This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Balinsky, C. A.
Right arrow Articles by Rock, D. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Balinsky, C. A.
Right arrow Articles by Rock, D. L.

 Previous Article  |  Next Article 

Journal of Virology, October 2007, p. 11392-11401, Vol. 81, No. 20
0022-538X/07/$08.00+0     doi:10.1128/JVI.01093-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Sheeppox Virus Kelch-Like Gene SPPV-019 Affects Virus Virulence{triangledown}

C. A. Balinsky,1,2,3 G. Delhon,3,4,5 C. L. Afonso,3,6 G. R. Risatti,2,3 M. V. Borca,3 R. A. French,2 E. R. Tulman,1,2,3 S. J. Geary,1,2 and D. L. Rock3,5*

Center of Excellence for Vaccine Research, University of Connecticut, Storrs, Connecticut 06269,1 Department of Pathobiology and Veterinary Science, University of Connecticut, Storrs, Connecticut 06269,2 Plum Island Animal Disease Center, Agricultural Research Service, U.S. Department of Agriculture, Greenport, New York 11944,3 Area of Virology, School of Veterinary Sciences, University of Buenos Aires, 1427 Buenos Aires, Argentina,4 Department of Pathobiology, College of Veterinary Medicine, University of Illinois, Urbana, Illinois 61802,5 Southeast Poultry Research Laboratory, Agricultural Research Service, U.S. Department of Agriculture, Athens, Georgia 306056

Received 21 May 2007/ Accepted 30 July 2007


arrow
ABSTRACT
 
Sheeppox virus (SPPV), a member of the Capripoxvirus genus of the Poxviridae, is the etiologic agent of a significant disease of sheep in the developing world. Genomic analysis of pathogenic and vaccine capripoxviruses identified genes with potential roles in virulence and host range, including three genes with similarity to kelch-like genes of other poxviruses and eukaryotes. Here, a mutant SPPV with a deletion in the SPPV-019 kelch-like gene, {Delta}KLP, was derived from the pathogenic strain SPPV-SA. {Delta}KLP exhibited in vitro growth characteristics similar to those of SPPV-SA and revertant virus (RvKLP). {Delta}KLP-infected cells exhibited a reduction in Ca2+-independent cell adhesion, suggesting that SPPV-019 may modulate cellular adhesion. When inoculated in sheep by the intranasal or intradermal routes, {Delta}KLP was markedly attenuated, since all {Delta}KLP-infected lambs survived infection. In contrast, SPPV-SA and RvKLP induced mortality approaching 100%. Lambs inoculated with {Delta}KLP exhibited marked reduction or delay in fever response, gross lesions, viremia, and virus shedding compared to parental and revertant viruses. Together, these findings indicate that SPPV-019 is a significant SPPV virulence determinant in sheep.


arrow
INTRODUCTION
 
Sheeppox virus (SPPV) is the etiologic agent of a highly significant disease of sheep and the type species of the genus Capripoxvirus, one of the eight genera of the subfamily Chordopoxvirinae of the Poxviridae (44). Other capripoxviruses (CaPVs) include goatpox virus (GTPV) and lumpy skin disease virus (LSDV), which cause disease in goats and cattle, respectively. Due to their significant economic impact and potential for disease transmission, CaPV diseases are listed diseases by the World Organization for Animal Health (OIE).

Sheeppox is characterized by fever, ocular and nasal discharges, papular dermatitis, and nodular lesions in a variety of organs, including the lungs, trachea, and abomasum (6, 16). Young animals are most susceptible, where mortality rates can be as high as 50 to 70% (21, 26). Transmission of sheeppox is thought to require close contact between animals and to occur primarily via aerosol and respiratory droplet, though insect vectors have also been implicated (21, 26, 33, 34). Sheeppox is endemic throughout southwest and central Asia, the Indian subcontinent, and African regions north of the equator (9, 16).

SPPV and other CaPVs are morphologically and serologically indistinguishable and genomically very similar, with overall conservation in genetic content and gene synteny and >96% nucleotide identity (7, 22, 32, 61). Comparison of field and vaccine strains has shown that relatively few genomic changes account for viral attenuation in CaPV. A number of these genes are predicted to affect virulence and host range (31, 61). Among the genes affected in vaccine strains of CaPV were those with products similar to kelch-like proteins encoded by eukaryotes and other poxviruses.

Kelch-like proteins, including the prototype kelch encoded by Drosophila, are members of a protein superfamily characterized by the presence of kelch repeat motifs. These proteins also belong to a subset of proteins characterized by a C-terminal domain of multiple kelch repeats joined to a N-terminal BTB/POZ (for broad-complex, tramtrack and bric-à-brac/poxvirus and zinc finger) domain via a BACK (for BTB and C-terminal kelch) domain (1, 57, 58). Kelch-like proteins are encoded by metazoans and demonstrate considerable expansion in gene repertoire among vertebrates, with humans encoding more than 50 (48). Kelch-like proteins, whose BTB and kelch domains can mediate protein-protein interactions, affect multiple cellular processes, including cytoskeleton organization and dynamics, ion channel modulation, transcriptional regulation, and protein ubiquitination, where they serve as substrate adapter proteins that mediate interaction between ubiquitin ligase complexes and the substrates targeted for degradation (1, 2, 14, 20, 49).

Kelch-like proteins are encoded by members of chordopoxviral genera Orthopoxvirus, Capripoxvirus, Leporipoxvirus, Suipoxvirus, and Yatapoxvirus and by unassigned deerpox viruses. Poxviral kelch-like genes are generally present as multiple, divergent, and occasionally fragmented genes located in variable and nonessential regions near genomic termini, leading to the suggestion that they function in aspects of virus-host interactions (55). Although domain structure is maintained, amino acid identity between poxviral and cellular kelch-like proteins is low. Studies examining the role of poxviral kelch-like genes in virus replication and pathogenesis have been limited to orthopoxviruses, where deletion of single or multiple kelch-like genes have been shown to affect lesion size, inflammatory cell infiltration, or virulence in a mouse model or vascularization and virus yield in a chorioallantoic membrane model of infection (4, 36, 47). These results have suggested a role for kelch-like genes in poxvirus virulence and host range, perhaps through the modulation of inflammatory responses (47). Still, the role of individual kelch-like proteins in poxvirus virulence remains to be fully elucidated.

SPPV encodes three kelch-like proteins—SPPV-019, SPPV-144, and SPPV-151 (annotated as SPPV_16, SPPV_137, and SPPV_144, respectively, in NCBI Reference Sequence accession NC_004002)—that exhibit 93 to 95% amino acid identity to GTPV and LSDV orthologues (61). Examination of SPPV-019 orthologues in GTPV G20 and LSDV Neethling vaccine strains shows truncating frameshift mutations at positions 231 and 124, respectively, suggesting a role for CaPV SPPV-019-like genes in virus virulence (31, 60). In the present study, we examined the role of the kelch-like protein-encoding gene SPPV-019 in sheep, the natural SPPV host. Our data indicate that SPPV-019 markedly affects SPPV virulence after intranasal or intradermal virus inoculation.


arrow
MATERIALS AND METHODS
 
Viruses and cell cultures. The pathogenic field isolate SPPV strain A (SPPV-SA) was obtained from a sick sheep in the Almatinskaya region of Kazakhstan and passaged nine times in sheep at the Scientific Research Agricultural Institute, Kazakhstan (61). Primary lamb kidney (LK) cells were obtained from the Animal and Plant Health Inspection Service, U.S. Department of Agriculture, at the Plum Island Animal Disease Center, Greenport, NY, and grown in Dulbecco modified Eagle medium containing 10% fetal bovine serum and 50 µg of gentamicin/ml.

Construction of SPPV recombinant viruses {Delta}TK, {Delta}KLP, and its revertant RvKLP. Recombinant SPPVs lacking the SPPV-019 kelch-like gene or the SPPV-066 thymidine kinase gene ({Delta}KLP and {Delta}TK, respectively), a gene known to be nonessential for capripoxvirus replication, were constructed (51, 63). Recombinant SPPVs were generated by homologous recombination between parental SPPV-SA and recombination transfer vectors containing appropriate gene deletions after viral infection (multiplicity of infection [MOI] of 10) and vector transfection of LK cells (Lipofectamine 2000; Invitrogen, San Diego, CA) (65). For vector construction, a cassette containing the Escherichia coli ß-glucuronidase (GUS) gene downstream of a synthetic vaccinia virus (VACV) promoter (VVp) (11) and flanked by viral sequences was PCR assembled according to methods previously described (62). Briefly, VVp-GUS and 1 kbp each of SPPV-019 or SPPV-066 flanking sequences were PCR amplified by using primers that generate DNA fragments with overlapping ends. The fragments were sequentially fused by recombinant PCR to generate the complete cassette, which was cloned into the pCR2.1 vector (Invitrogen, San Diego, CA). Primers included the following (5' to 3'): GUS forward, TCCCTTATGTTACGTCCTGTAG; GUS reverse, TTCATTGTTTGCCTCCCTG; VVp forward, CTAGCGATCGCGTTGCTGAAAAATTGAAATTTTATTTTTTTTTTTTGG; VVp reverse, CTTTAAAATAAAAAAAAAAAACCTTATATTTATACAATGCAGGACATC; SPPV-019 left flank forward (S19Lf), CTAAATCATCATCAACAACTTCATTG; SPPV-019 left flank reverse (S19Lr), CAGCAACGCGATCGCTACGTTATAGGAGCATTAGACATAGATAGTG; SPPV-019 right flank forward (S19Rf) CTAAGCGGCCGCGTAAGTATTCAAGATAATTAACAAAAAGTTG; SPPV-019 right flank reverse (S19Rr), TAGATGATACGTATACGTGTGTGG; SPPV-066 left flank forward (S66Lf), TTTATTTTACTCCTGTATTTATAGAACCTAC; SPPV-066 left flank reverse (S66Lr), CAGCAACGCGATCGCTATAGGTCCTATAATTAAATGTATATATCCATAG; SPPV-066 right flank forward (S66Rf), CTAAGCGGCCGCGTAAGGCACTAGATAGCACATTTCAACG; and SPPV-066 right flank reverse (S66Rr), TGTTGTCGTCCATCTATTAATATCC. Primer pairs S19Lf/S19Rr and S66Lf/S66Rr were used to generate full-length transfer cassettes. Primer pairs S19Tf (CTATGTCTAATGCTCCTATAACGTTC)/S19Tr (TGTATAGTTAATAAAGTTGAAAGTTGGTC) and S66Tf (ATGGACTATGGAT ATATACATTTAATTATAGTTCTA)/S66Tr (AAAAATAACATTTCCTACAAAC) were used to test for the presence of SPPV-019 and SPPV-066, respectively.

LK cell cultures were infected with harvested cell lysates from the infection-transfection and overlaid with complete medium containing 0.5% SeaKem GTG agarose (Cambrex Bioscience, Rockland, ME) and 5-bromo-4-chloro-3-indolyl ß-D-glucuronic acid (X-Gluc). Blue plaques indicative of recombinant viruses were collected and purified to homogeneity by additional plaque assays. Lack of SPPV-019 or SPPV-066 gene sequences and the correct position and orientation of reporter sequences in recombinant viruses were confirmed by PCR analysis. A 4-kbp genomic region flanking the deletion site was sequenced by using an Applied Biosystems Prism 3730xl automated DNA sequencer (Applied Biosystems, Foster City, CA).

A SPPV-019 revertant virus (RvKLP) was constructed by restoring SPPV-019 gene sequences to the {Delta}KLP genome. A region of the SPPV-SA genome, including the SPPV-019 gene and flanking regions, was PCR amplified using primers S19Lf and S19Rr and cloned into pCR2.1. Isolated clones were sequenced using overlapping gene-specific primers. Transfer vectors with the correct SPPV sequences were used for RvKLP construction. In addition, a second transfer vector, containing a single nucleotide insertion that introduced a stop codon (amino acid 231) in the linker region between BTB/BACK and kelch-repeat domains of SPPV-019, was used to create a second revertant virus, fsKLP. LK cells were transfected with these transfer vectors and infected with {Delta}KLP. Harvested viruses were used to infect LK cells in 96-well plates, and supernatants were assayed for the restoration of wild-type SPPV-019 sequences by dot blot hybridization (protocol adapted from the method of Goswami and Glazer [24]) on a nylon membrane (Hoffmann-La Roche, Switzerland) using a SPPV-019-specific digoxigenin-labeled probe generated with primer pair S19Tf/S19Tr (PCR DIG probe synthesis kit; Hoffmann-La Roche). Positive wells were detected using a DIG luminescence detection kit (Hoffmann-La Roche). RvKLP and fsKLP virus clones were purified through two additional rounds of infection and hybridization. A 5-kbp region extending 0.5 kbp outside of either end of the original transfer cassette was then sequenced to ensure the integrity of SPPV-019 and adjacent genomic regions and to confirm the fsKLP sequence.

Ca2+-independent cell adhesion assay. Ca2+-independent cell adhesion was assessed as previously described (47, 54), using the divalent cation chelator EDTA instead of EGTA. LK cells grown on chamber slides (Nunc, Inc., Naperville, IL) were either mock infected or infected with SPPV-SA, {Delta}KLP, or RvKLP viruses (MOI of 10) and allowed to incubate for 24 h. Cells were then washed with phosphate-buffered saline (PBS), treated with 0.1 mM EDTA, and monitored at 5-min intervals for cell adhesion using an inverted microscope and an attached Nikon CoolPix 5000 digital camera. The results were obtained from three independent experiments, and the percent rounded cells was calculated from three randomly selected fields per time point.

Animal inoculation. Three- to four-month-old Merino lambs were inoculated intranasally with 106 PFU of the SPPV-SA, {Delta}KLP, {Delta}TK, or RvKLP viruses/animal. Clinical signs of sheeppox, including fever (a rectal temperature equal to or greater than 39.7°C), anorexia, lethargy, nasal and ocular discharges, coughing, labored respiration, recumbency, and the appearance of skin lesions, were monitored daily. Blood samples and nasal swabs were collected every day for the first 10 days and every other day thereafter for the duration of the 30-day experiment. Lambs were euthanized when found moribund or at the end of the experiment, and tissue samples were collected. Tissue samples were immediately frozen at –70°C for virus isolation and titration or fixed in 10% neutral buffered formalin for histopathology. Frozen tissues were weighed, homogenized and clarified by low-speed centrifugation. Virus isolation from clinical samples was performed with LK cells as described in OIE protocols (http://www.oie.int/eng/normes/mmanual/A_00033.htm). Virus titration in buffy coat and tissue homogenates was performed by the limiting-dilution method. Titers were calculated by the method of Spearman-Karber and are expressed as the 50% tissue culture infectious dose (TCID50) (18).

Additional lambs were intradermally inoculated in the left flank and inner side of the left thigh with 104 PFU of SPPV-SA, {Delta}KLP, or fsKLP virus or mock infected with PBS. Lambs were monitored and sampled as described above and then euthanized and necropsied as described above at 6 days postinfection or at the conclusion of the 10-day experiment.

Real-time PCR. Real-time PCR was used to detect the presence of viral DNA in blood samples. DNA was extracted from buffy coats by using a QIAamp DNA blood minikit (QIAGEN, Inc., Valencia, CA). Reaction mixes were prepared and run with reagents from a SYBR green PCR master mix kit (Applied Biosystems) as recommended in a final volume of 25 µl. The forward and reverse primers were 5'-GCCAAAAAAATTACCATATCAAGGTC-3' and 5'-GAGCTGATCCAACATATACTATTGTGC-3' (500 nM), respectively. Sample template (2.5 µl) was added to each reaction in a SmartCycler 25-µl reaction tube (Cepheid, Sunnyvale, CA). Cycling conditions consisted of an initial denaturation at 95 °C for 5 min, followed by an additional 45 amplification cycles (95°C for 15 s, 58°C for 15 s, and 68°C for 60 s). Assays were run on a Cepheid SmartCycler. Positive and negative controls were included with each set of reactions.

Immunohistochemistry. Tissues were fixed in 10% neutral buffered formalin for 48 h, embedded in paraffin, and sectioned onto SuperFrost Plus glass slides (Fisher Scientific, Pittsburgh, PA). Sections were deparaffinized and rehydrated according to standard methods, unmasked with Dako antigen retrieval solution (DakoCytomation, Carpinteria, CA), and blocked with 2% normal horse serum in PBS. Sections were sequentially incubated with polyclonal anti-SPPV serum (1:10) overnight, biotinylated universal antibody (Vector Laboratories, Burlingame, CA) for 1 h, ABC-AP (Vector Laboratories) for 30 min, and Vector Red substrate solution (Vector Laboratories) for an additional 30 min. The slides were counterstained with Mayer's hematoxylin (Sigma-Aldrich, St. Louis, MO), dehydrated, cleared, and mounted.


arrow
RESULTS
 
SPPV-019 encodes a kelch-like protein. The predicted 569-amino-acid SPPV-019 protein is similar to kelch-like proteins encoded by chordopoxviruses and metazoans (48). Present in SPPV-019 are the domains conserved in other kelch-like proteins, including an N-terminal BTB/POZ domain (Pfam 00651, amino acids 15 to 116), a BACK domain (Pfam 07707, amino acids 121 to 220), and a C-terminal kelch domain (amino acids 329 to 564) containing four kelch repeat motifs (Pfam 01344) (Fig. 1A). The four intact kelch repeats are preceded by one repeat that is incomplete and lacks the conserved tryptophan residue of the ß4 sheet within the predicted kelch domain propeller blade structure (1). The BTB-BACK and the kelch-repeat-containing domains are separated by a 109-amino-acid linker region.


Figure 1
View larger version (17K):
[in this window]
[in a new window]

  		FIG. 1. Characterization of a SPPV SPPV-019 gene deletion mutant, {Delta}KLP, and its revertant, RvKLP. (A) Diagram of SPPV-019 domain structure. (B) Diagram of SPPV-SA and recombinant viruses {Delta}KLP, fsKLP, and RvKLP. The arrowhead in fsKLP indicates the position of the stop codon. (C) PCR analysis of SPPV-SA, {Delta}KLP, and RvKLP viral DNAs using primers specific for SPPV-019 or ß-glucuronidase (ß-GUS) gene sequences. M, molecular markers; NTC, no template DNA.

SPPV-019 is most similar to its orthologues in other chordopoxviral genera, sharing 35 to 40% amino acid identity to orthologues in genera closely related to CaPV (suipoxvirus, yatapoxviruses, leporipoxviruses, and deerpox viruses) and 24 to 27% identity to orthopoxviral orthologues, including VACV (strain Copenhagen) F3L. The orthologous nature of these genes is further indicated by the conserved locus at which they are located in all chordopoxviral genomes containing kelch-like genes. This locus is in the left genomic region between the dUTPase gene (orthopoxviruses, capripoxviruses, yatapoxviruses, and deerpox viruses) or myxoma virus m013L-like gene (leporipoxviruses and suipoxvirus) and the ribonucleotide reductase small subunit gene (61). Notably, SPPV-019 orthologues represent the only kelch-like gene present in all poxviruses known to encode kelch-like proteins, making it the most conserved poxviral kelch-like gene. Sequence conservation among SPPV-019 orthologues is lowest in the linker region separating the BACK domain from the kelch domain, a region that contains a unique 40-amino-acid sequence in CaPV orthologues. SPPV-019 is less similar to paralogues in SPPV (18 to 24% amino acid identity to SPPV-144 and SPPV-151 over their length), homologues in other poxvirus genera (including VACV A55R and C2L [23 and 24% amino acid identity, respectively]), and cellular kelch-like proteins.

Construction and analysis of SPPV SPPV-019 and SPPV-066 gene deletion mutants, {Delta}KLP and {Delta}TK, and the SPPV-019 revertant, RvKLP. To examine the role of SPPV-019 during SPPV infection, an SPPV SPPV-019 gene deletion mutant, {Delta}KLP, and its revertant, RvKLP, were constructed. In {Delta}KLP, 1,654 bp of the 1,706-bp SPPV-019 gene (98.5%) were deleted and replaced with the 1,943-bp reporter gene cassette. In RvKLP, {Delta}KLP reporter gene sequences were replaced with wild-type SPPV-019 sequences (Fig. 1B). An additional revertant virus, fsKLP, containing a nonsense mutation at SPPV-019 amino acid position 231 was also constructed (Fig. 1B). As a control for the generation of gene deletion mutants, an SPPV-066 thymidine kinase gene deletion mutant ({Delta}TK) was constructed by replacing the 5' 307 bp of the SPPV-066 coding sequence (531 bp) with the GUS cassette. Genomic DNA from parental and recombinant viruses was analyzed by PCR. The deleted SPPV-019 sequences were not detected in DNA preparations prepared from {Delta}KLP virus stocks but were amplified from parental and revertant viral genomic DNAs. Reporter gene sequences were detected only in the deletion mutant virus (Fig. 1C). Similar results were obtained for {Delta}TK (not shown). DNA sequencing confirmed preservation of wild-type genomic sequences flanking the deletion sites in recombinant viruses and integrity of the wild-type SPPV-019 gene in RvKLP (not shown).

SPPV-019 does not affect growth of SPPV in vitro. Growth characteristics of {Delta}KLP were compared to those of SPPV-SA and RvKLP by infecting primary LK cell cultures (MOI = 0.1) and determining total virus titers at 24-h intervals for 5 days. No significant differences in growth were observed between these viruses, indicating that SPPV-019 is not essential for SPPV growth in LK cells (Fig. 2A). As anticipated, the growth characteristics of {Delta}TK also were indistinguishable from those of SPPV-SA (Fig. 2B). In addition, no differences in plaque size or morphology were observed for {Delta}KLP relative to the parental virus (not shown).


Figure 2
View larger version (14K):
[in this window]
[in a new window]

  		FIG. 2. Growth characteristics of SPPV isolate SPPV-SA and recombinant SPPV viruses {Delta}KLP, RvKLP (A), and {Delta}TK (B) in primary sheep LK cells. Cells were infected (MOI = 0.1) with the appropriate viruses and, at the indicated times postinfection, samples were collected and titrated for virus yield. The data are the means and standard errors of three independent experiments.

SPPV-019 affects Ca2+-independent cell adhesion in LK cells. Of interest was the ability of {Delta}KLP to affect Ca2+-independent cell adhesion in infected cultured cells, a phenotype previously shown to be affected in VACV-infected cells by deletion of C2L and A55R kelch-like genes (4, 47, 54). To examine the ability of SPPV to affect cell adhesion in vitro and the effect of SPPV-019 gene deletion on this phenotype, LK cells were mock infected or infected with {Delta}KLP, SPPV-SA, or RvKLP for 24 h, followed by treatment of cultures with EDTA (Fig. 3). Although 97% of mock-infected cells were rounded and detached from the glass surface within 20 min of EDTA treatment, ca. 50% of cells infected with SPPV-SA or RvKLP remained adherent. This indicates that SPPV infection induces Ca2+-independent adhesion in LK cells. Cells infected with {Delta}KLP displayed a phenotype intermediate (88% of cells rounded and detached) relative to SPPV-SA or RvKLP and mock-infected cells, indicating that SPPV-019 contributes directly or indirectly to the Ca2+-independent adhesion phenotype in LK cells.


Figure 3
View larger version (11K):
[in this window]
[in a new window]

  		FIG. 3. Ca2+-independent adhesion of LK cells infected with SPPV-SA, {Delta}KLP, or RvKLP viruses. Monolayers of LK cells were infected (MOI = 10) with the indicated viruses or mock infected. At 24 hpi, cultures were treated with EDTA and photographs of cell monolayers under phase-contrast microscopy were taken at 5-min intervals. The data were collected from three independent experiments, and the percent rounded cells was calculated as described in Materials and Methods. The number ± the standard deviation of rounded cells is shown.

SPPV-019 affects viral virulence in sheep. (i) Intranasal inoculation. To examine the role of SPPV-019 on SPPV virulence, Merino lambs were inoculated intranasally with 106 TCID50 of SPPV-SA, {Delta}KLP, or {Delta}TK (experiment 1) or SPPV-SA, {Delta}KLP, or RvKLP (experiment 2) and observed for clinical signs of infection (Tables 1 and 2). In contrast to SPPV-SA and RvKLP, where the combined mortality was 92%, all lambs infected with {Delta}KLP and {Delta}TK survived the infection (Table 1). Although lambs in all groups showed a fever response starting on days 3 to 4 postinoculation, the mean body temperatures were highest in lambs inoculated with SPPV-SA or RvKLP (>40.2°C), lowest in the {Delta}TK group (39.3°C), and intermediate in {Delta}KLP-infected lambs (39.7°C). Pyrexia persisted until death in the SPPV-SA and RvKLP groups but ended after approximately 1 or 2 weeks in {Delta}TK and {Delta}KLP groups, respectively. All lambs inoculated with SPPV-SA (8 of 8 animals) or RvKLP (5 of 5 animals) exhibited seromucous or purulent nasal discharge. In contrast, only one {Delta}KLP-infected lamb and no {Delta}TK-infected lambs exhibited nasal discharge (Table 1).


View this table:
[in this window]
[in a new window]

  		TABLE 1. Survival and clinical response after intranasal inoculation of lambs with SPPV-SA, {Delta}TK, {Delta}KLP, or RvKLP virusesa


View this table:
[in this window]
[in a new window]

  		TABLE 2. Detection of SPPV in nasal secretions and blood after intranasal inoculation of lambs with SPPV-SA, {Delta}KLP, {Delta}TK, or RvKLP virusa

Differences in the development of skin lesions were observed between experimental groups. Lambs inoculated with SPPV-SA or RvKLP exhibited multiple skin lesions, which appeared first in axillary, inguinal, and perineal regions and eventually covered the entire body of most animals (Table 1). Skin lesions progressed from macular to papular to nodular forms (Fig. 4A). In contrast, of the eight lambs inoculated with {Delta}KLP, three failed to develop skin lesions, four exhibited a few (<6) transient prepapular axillary and/or inguinal lesions (Fig. 4B), and only one animal exhibited papular skin lesions (approximately 15) (Table 1). No skin lesions were observed in lambs inoculated with {Delta}TK.


Figure 4
View larger version (102K):
[in this window]
[in a new window]

  		FIG. 4. Skin lesions in lambs 8 days after intranasal (A and B) or intradermal (C and D) inoculation with SPPV-SA (A and C) or {Delta}KLP (B and D) viruses. Animals were inoculated with 106 (intranasal) or 104 (intradermal) TCID50. Panels A and B show the left axillary regions. In panels C and D, arrows indicate inoculation sites in the inner side of the left thigh.

Although all lambs inoculated with SPPV-SA or RvKLP and seven of eight lambs inoculated with {Delta}KLP became viremic, the appearance of {Delta}KLP in blood (real-time PCR) was delayed approximately 1.5 days relative to SPPV-SA or RvKLP. Further, the duration of viremia and maximum viremic titers in animals infected with {Delta}KLP were reduced (Table 2). No virus was detected in blood collected from the {Delta}TK group. Infectious virus was detected in nasal secretions from all animals infected with SPPV-SA or RvKLP. In contrast, only two of eight lambs inoculated with {Delta}KLP shed virus in nasal secretions, and the onset of virus shedding was delayed and transient relative to the SPPV-SA or RvKLP groups (Table 2). Lambs in the {Delta}TK group did not shed detectable virus in nasal secretions.

Upon postmortem examination, lambs inoculated with SPPV-SA or RvKLP demonstrated tracheal ulcers (10 of 13 animals) and lesions in the rumen (6 of 13 animals), lungs (6 of 13 animals), and nasal turbinates (2 of 13 animals). In contrast, lambs inoculated with {Delta}KLP or {Delta}TK lacked postmortem lesions, with the exception of a single tracheal ulcer in one {Delta}KLP-infected lamb. These results demonstrated that deletion of SPPV-019 markedly attenuated SPPV in sheep after intranasal inoculation.

(ii) Intradermal inoculation. To determine whether SPPV-019-dependent attenuation is affected by inoculation route, two groups of three lambs were intradermally inoculated in the flank and in the inner side of the left thigh with 104 TCID50 of SPPV-SA or {Delta}KLP and euthanized and necropsied at either 6 or 10 days postinoculation (Table 3). All inoculated lambs developed large, raised, erythematous lesions at the inoculation sites, although one lamb in the {Delta}KLP group developed a lesion in the flank but not in the thigh. Although lesion size at thigh inoculation sites tended to be larger in SPPV-SA- than in {Delta}KLP-infected lambs, differences between groups were not significant. Lambs inoculated with SPPV-SA developed high fever (>40.5°C) and generalized skin lesions (Fig. 4C), whereas lambs inoculated with {Delta}KLP showed mild fever and either no secondary skin lesions (Fig. 4D) or transient prepapular lesions (Table 3). Detection of viral DNA in blood was delayed by 2 to 4 days in {Delta}KLP-infected animals relative to those infected with SPPV-SA (Table 3). Lambs infected with SPPV-SA began shedding virus in nasal secretions by day 10, while lambs infected with {Delta}KLP did not shed detectable virus. Postmortem examination revealed multiple lesions in the lungs and rumina of lambs inoculated with SPPV-SA, whereas only one of the lambs inoculated with {Delta}KLP showed a few scattered focal lesions in these organs. Tissue samples from the inoculation sites and draining lymph nodes, axillary skin, and lungs were collected for virus titration. Although virus was detected in the skin and lymph nodes from all lambs infected with SPPV-SA, no virus was detected in lambs inoculated with {Delta}KLP other than at the inoculation sites (Table 3). On day 10, no significant difference in virus titer was observed from skin inoculated with SPPV-SA or {Delta}KLP (Table 3). Furthermore, histology and immunohistochemistry of skin lesions at inoculation sites exhibited no differences in pathology or viral antigen distribution between groups (not shown). These results indicate that {Delta}KLP, while replicating at the site of intradermal inoculation, is restricted in its ability to disseminate and cause generalized disease.


View this table:
[in this window]
[in a new window]

  		TABLE 3. Clinical signs, lesions at necropsy, and virus titers after intradermal inoculation of lambs with SPPV-SA or {Delta}KLP virusesa

As an additional control for the {Delta}KLP phenotype, fsKLP, a virus maintaining SPPV-019 coding sequences but harboring a nonsense mutation at SPPV-019 amino acid position 231, was intradermally inoculated into two lambs as described above. Only one of the two lambs showed a transient fever response (40°C) that persisted for 3 days. Similar to {Delta}KLP, primary lesions at inoculation sites were observed, but secondary skin lesions were absent.


arrow
DISCUSSION
 
We have shown here that an SPPV kelch-like gene, SPPV-019, affects viral virulence in sheep. A recombinant virus with an SPPV-019 deletion, {Delta}KLP, was markedly attenuated after virus inoculation by the intranasal or intradermal routes (Tables 1, 2, and 3). Attenuation of {Delta}KLP relative to parental (SPPV-SA) or revertant (RvKLP) viruses was demonstrated by 100% lamb survival, decreased fever response and nasal discharge, marked reduction in number and development of skin and internal lesions, reduced viremia titers and duration of viremia, and reduced virus shedding. The observed attenuation of {Delta}KLP in the natural SPPV host species and use of the natural route of infection indicates that SPPV-019 is a bona fide virulence determinant for SPPV. This represents the first attenuation of virulent SPPV or any other pathogenic CaPV by engineered gene deletion.

The marked decrease in lesion number and the limited progression of lesion development exhibited by lambs intranasally or intradermally inoculated with {Delta}KLP (Tables 1 and 3) may be partially explained by the reduced magnitude and duration of viremia (Tables 2 and 3). In lambs inoculated by the intradermal route, {Delta}KLP failed to spread to lymph nodes, and secondary skin and lung lesions were less numerous and less pronounced than in lambs inoculated with wild-type virus (Table 3). However, lesion size and {Delta}KLP skin titers at dermal inoculation sites were comparable to those of SPPV-SA. Overall, these data suggest that {Delta}KLP is restricted in its ability to spread to secondary sites of infection.

Growth characteristics of {Delta}KLP in primary sheep cells (LK) were indistinguishable from those of SPPV-SA or RvKLP (Fig. 2), indicating that SPPV-019 is not essential for virus growth in these cells and suggesting that, similar to kelch-like genes present in orthopoxviruses, SPPV-019 is dispensable for growth in vitro (36, 37, 45). In CPXV, deletion of kelch-like genes D11L, G3L, C18L, or A57R did not affect virus growth in a number of cell lines; however, simultaneous deletion of three or four of these genes delayed virus replication in certain cell lines, suggesting an additive or gene dosage effect for kelch-like genes in some aspects of host range (36). Whether an additive effect would be seen with double or triple SPPV kelch-like gene deletion mutants remains to be determined.

The present study demonstrates that deletion of a single viral kelch-like gene from SPPV leads to marked attenuation of virus in the natural host. Previous studies deleting single kelch-like genes in CPXV and VACV failed to reduce viral virulence in mice. Further, CPXV double kelch-like gene knockouts in mice caused disease indistinguishable from that of wild-type CPXV, and a significant decrease in virus virulence was observed only with quadruple kelch-like gene deletion mutants (36). VACV with C2L or A55R gene deletions exhibited no difference in weight loss or mortality relative to parental virus after intranasal inoculation of mice (4, 47). However, in an intradermal mouse model, infection with one of these two viruses with deletions in one of these two genes resulted in lesions that were larger (A55R and C2L), took longer to heal, and contained more abundant cell infiltrates (C2L) than those observed for parental and revertant viruses, suggesting that C2L and A55R function by limiting the intradermal pathology of VACV, perhaps by modulating inflammatory responses (4, 47).

The range of phenotypes observed among SPPV-019 single gene and orthopoxviral kelch-like gene deletion studies may be explained by functional differences of specific poxviral kelch-like proteins individually or within the context of the viral genotype, the nature of the host used, or both. Although all encode kelch-like proteins, SPPV-019, VACV C2L, and VACV A55R are distinct genes. The lack of complementation between VACV C2L and A55R in vitro and the slight phenotypic differences between the C2L and A55R gene deletion mutants in mice support functional differences in these genes. In addition, SPPV, VACV, and CPXV genomes contain distinct kelch-like genes and overall gene complements that may influence the effect of individual kelch-like proteins. Finally, the limited host range of SPPV and its virulence in sheep relative to VACV and CPXV in mice suggest that sheeppox may be a useful and appropriate natural host model to functionally determine specific roles of virulence and host range determinants in disease (17, 39).

The function(s) of poxviral kelch-like proteins is unknown. Compared to wild-type VACV, infection of cells with VACV C2L or A55R gene knockouts resulted in altered plaque morphology and a reduction in the formation of cellular projections and Ca2+-independent cell adhesion in vitro, indicating that C2L and A55R may play a role in promoting Ca2+-independent cell adhesion and cellular projection formation (4, 47, 54). Similar to VACV C2L and A55R deletion mutants, {Delta}KLP-infected cells did exhibit a reproducible 40% reduction in Ca2+-independent cell adhesion (Fig. 3); however, no obvious differences in plaque morphology were observed between SPPV-SA and {Delta}KLP-infected cultures, and no cellular projections were observed in any SPPV-infected cells (not shown). How SPPV-019 may specifically affect cellular adhesion or whether a cell adhesion function is involved in failure of {Delta}KLP to spread to secondary sites within the host have yet to be determined.

Poxviral kelch-like proteins conceivably perform a range of functions during infection, potentially through interaction with cytoskeleton or through protein ubiquitination. The effect of SPPV-019 on cellular adhesion is consistent with roles of cellular kelch-like proteins in cell attachment and cytoskeletal dynamics (1, 27, 29, 49, 56). The cytoskeleton has also been shown to affect critical processes during VACV infection; however, the phenotypes of {Delta}KLP described here suggest that functions affected by potential SPPV019-cytoskeletal interaction are distinct and perhaps more host range related (10, 13, 28, 40, 53). Kelch-like proteins have also been shown to function as substrate adaptor molecules for Cul3-based E3 ubiquitin ligase complexes (14, 20, 23, 35, 38, 46). Other poxviral genes have been predicted to encode ubiquitin ligase-related proteins, and poxvirus-encoded ubiquitin ligases have been shown to target host proteins and affect viral virulence and host range, thus making attractive an E3 substrate adapter role for virally encoded kelch-like proteins (3, 25, 41, 42). SPPV-019 could also affect cell attachment through an E3-adapter protein function, since ubiquitination pathways have been shown to affect cell attachment and cytoskeletal dynamics (19, 30, 64). The precise mechanism(s) through which SPPV-019 or other poxviral kelch-like proteins affect virulence requires further investigation.

SPPV-019 orthologues in vaccine strains GTPV G20 and LSDV Neethling contain frameshift mutations at positions 231 and 124, respectively, suggesting that SPPV-019 orthologues affect CaPV virulence (31, 60). The results here with SPPV further support the hypothesis that mutation of SPPV-019 orthologues contributes to the attenuated phenotypes of these vaccines. Similar to GTPV G20, the fsKLP mutant generated here harbors a nonsense mutation in the region separating the BTB and BACK domains from the kelch repeat-containing domain. Interestingly, fsKLP also was attenuated after intradermal virus inoculation of lambs, suggesting that a complete SPPV-019 protein is necessary for virus virulence.

Infection with {Delta}TK did not affect SPPV replication in tissue culture but resulted in an even more attenuated phenotype than {Delta}KLP in vivo. Lambs intranasally inoculated with {Delta}TK did not shed detectable virus in nasal secretions and, with the exception of a transient, low-magnitude fever response, did not develop signs of disease (Tables 1 and 2), indicating that SPPV-066 is an SPPV virulence factor in sheep. Preliminary studies using the intradermal route of infection showed that, unlike {Delta}KLP, {Delta}TK fails to induce a lesion at the inoculation site, suggesting that viral TK is important for virus growth in the skin (not shown). An important role for viral TK in pathogenesis has been previously reported with other large DNA viruses, including VACV (8, 59), African swine fever virus (43), and herpes simplex virus (12). The TK locus has been used as a site of insertion for foreign viral genes during construction of CaPV vaccine expression vectors; however, these recombinants were derived from previously attenuated CaPV, and the effect of TK deletion on viral virulence has not been reported (5, 15, 50-52).

Sheeppox is of major economic significance in the developing world, and vaccination is the most important disease control strategy in areas of endemicity. Attenuated live vaccines, obtained through serial passage of SPPV in tissue culture, have been used with variable success. Problems associated with these vaccines include variable levels and duration of protection, lack of vaccine virus characterization, and safety issues (6). Studies of SPPV virulence determinants in the natural host may be useful to better define mechanisms underlying poxviral pathogenesis and for engineering novel vaccines with improved safety and efficacy and of greater utility.


arrow
ADDENDUM
 
Since completion of the work described here, deletion of the SPPV-019 orthologue in VACV (F3L) has been reported to result in modest but significant reduction in lesion size and alteration of infiltrating immune cell populations in a mouse intradermal model of VACV infection, a finding suggestive of an effect on innate immune responses (18a). Whether a similar effect on immune response contributes to the attenuated phenotype of the SPPV-019 gene deletion mutant reported here remains to be determined.


arrow
ACKNOWLEDGMENTS
 
We thank animal care and audiovisual staff at the Plum Island Animal Disease Center for excellent technical assistance; L. Zsak and J. Neilan for assistance with recombinant virus construction; Z. Lu and G. F. Kutish for assistance with DNA sequencing; T. G. Burrage for assistance with electron microscopy; and the Animal and Plant Health Inspection Service, U.S. Department of Agriculture, for providing LK cells.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: 2522 Veterinary Medicine Basic Science Building, MC-002, 2001 S. Lincoln Ave., Urbana, IL 61802. Phone: (217) 244-0533. Fax: (217) 244-7421. E-mail: dlrock{at}uiuc.edu Back

{triangledown} Published ahead of print on 8 April 2007. Back


arrow
REFERENCES
 
    1
  1. Adams, J. C., R. Kelso, and L. Cooley. 2000. The kelch repeat superfamily of proteins: propellers of cell function. Trends Cell Biol. 10:17-24.[CrossRef][Medline]
    2. 2
  2. Aromolaran, K. A., K. A. Benzow, M. D. Koob, and E. S. Piedras-Renteria. 2007. The Kelch-like protein 1 modulates P/Q-type calcium current density. Neuroscience 145:841-850.[CrossRef][Medline]
    3. 3
  3. Barry, M., and K. Fruh. 2006. Viral modulators of cullin RING ubiquitin ligases: culling the host defense. Sci. STKE 2006:pe21.[Abstract/Free Full Text]
    4. 4
  4. Beard, P. M., G. C. Froggatt, and G. L. Smith. 2006. Vaccinia virus kelch protein A55 is a 64-kDa intracellular factor that affects virus-induced cytopathic effect and the outcome of infection in a murine intradermal model. J. Gen. Virol. 87:1521-1529.[Abstract/Free Full Text]
    5. 5
  5. Berhe, G., C. Minet, C. Le Goff, T. Barrett, A. Ngangnou, C. Grillet, G. Libeau, M. Fleming, D. N. Black, and A. Diallo. 2003. Development of a dual recombinant vaccine to protect small ruminants against peste-des-petits-ruminants virus and capripoxvirus infections. J. Virol. 77:1571-1577.[CrossRef][Medline]
    6. 6
  6. Bhanuprakash, V., B. K. Indrani, M. Hosamani, and R. K. Singh. 2006. The current status of sheep pox disease. Comp. Immunol. Microbiol. Infect. Dis. 29:27-60.[CrossRef][Medline]
    7. 7
  7. Black, D. N., J. M. Hammond, and R. P. Kitching. 1986. Genomic relationship between capripoxviruses. Virus Res. 5:277-292.[CrossRef][Medline]
    8. 8
  8. Buller, R. M., G. L. Smith, K. Cremer, A. L. Notkins, and B. Moss. 1985. Decreased virulence of recombinant vaccinia virus expression vectors is associated with a thymidine kinase-negative phenotype. Nature 317:813-815.[CrossRef][Medline]
    9. 9
  9. Carn, V. M. 1993. Control of capripoxvirus infections. Vaccine 11:1275-1279.[CrossRef][Medline]
    10. 10
  10. Carter, G. C., G. Rodger, B. J. Murphy, M. Law, O. Krauss, M. Hollinshead, and G. L. Smith. 2003. Vaccinia virus cores are transported on microtubules. J. Gen. Virol. 84:2443-2458.[Abstract/Free Full Text]
    11. 11
  11. Chakrabarti, S., J. R. Sisler, and B. Moss. 1997. Compact, synthetic, vaccinia virus early/late promoter for protein expression. BioTechniques 23:1094-1097.[Medline]
    12. 12
  12. Coen, D. M., M. Kosz-Vnenchak, J. G. Jacobson, D. A. Leib, C. L. Bogard, P. A. Schaffer, K. L. Tyler, and D. M. Knipe. 1989. Thymidine kinase-negative herpes simplex virus mutants establish latency in mouse trigeminal ganglia but do not reactivate. Proc. Natl. Acad. Sci. USA 86:4736-4740.[Abstract/Free Full Text]
    13. 13
  13. Cudmore, S., P. Cossart, G. Griffiths, and M. Way. 1995. Actin-based motility of vaccinia virus. Nature 378:636-638.[CrossRef][Medline]
    14. 14
  14. Cullinan, S. B., J. D. Gordan, J. Jin, J. W. Harper, and J. A. Diehl. 2004. The Keap1-BTB protein is an adaptor that bridges Nrf2 to Cul3-based E3 ligase: oxidative stress sensing by a Cul3-Keap1 ligase. Mol. Cell. Biol. 24:8477-8486.[Abstract/Free Full Text]
    15. 15
  15. Diallo, A., C. Minet, G. Berhe, C. Le Goff, D. N. Black, M. Fleming, T. Barrett, C. Grillet, and G. Libeau. 2002. Goat immune response to capripox vaccine expressing the hemagglutinin protein of peste des petits ruminants. Ann. N. Y. Acad. Sci. 969:88-91.[Medline]
    16. 16
  16. Diallo, A., and G. J. Viljoen. 2007. Genus Capripoxvirus, p.167 -181. In A. A. Mercer, A. Schmidt, and O. Weber (ed.) Poxviruses. Birkhauser, Basel, Switzerland.
    17. 17
  17. Essbauer, S., and H. Meyer. Genus Orthopoxvirus: Cowpox virus, p.75 -88. In A. A. Mercer, A. Schmidt, and O. Weber (ed.), Poxviruses. Birkhauser, Basel, Switzerland.
    18. 18
  18. Finney, D. J.1978 . Statistical methods in biological assays, 2nd ed. Macmillan Publishing Co., New York, NY.
    19. 18
  19. Froggatt, G. C., G. L. Smith, and P. M. Beard.2007 . Vaccinia virus gene F3L encodes an intracellular protein that affects the innate immune response. J. Gen. Virol. 88:1917-1921.[Abstract/Free Full Text]
    20. 19
  20. Fujita, Y., G. Krause, M. Scheffner, D. Zechner, H. E. Leddy, J. Behrens, T. Sommer, and W. Birchmeier. 2002. Hakai, a c-Cbl-like protein, ubiquitinates and induces endocytosis of the E-cadherin complex. Nat. Cell. Biol. 4:222-231.[CrossRef][Medline]
    21. 20
  21. Furukawa, M., Y. J. He, C. Borchers, and Y. Xiong. 2003. Targeting of protein ubiquitination by BTB-Cullin 3-Roc1 ubiquitin ligases. Nat. Cell Biol. 5:950-951.[CrossRef][Medline]
    22. 21
  22. Garner, M. G., S. D. Sawarkar, E. K. Brett, J. R. Edwards, V. B. Kulkarni, D. B. Boyle, and S. N. Singh. 2000. The extent and impact of sheep pox and goat pox in the state of Maharashtra, India. Trop. Anim. Health. Prod. 32:205-223.[CrossRef][Medline]
    23. 22
  23. Gershon, P. D., and D. N. Black. 1988. A comparison of the genomes of capripoxvirus isolates of sheep, goats, and cattle. Virology 164:341-349.[CrossRef][Medline]
    24. 23
  24. Geyer, R., S. Wee, S. Anderson, J. Yates, and D. A. Wolf. 2003. BTB/POZ domain proteins are putative substrate adaptors for cullin 3 ubiquitin ligases. Mol. Cell 12:783-790.[CrossRef][Medline]
    25. 24
  25. Goswami, B. B., and R. I. Glazer. 1991. A simplified method for the production of recombinant baculovirus. BioTechniques 10:626-630.[Medline]
    26. 25
  26. Guerin, J. L., J. Gelfi, S. Boullier, M. Delverdier, F. A. Bellanger, S. Bertagnoli, I. Drexler, G. Sutter, and F. Messud-Petit. 2002. Myxoma virus leukemia-associated protein is responsible for major histocompatibility complex class I and Fas-CD95 down-regulation and defines scrapins, a new group of surface cellular receptor abductor proteins. J. Virol. 76:2912-2923.[Abstract/Free Full Text]
    27. 26
  27. Hailat, N., O. Al-Rawashdeh, S. Lafi, and Z. Al-Bateineh. 1994. An outbreak of sheep pox associated with unusual winter conditions in Jordan. Trop. Anim. Health Prod. 26:79-80.[CrossRef][Medline]
    28. 27
  28. Hara, T., H. Ishida, R. Raziuddin, S. Dorkhom, K. Kamijo, and T. Miki. 2004. Novel kelch-like protein, KLEIP, is involved in actin assembly at cell-cell contact sites of Madin-Darby canine kidney cells. Mol. Biol. Cell 15:1172-1184.[Abstract/Free Full Text]
    29. 28
  29. Hollinshead, M., G. Rodger, H. Van Eijl, M. Law, R. Hollinshead, D. J. Vaux, and G. L. Smith. 2001. Vaccinia virus utilizes microtubules for movement to the cell surface. J. Cell Biol. 154:389-402.[Abstract/Free Full Text]
    30. 29
  30. Jiang, S., H. K. Avraham, S. Y. Park, T. A. Kim, X. Bu, S. Seng, and S. Avraham. 2005. Process elongation of oligodendrocytes is promoted by the Kelch-related actin-binding protein Mayven. J. Neurochem. 92:1191-1203.[CrossRef][Medline]
    31. 30
  31. Kaabeche, K., H. Guenou, D. Bouvard, N. Didelot, A. Listrat, and P. J. Marie. 2005. Cbl-mediated ubiquitination of alpha5 integrin subunit mediates fibronectin-dependent osteoblast detachment and apoptosis induced by FGFR2 activation. J. Cell Sci. 118:1223-1232.[Abstract/Free Full Text]
    32. 31
  32. Kara, P. D., C. L. Afonso, D. B. Wallace, G. F. Kutish, C. Abolnik, Z. Lu, F. T. Vreede, L. C. Taljaard, A. Zsak, G. J. Viljoen, and D. L. Rock. 2003. Comparative sequence analysis of the South African vaccine strain and two virulent field isolates of Lumpy skin disease virus. Arch. Virol. 148:1335-1356.[Medline]
    33. 32
  33. Kitching, R. P., P. P. Bhat, and D. N. Black. 1989. The characterization of African strains of capripoxvirus. Epidemiol. Infect. 102:335-343.[Medline]
    34. 33
  34. Kitching, R. P., and W. P. Taylor. 1986. Insect transmission of capripoxvirus. Res. Vet. Sci. 40:255-258.[Medline]
    35. 34
  35. Kitching, R. P., and W. P. Taylor. 1985. Transmission of capripoxvirus. Res. Vet. Sci. 39:196-199.[Medline]
    36. 35
  36. Kobayashi, A., M. I. Kang, H. Okawa, M. Ohtsuji, Y. Zenke, T. Chiba, K. Igarashi, and M. Yamamoto. 2004. Oxidative stress sensor Keap1 functions as an adaptor for Cul3-based E3 ligase to regulate proteasome degradation of Nrf2. Mol. Cell. Biol. 24:7130-7139.[Abstract/Free Full Text]
    37. 36
  37. Kochneva, G., I. Kolosova, T. Maksyutova, E. Ryabchikova, and S. Shchelkunov. 2005. Effects of deletions of kelch-like genes on cowpox virus biological properties. Arch. Virol. 150:1857-1870.[CrossRef][Medline]
    38. 37
  38. Kotwal, G. J., and B. Moss. 1988. Analysis of a large cluster of nonessential genes deleted from a vaccinia virus terminal transposition mutant. Virology 167:524-537.[Medline]
    39. 38
  39. Krek, W. 2003. BTB proteins as henchmen of Cul3-based ubiquitin ligases. Nat. Cell. Biol. 5:950-951.[CrossRef][Medline]
    40. 39
  40. Lefevre, P. C. 1983. La variole ovine (clavelée) et la variole caprine. Etudes et synthèses de l'IEMVT. Institut d'Elevage et de Médecine Vétérinaire des Pays Tropicaux (IEMVT), Maisons-Alfort, France.
    41. 40
  41. Mallardo, M., S. Schleich, and J. Krijnse Locker. 2001. Microtubule-dependent organization of vaccinia virus core-derived early mRNAs into distinct cytoplasmic structures. Mol. Biol. Cell 12:3875-3891.[Abstract/Free Full Text]
    42. 41
  42. Mansouri, M., E. Bartee, K. Gouveia, B. T. Hovey-Nerenberg, J. Barrett, L. Thomas, G. Thomas, G. McFadden, and K. Fruh. 2003. The PHD/LAP-domain protein M153R of myxomavirus is a ubiquitin ligase that induces the rapid internalization and lysosomal destruction of CD4. J. Virol. 77:1427-1440.[CrossRef][Medline]
    43. 42
  43. Mercer, A. A., S. B. Fleming, and N. Ueda. 2005. F-box-like domains are present in most poxvirus ankyrin repeat proteins. Virus Genes 31:127-133.[CrossRef][Medline]
    44. 43
  44. Moore, D. M., L. Zsak, J. G. Neilan, Z. Lu, and D. L. Rock. 1998. The African swine fever virus thymidine kinase gene is required for efficient replication in swine macrophages and for virulence in swine. J. Virol. 72:10310-10315.[Abstract/Free Full Text]
    45. 44
  45. Moyer, R. W., B. Arif, D. N. Black, D. B. Boyle, R. M. Buller, K. R. Dumbell, J. J. Esposito, G. McFadden, B. Moss, A. Mercer, S. Ropp, D. N. Tripathy, and C. Upton. 2000. Family Poxviridae, p. 137-147. In M. H. V. van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle, and R. B. Wickner (ed.), Virus taxonomy. Academic Press, Inc., New York, NY.
    46. 45
  46. Perkus, M. E., S. J. Goebel, S. W. Davis, G. P. Johnson, E. K. Norton, and E. Paoletti. 1991. Deletion of 55 open reading frames from the termini of vaccinia virus. Virology 180:406-410.[CrossRef][Medline]
    47. 46
  47. Pintard, L., J. H. Willis, A. Willems, J. L. Johnson, M. Srayko, T. Kurz, S. Glaser, P. E. Mains, M. Tyers, B. Bowerman, and M. Peter. 2003. The BTB protein MEL-26 is a substrate-specific adaptor of the CUL-3 ubiquitin-ligase. Nature 425:311-316.[CrossRef][Medline]
    48. 47
  48. Pires de Miranda, M., P. C. Reading, D. C. Tscharke, J. M. Brendan, and G. L. Smith. 2003. The vaccinia virus kelch-like protein C2L affects calcium-independent adhesion to the extracellular matrix and inflammation in a murine intradermal model. J. Gen. Virol. 84:2459-2471.[Abstract/Free Full Text]
    49. 48
  49. Prag, S., and J. C. Adams. 2003. Molecular phylogeny of the kelch-repeat superfamily reveals an expansion of BTB/kelch proteins in animals. BMC Bioinformatics 4:42.[CrossRef][Medline]
    50. 49
  50. Robinson, D. N., and L. Cooley. 1997. Drosophila kelch is an oligomeric ring canal actin organizer. J. Cell Biol. 138:799-810.[Abstract/Free Full Text]
    51. 50
  51. Romero, C. H., T. Barrett, R. W. Chamberlain, R. P. Kitching, M. Fleming, and D. N. Black. 1994. Recombinant capripoxvirus expressing the hemagglutinin protein gene of rinderpest virus: protection of cattle against rinderpest and lumpy skin disease viruses. Virology 204:425-429.[CrossRef][Medline]
    52. 51
  52. Romero, C. H., T. Barrett, S. A. Evans, R. P. Kitching, P. D. Gershon, C. Bostock, and D. N. Black. 1993. Single capripoxvirus recombinant vaccine for the protection of cattle against rinderpest and lumpy skin disease. Vaccine 11:737-742.[CrossRef][Medline]
    53. 52
  53. Romero, C. H., T. Barrett, R. P. Kitching, V. M. Carn, and D. N. Black. 1994. Protection of cattle against rinderpest and lumpy skin disease with a recombinant capripoxvirus expressing the fusion protein gene of rinderpest virus. Vet. Rec. 135:152-154.[Abstract]
    54. 53
  54. Sanderson, C. M., M. Hollinshead, and G. L. Smith. 2000. The vaccinia virus A27L protein is needed for the microtubule-dependent transport of intracellular mature virus particles. J. Gen. Virol. 81:47-58.[Abstract/Free Full Text]
    55. 54
  55. Sanderson, C. M., and G. L. Smith. 1998. Vaccinia virus induces Ca2+-independent cell-matrix adhesion during the motile phase of infection. J. Virol. 72:9924-9933.[Abstract/Free Full Text]
    56. 55
  56. Shchelkunov, S., A. Totmenin, and I. Kolosova. 2002. Species-specific differences in organization of orthopoxvirus kelch-like proteins. Virus Genes. 24:157-162.[CrossRef][Medline]
    57. 56
  57. Spence, H. J., I. Johnston, K. Ewart, S. J. Buchanan, U. Fitzgerald, and B. W. Ozanne. 2000. Krp1, a novel kelch related protein that is involved in pseudopod elongation in transformed cells. Oncogene 19:1266-1276.[CrossRef][Medline]
    58. 57
  58. Stogios, P. J., G. S. Downs, J. J. S. Jauhal, S. K. Nandra, and G. G. Prive. 2005. Sequence and structural analysis of BTB domain proteins. Genome Biol. 6:R82.[CrossRef][Medline]
    59. 58
  59. Stogios, P. J., and G. G. Prive. 2004. The BACK domain in BTB-kelch proteins. Trends Biochem. Sci. 29:634-637.[CrossRef][Medline]
    60. 59
  60. Taylor, G., E. J. Stott, G. Wertz, and A. Ball. 1991. Comparison of the virulence of wild-type thymidine kinase (tk)-deficient and tk+ phenotypes of vaccinia virus recombinants after intranasal inoculation of mice. J. Gen. Virol. 72:125-130.[Abstract/Free Full Text]
    61. 60
  61. Tulman, E. R., C. L. Afonso, Z. Lu, L. Zsak, G. F. Kutish, and D. L. Rock. 2001. Genome of lumpy skin disease virus. J. Virol. 75:7122-7130.[Abstract/Free Full Text]
    62. 61
  62. Tulman, E. R., C. L. Afonso, Z. Lu, L. Zsak, J.-H. Sur, N. T. Sandybaev, U. Z. Kerembekova, V. L. Zaitsev, G. F. Kutish, and D. L. Rock. 2002. The genomes of sheeppox and goatpox viruses. J. Virol. 76:6054-6061.[Abstract/Free Full Text]
    63. 62
  63. Turner, P. C., and R. W. Moyer. 1992. A PCR-based method for manipulation of the vaccinia virus genome that eliminates the need for cloning. BioTechniques 13:764-771.[Medline]
    64. 63
  64. Wallace, D. B., and G. J. Viljoen. 2005. Immune responses to recombinants of the South African vaccine strain of lumpy skin disease virus generated by using thymidine kinase gene insertion. Vaccine 23:3061-3067.[CrossRef][Medline]
    65. 64
  65. Wang, H. R., Y. Zhang, B. Ozdamar, A. A. Ogunjimi, E. Alexandrova, G. H. Thomsen, and J. L. Wrana. 2003. Regulation of cell polarity and protrusion formation by targeting RhoA for degradation. Science 302:1775-1779.[Abstract/Free Full Text]
    66. 65
  66. Zsak, L., Z. Lu, G. F. Kutish, J. G. Neilan, and D. L. Rock. 1996. An African swine fever virus virulence-associated gene NL-S with similarity to the herpes simplex virus ICP34.5 gene. J. Virol. 70:8865-8871.[Abstract]

Journal of Virology, October 2007, p. 11392-11401, Vol. 81, No. 20
0022-538X/07/$08.00+0     doi:10.1128/JVI.01093-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Babiuk, S., Bowden, T. R., Parkyn, G., Dalman, B., Hoa, D. M., Long, N. T., Vu, P. P., Bieu, D. X., Copps, J., Boyle, D. B. (2009). Yemen and Vietnam capripoxviruses demonstrate a distinct host preference for goats compared with sheep. J. Gen. Virol. 90: 105-114 [Abstract] [Full Text]  
  • Balinsky, C. A., Delhon, G., Smoliga, G., Prarat, M., French, R. A., Geary, S. J., Rock, D. L., Rodriguez, L. L. (2008). Rapid Preclinical Detection of Sheeppox Virus by a Real-Time PCR Assay. J. Clin. Microbiol. 46: 438-442 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Balinsky, C. A.
Right arrow Articles by Rock, D. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Balinsky, C. A.
Right arrow Articles by Rock, D. L.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»