Abstract/Free Full Text]
- Igarashi, T., Y. Endo, G. Englund, R. Sadjadpour, T. Matano, C. Buckler, A. Buckler-White, R. Plishka, T. Theodore, R. Shibata, and M. Martin. 1999. Emergence of a highly pathogenic simian/human immunodeficiency virus in a rhesus macaque treated with anti-CD8 mAb during a primary infection with a nonpathogenic virus. Proc. Natl. Acad. Sci. USA 96:14049-14054.[Abstract/Free Full Text]
- Igarashi, T., R. Shibata, F. Hasebe, Y. Ami, K. Shinohara, T. Komatsu, C. Stahl-Hennig, H. Petry, G. Hunsmann, T. Kuwata, et al. 1994. Persistent infection with SIVmac chimeric virus having tat, rev, vpu, env and nef of HIV type 1 in macaque monkeys. AIDS Res. Hum. Retrovir. 10:1021-1029.[Medline]
- Joag, S. V., Z. Li, L. Foresman, E. B. Stephens, L. J. Zhao, I. Adany, D. M. Pinson, H. M. McClure, and O. Narayan. 1996. Chimeric simian/human immunodeficiency virus that causes progressive loss of CD4+ T cells and AIDS in pig-tailed macaques. J. Virol. 70:3189-3197.[Abstract]
- Kamada, K., T. Igarashi, M. A. Martin, B. Khamsri, K. Hatcho, T. Yamashita, M. Fujita, T. Uchiyama, and A. Adachi. 2006. Generation of HIV-1 derivatives that productively infect macaque monkey lymphoid cells. Proc. Natl. Acad. Sci. USA 103:16959-16964.[Abstract/Free Full Text]
- Kimata, J. T., L. Kuller, D. B. Anderson, P. Dailey, and J. Overbaugh. 1999. Emerging cytopathic and antigenic simian immunodeficiency virus variants influence AIDS progression. Nat. Med. 5:535-541.[CrossRef][Medline]
- Li, J., C. I. Lord, W. Haseltine, N. L. Letvin, and J. Sodroski. 1992. Infection of cynomolgus monkeys with a chimeric HIV-1/SIVmac virus that expresses the HIV-1 envelope glycoproteins. J. Acquir. Immune Defic. Syndr. 5:639-646.[Medline]
- Luciw, P. A., E. Pratt-Lowe, K. E. Shaw, J. A. Levy, and C. Cheng-Mayer. 1995. Persistent infection of rhesus macaques with T-cell-line-tropic and macrophage-tropic clones of simian/human immunodeficiency viruses (SHIV). Proc. Natl. Acad. Sci. USA 92:7490-7494.[Abstract/Free Full Text]
- Mariani, R., D. Chen, B. Schrofelbauer, F. Navarro, R. Konig, B. Bollman, C. Munk, H. Nymark-McMahon, and N. R. Landau. 2003. Species-specific exclusion of APOBEC3G from HIV-1 virions by Vif. Cell 114:21-31.[CrossRef][Medline]
- Mascola, J. R., G. Stiegler, T. C. VanCott, H. Katinger, C. B. Carpenter, C. E. Hanson, H. Beary, D. Hayes, S. S. Frankel, D. L. Birx, and M. G. Lewis. 2000. Protection of macaques against vaginal transmission of a pathogenic HIV-1/SIV chimeric virus by passive infusion of neutralizing antibodies. Nat. Med. 6:207-210.[CrossRef][Medline]
- National Research Council. 2002. Guide for the care and use of laboratory animals. NIH publication no. 85-23. National Academy Press, Washington, DC.
- Nishimura, Y., T. Igarashi, N. Haigwood, R. Sadjadpour, R. J. Plishka, A. Buckler-White, R. Shibata, and M. A. Martin. 2002. Determination of a statistically valid neutralization titer in plasma that confers protection against simian-human immunodeficiency virus challenge following passive transfer of high-titered neutralizing antibodies. J. Virol. 76:2123-2130.[Abstract/Free Full Text]
- Reimann, K. A., J. T. Li, R. Veazey, M. Halloran, I. W. Park, G. B. Karlsson, J. Sodroski, and N. L. Letvin. 1996. A chimeric simian/human immunodeficiency virus expressing a primary patient human immunodeficiency virus type 1 isolate env causes an AIDS-like disease after in vivo passage in rhesus monkeys. J. Virol. 70:6922-6928.[Abstract/Free Full Text]
- Sakuragi, S., R. Shibata, R. Mukai, T. Komatsu, M. Fukasawa, H. Sakai, J. Sakuragi, M. Kawamura, K. Ibuki, M. Hayami, et al. 1992. Infection of macaque monkeys with a chimeric human and simian immunodeficiency virus. J. Gen. Virol. 73:2983-2987.[Abstract/Free Full Text]
- Schmitz, J. E., M. J. Kuroda, S. Santra, V. G. Sasseville, M. A. Simon, M. A. Lifton, P. Racz, K. Tenner-Racz, M. Dalesandro, B. J. Scallon, J. Ghrayeb, M. A. Forman, D. C. Montefiori, E. P. Rieber, N. L. Letvin, and K. A. Reimann. 1999. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science 283:857-860.[Abstract/Free Full Text]
- Sharma, D. P., M. C. Zink, M. Anderson, R. Adams, J. E. Clements, S. V. Joag, and O. Narayan. 1992. Derivation of neurotropic simian immunodeficiency virus from exclusively lymphocytetropic parental virus: pathogenesis of infection in macaques. J. Virol. 66:3550-3556.[Abstract/Free Full Text]
- Sheehy, A. M., N. C. Gaddis, J. D. Choi, and M. H. Malim. 2002. Isolation of a human gene that inhibits HIV-1 infection and is suppressed by the viral Vif protein. Nature 418:646-650.[CrossRef][Medline]
- Stremlau, M., C. M. Owens, M. J. Perron, M. Kiessling, P. Autissier, and J. Sodroski. 2004. The cytoplasmic body component TRIM5alpha restricts HIV-1 infection in Old World monkeys. Nature 427:848-853.[CrossRef][Medline]
- Willey, R. L., D. H. Smith, L. A. Lasky, T. S. Theodore, P. L. Earl, B. Moss, D. J. Capon, and M. A. Martin. 1988. In vitro mutagenesis identifies a region within the envelope gene of the human immunodeficiency virus that is critical for infectivity. J. Virol. 62:139-147.[Abstract/Free Full Text]
- Witvrouw, M., C. Pannecouque, W. M. Switzer, T. M. Folks, E. De Clercq, and W. Heneine. 2004. Susceptibility of HIV-2, SIV and SHIV to various anti-HIV-1 compounds: implications for treatment and postexposure prophylaxis. Antivir. Ther. 9:57-65.[Medline]
Journal of Virology, October 2007, p. 11549-11552, Vol. 81, No. 20
0022-538X/07/$08.00+0 doi:10.1128/JVI.00960-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.