This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Laird, M. E.
Right arrow Articles by Desrosiers, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Laird, M. E.
Right arrow Articles by Desrosiers, R. C.

 Previous Article  |  Next Article 

Journal of Virology, October 2007, p. 10838-10848, Vol. 81, No. 20
0022-538X/07/$08.00+0     doi:10.1128/JVI.00831-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Infectivity and Neutralization of Simian Immunodeficiency Virus with FLAG Epitope Insertion in gp120 Variable Loops{triangledown}

Melissa E. Laird and Ronald C. Desrosiers*

New England Primate Research Center, Department of Microbiology and Molecular Genetics, Harvard Medical School, Southborough, Massachusetts 01772-9102

Received 18 April 2007/ Accepted 27 July 2007


arrow
ABSTRACT
 
A FLAG epitope tag was substituted within variable loop 1 (V1), 2 (V2), or 4 (V4) of the gp120 envelope glycoprotein of simian immunodeficiency virus strain 239 (SIV239) to evaluate the extent to which each variable loop may serve as a target for antibody-mediated neutralization. Two sites within each variable loop of SIV239 were chosen for individual epitope tag insertions. FLAG epitope substitutions were also made in the V1, V2, and V4 loops of a neutralization-sensitive derivative of SIV239, SIV316. Of the 10 FLAG-tagged recombinant viruses analyzed, three (SIV239FV1b, SIV239FV2b, and SIV239FV4a) replicated with kinetics similar to those of the parental strain, SIV239, in both CEMx174 cells and the immortalized rhesus monkey T-cell line 221. The SIV316FV1b and SIV316FV4a FLAG variants replicated with a substantial lag, and the five remaining recombinants did not replicate detectably. Both gp160 and gp120 from replication-competent FLAG variants could be immunoprecipitated from transfected 293T cells by the anti-gp120 rhesus monoclonal antibody (RhMAb) 3.11H, the anti-FLAG MAb M2, and CD4-immunoglobulin, whereas only unprocessed gp160 was detected in 293T cells transfected with replication-defective variants. Furthermore, gp120 was detectably incorporated only into virions that were infectious. SIV239FV1b was sensitive to neutralization by MAb M2, with a 50% inhibitory concentration of 1 µg/ml. Neither SIV239FV2b nor SIV239FV4a was sensitive to M2 neutralization. The ability of the M2 antibody to neutralize SIV239FV1b infectivity was associated with an increased ability of the M2 antibody to detect native, oligomeric SIV239FV1b envelope protein on the surfaces of cells relative to that for the other SIV FLAG variants. Furthermore, SIV239FV1b was globally more sensitive to antibody-mediated neutralization than was parental SIV239 when these strains were screened with a panel of anti-SIV MAbs of various specificities. These results indicate that the V1 loop can serve as an effective target for neutralization on SIV239FV1b. However, antibody-mediated neutralization of this variant, similar to that of other SIV239 variants that have been studied previously, was associated with a global increase in neutralization sensitivity. These results suggest that the variable loops on the neutralization-resistant SIV239 strain are difficult for antibodies to access effectively and that mutations that allow neutralization have global effects on the trimeric envelope glycoprotein structure and accessibility.


arrow
INTRODUCTION
 
Sequence comparisons of human immunodeficiency virus type 1 (HIV-1) and simian immunodeficiency virus (SIV) isolates reveal the existence of five highly variable regions within the surface subunit of the viral envelope glycoprotein (gp120) (3, 4, 28, 43, 47). Analysis of the gp120 secondary structure predicts that four of these variable regions are set apart from the remainder of the protein by intrachain disulfide bonds (17, 19, 29). These four sequestered variable regions are referred to as variable loops and are designated V1, V2, V3, and V4. Although the envelope protein of SIV differs clearly from that of HIV-1, the placement of the variable loops and overall secondary structure of the gp120s are thought to be generally similar (6, 19, 41). It has been suggested that the mature envelope trimer is assembled with the variable loops exposed on the outer surface (27, 48). Thus, the variable loops may act as an antigenic shield by occluding more-conserved regions within the core of the envelope complex from antibody recognition.

A number of studies have investigated the role of the variable loops in the occlusion of conserved epitopes within the gp120 core and the effects of deletion of one or more of the variable loops on sensitivity to antibody-mediated neutralization (5, 22-24, 40, 42, 49). The removal of both the V1 and V2 loops from the HXB-2 strain of HIV resulted in a variant with only a modest delay in replication and a substantially increased sensitivity to monoclonal antibodies (MAbs) directed to the V3 loop and to epitopes induced upon CD4 binding (CD4i epitopes) (5). However, the deletion of V1 and V2 did not seem to enhance neutralization sensitivity to antibodies targeted to the CD4 binding site (5). Further studies in which the V2 loop was deleted showed a substantial increase in sensitivity to CD4i MAbs and in exposure of CD4i epitopes (42, 49). Upon deletion of the V1/V2 loop region from SIV239 gp120, the resulting variant (SIVmac{Delta}V1V2) replicated with a decreased rate compared to that of the parental strain, SIV239, and exhibited markedly increased sensitivity to neutralization by MAbs targeting multiple epitopes on gp120 (22, 23).

Functionally, the V1 and V2 loops are thought to partially shield the binding sites for the cellular receptor (CD4) and the coreceptor on gp120 (6). Binding to CD4 induces conformational rearrangements in which the V1 and V2 loops are displaced to reveal the previously shielded coreceptor binding site (6, 27, 48). Conserved residues at the tip and base of the V3 loop are critically important for coreceptor binding (9, 39). Additionally, the specific placement of a positively charged amino acid at position 11 or 25 within the V3 loop dictates CXCR4 coreceptor usage over CCR5 usage (38).

The gp120 variable loops are thought to be important targets of antibody recognition. Considerable research on the role of the V3 loop in the anti-HIV-1 antibody response suggests that anti-V3 antibodies are extremely strain specific and neutralize mainly tissue culture-adapted virus strains, whereas primary HIV-1 isolates remain mostly resistant to V3 antibodies (32), with the exception of the rather broadly acting MAb 447-52D (16). Several studies have characterized highly strain-specific antibodies targeting the V1 and/or V2 loop, although exact epitopes have not been mapped (8, 11, 12, 14, 44). In SIV, the V4 loop contains a conformational epitope involved in antibody-mediated neutralization (20, 45). In addition, SIV isolates that have escaped neutralization in monkeys have sequence changes that map to the V4 loop (1, 7, 25), suggesting that the V4 loop may be a main determinant of the ability of antibodies to neutralize virus in the context of SIV infection.

To further examine the extent to which each variable loop can act as a target for neutralization, we constructed a panel of SIV239 variants that contain the FLAG epitope tag substituted at several sites within the V1, V2, or V4 loop. The FLAG tag was selected because internal recognition of the linear FLAG epitope by its cognate antibody, M2, occurs with a high affinity (2). In this report, we describe the effects of FLAG substitution within the SIV239 V1, V2, or V4 loop on sensitivity to anti-FLAG and anti-SIV MAb-mediated neutralization, virus replication efficiency, and envelope expression and processing. Specifically, we generated three SIV239FLAG variants (SIV239FV1b, SIV239FV2b, and SIV239FV4a) that displayed replication kinetics similar to those of the parental strain, SIV239. We demonstrate that the introduction of the FLAG epitope tag within the V1 loop produces a virus that is sensitive to anti-FLAG antibody neutralization but that this recombinant virus is also globally more sensitive to anti-SIV antibody-mediated neutralization.


arrow
MATERIALS AND METHODS
 
Site-specific mutagenesis and plasmid construction. Mutations in env within the pSP72-239-3' plasmid (34) or pSP72-316-3' plasmid (33) were created by site-directed mutagenesis using a QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). The following mutagenic primers were used (nucleotides encoding the FLAG tag are underlined): for 239FV1a nucleotides 6958 to 7038, 5'-GATTATAAAGATGATGATGATAAAATAACAACAACAGCATCAACAACATCAACGACAGCATCAGCAAAAGTAGACA TGGTC-3'; for 239FV1a nucleotides 6981 to 6919, 5'-TTTATCATCATCATCTTTATAATCTGTCTCACTTTTATTGCATCTCATAGTAATGCATA ATGG-3'; for 239FV1b and 316FV1b nucleotides 7015 to 7080, 5'-GATTATAAAGATGATGATGATAAAAATGAGACTAGTTCTTGTATAGCCCAGGATAATTGCACAGGC-3'; for 239FV1b and 316FV1b nucleotides 7038 to 6967, 5'-TTTATCATCATCATCTTTATAATCTGTCGTTGATGTTGTTGATGCTGTTGTTGTTATTGATTTTGTCAATCC-3'; for 239FV2a nucleotides 7132 to 7194, 5'-GATTATAAAGATGATGATGATAAAAATGAAACTTGGTACTCTGCAGATTTGGTATGTGAACAAGGG-3'; for 239FV2a nucleotides 7152 to 7078, 5'-TTTATCATCATCATCTTTATAATCTTTTAACCCTGTCATGTTGAATTTACAGCTTATCATTTGCTCTTGTTCCAAG CC-3'; for 239FV2b nucleotides 7186 to 7235, 5'-GATTATAAAGATGATGATGATAAAAATAACACTGGTAATGAAAGTAGATGTTACATGAACCACTG-3'; for 239FV2b nucleotides 7194 to 7147, 5'-TTTATCATCATCATCTTTATAATCACATACCAAATCTGCAGAGTACCAAGTTTCATTGTACTC-3'; for 239FV4a and 316FV4a nucleotides 7840 to 7926, 5'-GATTATAAAGATGATGATGATAAGCCAAAGGAACAGCATAAAAGGAATTA CGTGCCATGTCATATAAGACAAATAATCAACACTTGG-3'; for 239FV4a and 316FV4a nucleotides 7863 to 7792, 5'-TTTATCATCATCATCTTTATAATCTTCTACCCAATTTAGAAACCAATTCATTTTACAGTAGAGGAACTCTC C-3'; for 239FV4b nucleotides 7861 to 7926, 5'-GATTATAAAGATGATGATGATAAAAATTACGTGCCATGTCATATTAGACAAATAATCAACACTT GG-3'; and for 239FV4b nucleotides 7884 to 7820, 5'-TTTATCATCATCATCTTTATAATCCTGGTTAGCTGTATTCCTATCTTCTACCCAATTTAGAAACC-3'. The mutagenic primers were purchased from Sigma-Genosys Biotechnologies, Inc. (The Woodlands, TX). To generate full-length proviral DNAs of the FLAG variants, the mutated pSP72-239-3' and pSP72-316-3' halves and p239SpX5' were digested with XhoI and SphI (New England Biolabs, Beverly, MA), and the corresponding fragments were ligated using T4 DNA ligase (New England Biolabs, Beverly, MA).

DNA sequencing. Mutations were confirmed by sequencing. Cloned plasmids containing mutated envelope genes were sequenced with a CEQ8000 genetic analysis system, using a dye terminator cycle sequencing chemistry kit as specified by the manufacturer (Beckman-Coulter, Fullerton, CA).

Virus stocks and cell culture. To generate virus stocks, full-length proviral DNA plasmids were used to transfect 293T cells, using the calcium phosphate method (Promega, Madison, WI). The culture medium was changed at 24 h posttransfection, and supernatants were harvested on day 3 posttransfection. Virus from the supernatants was quantified by determining the concentration of p27 capsid protein by an antigen capture assay according to the manufacturer's instructions (Coulter Corp., Hialeah, FL). 293T, Rh221-89, CEMx174, and LTR-SEAP-CEMx174 cells were grown and maintained as previously described (30).

Growth curves. To determine virus growth in CEMx174 and Rh221-89 cells, 2 x 106 cells were infected with virus stocks containing 10 ng of p27 equivalents. At 3 hours postinfection, the cells were pelleted and resuspended in 10 ml of virus-free RPMI 1640 supplemented with 10 or 20% fetal calf serum and 10% interleukin-2. Five milliliters of cell-free supernatant was collected every 3 to 4 days and replaced with fresh medium. The amount of p27 capsid protein in the cell-free supernatant was quantified as described above.

Infectivity assay. Viral infectivity was measured using the LTR-SEAP-CEMx174 indicator cell line (30). Nine serial twofold dilutions of virus were made, starting from 10 ng of p27 equivalents of 293T cell-produced virus stock, as quantified by p27 antigen capture. LTR-SEAP-CEMx174 cells (4 x 104) were added to each well. The cells were incubated at 37°C in a humidified CO2 incubator. At 3 days postinfection, secreted alkaline phosphatase (SEAP) activity was measured in the cell-free supernatant, using a Phosphalight kit (Applied Biosystems, Foster City, CA).

Immunoprecipitation and Western blotting. 293T cells were transfected with full-length proviral DNA clones as described above. On day 3 posttransfection, cells were washed off the plate, using 0.01 M phosphate-buffered saline (PBS), and lysed in NP-40 lysis buffer (0.05 M Tris-HCl, pH 8, 2 mM EDTA, 0.03 M NaCl, and 1% NP-40 in PBS). Cell lysates were precleared for 2 h at 4°C with 30 µl protein A/G Sepharose bead slurry (Santa Cruz Biotechnology, Santa Cruz, CA). The viral protein content in each precleared lysate was quantified using a p27 antigen capture assay. Lysate samples normalized for p27 content were immunoprecipitated with either the anti-gp120 RhMAb 3.11H, the anti-FLAG MAb M2 (Sigma-Aldrich, St. Louis, MO), or CD4-immunoglobulin G2 (CD4-IgG2) and with 30 µl protein A/G Sepharose beads for 4 h at 4°C. The beads were then washed three times with cold 0.01 M PBS, mixed with 25 µl 2x Laemmli buffer (Sigma-Aldrich, St. Louis, MO), and boiled for 8 minutes. Samples were resolved in a 6% polyacrylamide-sodium dodecyl sulfate (SDS) gel and transferred to a polyvinylidene difluoride membrane (Millipore, Bedford, MA). The RhMAb 3.11H was a gift of J. E. Robinson (Tulane University Medical School, New Orleans, LA). CD4-IgG2 was a gift of D. Burton (Scripps Research Institute, San Diego, CA).

Membranes were incubated for 1 h in blocking buffer (5% milk in PBS-0.05% Tween 20) and then incubated with a MAb recognizing the gp120 envelope glycoprotein (3.11H) or the FLAG epitope (M2). Horseradish peroxidase-conjugated anti-rhesus IgG was used to detect antibody 3.11H, and horseradish peroxidase-conjugated anti-mouse IgG was used to detect antibody M2. The membranes were treated with a chemiluminescent substrate (Pierce, Rockford, IL) and visualized and analyzed with a Fuji phosphorimager.

Envelope incorporation into virions. Cell debris was pelleted from virus-containing supernatants by two consecutive centrifugation steps for 10 min at 2,600 x g. Virions were then pelleted by centrifugation for 2 h at 16,000 x g at 4°C. The resulting viral pellet was resuspended in 1 ml 0.01 M PBS and pelleted again by centrifugation at 16,000 x g. After the second centrifugation, the viral pellets were resuspended in 50 µl of PBS, and the virus concentration was determined by p27 antigen capture as described above. Equivalents of p27 were mixed with 5x Laemmli buffer and boiled for 8 min. The samples were resolved in an 8 to 16% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) gradient gel (Invitrogen, Carlsbad, CA), transferred, and blocked as described above. The membranes were then incubated with the gp120 MAb 3.11H or the p27 MAb 2F12, obtained through the NIH AIDS Research and Reference Reagent Program (Bethesda, MD). Membranes were blotted, visualized, and analyzed as described above.

Neutralization. The neutralization sensitivity of each virus was tested using the SEAP reporter cell assay as described previously (30). Aliquots of all virus stocks used in these experiments were subjected to serial twofold dilutions, and their titers were determined on CEMx174-SEAP reporter cells. Virus equivalent to 5 ng of p27 capsid protein was determined to be the lowest level of viral input sufficient to give a reliable SEAP signal within the linear range of the assay for all of the virus strains. SEAP activity was measured on the earliest days postinfection when levels were sufficiently over background to give reliable measurements, ranging from 2.5 to 3 days for SIV239, 5 days for SIV239FV2b, and 7 days for SIV239FV1b and SIV239FV4a.

To perform neutralization assays, 96-well plates were organized as follows. Twenty-five microliters of medium (RPMI 1640 plus 10% fetal calf serum [R10]) was added to each well in the first three columns. To the wells in the remaining columns (columns 4 through 12), 25-µl aliquots of successive twofold dilutions of test antibody in R10 were added. For monkey plasma, 25 µl of a 1:10 dilution of plasma was mixed with 75 µl of the test virus. This constitutes a 1:40 dilution in the representative graph. Virus equivalent to 5 ng of p27 capsid protein in a total volume of 75 µl R10 was then added to each well in columns 3 through 12. Virus-free R10 was added to each well in columns 1 and 2 (mock). The plate was incubated for 1 h at 37°C. Following incubation, 4 x 104 target cells (LTR-SEAP-CEMx174) in 100 µl of R10 were added to each well. The plate was then placed in a humidified CO2 incubator at 37°C for 3 to 7 days. SEAP activity was measured according to the manufacturer's recommendations, with modifications as described previously (30). Neutralizing activity for all antibodies was measured in triplicate and reported as the average. All test MAbs were a gift of J. E. Robinson (Tulane University Medical School).

Flow cytometry. Envelope expression on the surfaces of transfected cells was monitored by flow cytometry. Full-length proviral DNA plasmids and the GFP expression plasmid pTracer (Invitrogen, Carlsbad, CA) were used to cotransfect 293T cells by the calcium phosphate method as described above. The cells were harvested at day 3 posttransfection and washed twice with PBS-5% fetal calf serum. The cells were incubated with the anti-FLAG MAb M2. The primary antibody was detected with an allophycocyanin-conjugated anti-mouse IgG (Invitrogen, Carlsbad, CA), and cells were fixed in 2% paraformaldehyde-PBS. The level of envelope binding was quantitated by flow cytometry. Eighty thousand events were collected on a FACSCalibur instrument (BD Biosciences, San Jose, CA), and data were analyzed using FlowJo (Tree Star Inc., Ashland, OR). Envelope-expressing cells were selected from the live cell population by first gating on green fluorescent protein-positive cells and subsequently examining levels of allophycocyanin expression.


arrow
RESULTS
 
Introduction of the FLAG epitope tag into SIV gp120 variable loops by site-directed mutagenesis. To investigate the accessibility of different sites within the variable loops of the SIV envelope glycoprotein gp120 to neutralizing antibodies, the FLAG epitope tag was substituted for native amino acid sequences at six sites within SIV239 by site-directed mutagenesis. The FLAG tag was substituted at two sites each within V1, V2, and V4 (Fig. 1). Additionally, four of these sites were also chosen for FLAG substitution within the variable loops of SIV316, a derivative of SIV239 that is markedly more sensitive to antibody-mediated neutralization (33).


Figure 1
View larger version (22K):
[in this window]
[in a new window]

 
FIG. 1. FLAG substitutions within SIV239 variable loops. (A) Schematic representation of FLAG epitope substitution sites within the gp120 envelope glycoprotein. *, substitutions also made in the SIV316 background. (B) Alignment of FLAG variant sequences and wild-type SIV239 sequence.

The FLAG epitope is an eight-amino-acid linear epitope with the sequence DYKDDDDK (18). Designed synthetically as an epitope tag, the sequence of the FLAG tag specifically promotes expression of the linear epitope on the exterior of the tagged protein of interest. The combination of acidic and basic amino acids together creates a water-soluble region that enhances surface exposure of the tag. Importantly, FLAG was selected as the epitope tag because of its ability to be recognized internally by the MAb M2 in a context-independent manner (2). This potential for internal recognition allows the use of the substituted FLAG epitope tag and its cognate antibody, M2, to investigate the roles of different variable loop sites in antibody-mediated neutralization. The specific sites for FLAG substitution within gp120 were chosen based on the following criteria: (i) sites known to contain extensive sequence variation; (ii) substitution rather than insertion of the FLAG tag, to not dramatically alter variable loop size or length; (iii) substitution for eight native amino acids that contained homologous amino acids compared to the FLAG tag or in areas that contained a mixture of both basic and acidic amino acids; (iv) sites that, upon FLAG introduction, would not induce changes in the glycosylation patterns of gp120; and (v) sites that, when replaced, would not alter the backbone sequence of SIV239 compared to that of SIV316.

Effects of FLAG substitution within SIV239 and SIV316 on replication. We compared the replication of the FLAG virus variants with that of the parental SIV239 and SIV316 strains in two cell lines, the human B-cell/T-cell hybrid line CEMx174 (Fig. 2A and C) and the rhesus immortalized T-cell line Rh221-89 (Fig. 2B and D). Normalized amounts of FLAG-tagged virus variants and parental virus stocks were used to infect each cell line as described in Materials and Methods. Cell supernatants were harvested on the indicated days, and viral replication was monitored by the production of p27 capsid protein. Three of the SIV239FLAG variants (SIV239FV1b, SIV239FV2b, and SIV239FV4a) replicated with kinetics very similar to those of parental SIV239 in Rh221-89 cells, whereas these SIV239FLAG variants replicated with a slight delay compared to SIV239 in CEMx174 cells (Fig. 2B and A, respectively). Two of the SIV316FLAG variants (SIV316FV1b and SIV316FV4a) were competent for replication; however, this replication was delayed compared to that of the parental SIV316 strain in both cell lines (Fig. 2C and D). Although not evident in Fig. 2C or D, SIV316FV1b did replicate at a very low level, with markedly delayed kinetics compared to those of both SIV316 and SIV316FV4. The remaining FLAG variants (SIV239FV1a, SIV239FV2a, SIV239FV4b, SIV316FV1a, and SIV316FV2a) did not replicate detectably in either cell line. SIV316FV1b, SIV316FV4a, and the five replication-incompetent strains were not studied further.


Figure 2
View larger version (22K):
[in this window]
[in a new window]

 
FIG. 2. Growth curves for parental and FLAG variant viruses in CEMx174 and Rh221-89 cells. Data for SIV239 parental and SIV239FLAG variant viruses grown in CEMx174 (A) or Rh221-89 (B) cells and for SIV316 and SIV316FLAG variant viruses grown in CEMx174 (C) or Rh221-89 (D) cells are shown. Although not readily apparent in panel C or D, SIV316FV1b was able to replicate at very low levels, with a marked delay in replication compared to that of SIV316.

Infectivities of SIV239FLAG variants. LTR-SEAP-CEMx174 cells were used to quantify the infectivity of each of the viruses under conditions that approximated a single round of infection. LTR-SEAP-CEMx174 cells secrete SEAP into the medium upon infection by SIV (30). The amount of SEAP secreted correlates directly with the amount of infectious virus and can be measured sensitively and accurately by a chemiluminescence assay. Cells were infected with normalized amounts of the parental SIV239 strain and the replication-competent SIV239FLAG variants (SIV239FV1b, SIV239FV2b, and SIV239FV4a). All of the SIV239FLAG variant viruses were slightly less infectious than the parental SIV239 strain (Fig. 3A). When virus activities were normalized to amounts of infectivity per nanogram of p27, SIV239FV2b and SIV239FV4a displayed an approximately 50% decrease in infectivity compared to parental SIV239, whereas SIV239FV1b showed a 75% decrease (Fig. 3B). Consistent with the growth curve experiments, the infectivities of SIV239FV1a, SIV239FV2a, and SIV239FV4b were below the limit of detection.


Figure 3
View larger version (14K):
[in this window]
[in a new window]

 
FIG. 3. Comparative infectivities of SIV239 and SIV239FLAG variant viruses. Virus stocks were obtained from transfection of 293T cells. Stocks were normalized by the amount of p27 and used to infect LTR-SEAP-CEMx174 cells. (A) SEAP activity was measured at 3 days postinfection. (B) SEAP activity normalized to the amount of p27.

Confirmation of gp120 expression and functional binding to CD4. To confirm the incorporation of the FLAG epitope into the envelope and its exposure on the surfaces of gp120 monomers, reciprocal immunoprecipitation experiments were performed. 293T cells that had been transfected transiently with the proviral DNA of either parental SIV239 or a SIV239FLAG variant were lysed in NP-40 lysis buffer. Lysates containing equivalent amounts of p27 were immunoprecipitated with the anti-gp120 MAb 3.11H or the anti-FLAG MAb M2. The anti-gp120 MAb 3.11H binds to a linear epitope in the V3 loop of gp120, and hence the FLAG substitutions within the V1, V2, or V4 loop are hypothesized not to interfere with antibody binding. Following immunoprecipitation, each sample was immunoblotted with 3.11H as well as M2. 3.11H was able to efficiently recognize the envelope glycoprotein precursor, gp160, in parental SIV239 and all of the SIV239FLAG variants tested (Fig. 4A). When M2 was used for immunoprecipitation and envelope was detected by blotting with 3.11H, gp160 was detected in all SIV239FLAG variants. 3.11H also detected the processed envelope glycoprotein, gp120, in parental SIV239 as well as in the replication-competent SIV239FLAG variants (SIV239FV1b, SIV239FV2b, and SIV239FV4a).


Figure 4
View larger version (36K):
[in this window]
[in a new window]

 
FIG. 4. Immunoprecipitation of envelope glycoproteins from cells transfected with SIV239 or SIV239FLAG variants. 293T cell lysates from cells transfected with full-length proviral DNA of either parental SIV239 or SIV239FLAG variants were immunoprecipitated with either the anti-gp120 MAb 3.11H or the anti-FLAG MAb M2 (A) or with CD4-IgG2 (B).

The FLAG substitution in the SIV239 variants may have altered or inhibited binding of the gp120 envelope glycoprotein to the CD4 receptor. To investigate this, immunoprecipitations of transfected 293T cell lysates were performed using CD4-IgG2, a modified form of the gp120 receptor (Fig. 4B). 3.11H was used to probe the envelope and M2 was used to detect the presence of FLAG. CD4-IgG2 readily bound the gp160 envelope glycoprotein precursor in parental SIV239 and all of the SIV239FLAG variant transfected cell lysates. CD4-IgG2 also immunoprecipitated processed gp120 in parental SIV239 and the FLAG variants SIV239FV1b, SIV239FV2b, SIV239FV4a, and to a limited extent, SIV239FV4b, confirming that the CD4 binding site was retained on these gp120 variants. When reprobed with M2, all envelope species within the SIV239FLAG variants that were previously recognized by CD4-IgG2 and detected by 3.11H were also shown to contain a FLAG epitope by recognition with M2.

Incorporation of FLAG-substituted envelope into virions. Mutations within the envelope glycoprotein of SIV239 have been shown to affect the incorporation of envelope into virions (50). Decreased envelope incorporation into virions is correlated with a decrease in infectivity of mutant viruses compared to that of parental SIV239 (50). To examine if the decreased infectivities of the SIV239FLAG variant viruses were related to altered levels of envelope incorporation into virions, the SIV239FLAG variant virions were concentrated, lysed, normalized by p27 content, separated by SDS-PAGE, and analyzed by Western blotting. Processed gp120 was detected in parental SIV239 virions as well as in the replication-competent FLAG variants, SIV239FV1b, SIV239FV2b, and SIV239FV4a (Fig. 5A), at different levels from that in parental SIV239. The processed envelope glycoprotein was detected using the anti-gp120 MAb 3.11H. In all instances, FLAG variant virions also contained increased amounts of the unprocessed envelope precursor, gp160, compared to that in parental SIV239. gp160 was the only envelope glycoprotein species detected in the virions of the replication-deficient FLAG variants SIV239FV1a, SIV239FV2a, and SIV239FV4b. The ratio of virion-associated gp120 to p27 capsid protein was determined for each of the SIV239FLAG variants by densitometric analysis and was then compared to that for wild-type SIV239 (Fig. 5B). The replication-competent FLAG variant viruses appeared to exhibit slight variations in the ability to incorporate gp120 into virions. SIV239FV1b incorporated 50% less envelope than did SIV239, whereas SIV239FV4a showed an almost equivalent amount of processed envelope to that seen in the wild-type virions. Interestingly, SIV239FV2b appeared to incorporate approximately twofold more gp120 than did wild-type SIV239. However, these are not considered major differences in envelope incorporation compared to other sequence variations that have been studied previously (51).


Figure 5
View larger version (28K):
[in this window]
[in a new window]

 
FIG. 5. Envelope glycoprotein incorporation into virions. Virions were pelleted, lysed, separated by SDS-PAGE, and visualized by Western blotting. (A) Virion-associated gp120 was detected using anti-gp120 MAb 3.11H, and p27 capsid protein was detected by MAb 2F12. (B) Densitometric analysis [(variant gp120/p27)/(parental gp120/p27)] of bands in panel A.

Neutralization of SIV239FLAG variants by anti-FLAG antibody M2 and SIV-positive monkey plasma. We next measured the neutralization sensitivities of the replication-competent SIV239FLAG variants, SIV239FV1b, SIV239FV2b, and SIV239FV4a, and the parental SIV239 strain to the anti-FLAG MAb M2. Although M2 was able to neutralize SIV239FV1b, strains SIV239FV2b and SIV239FV4a could not be neutralized by the M2 MAb (Fig. 6A). Fifty percent neutralization of SIV239FV1b by M2 was achieved at an antibody concentration of 1 µg/ml. The introduction of the FLAG epitope into the V1 loop of gp120 altered the sensitivity of this SIV239FLAG variant to neutralization by plasmas from SIV-positive monkeys compared to that of parental SIV239 (Fig. 6B). SIV239FV2b and SIV239FV4a displayed low-level neutralization sensitivities to SIV-positive pooled plasma, similar to that observed with SIV239. Fifty percent neutralization of parental SIV239, SIV239FV2b, and SIV239FV4a by pooled positive monkey plasma was achieved at a dilution of approximately 1/50. However, the substitution of the FLAG epitope within SIV239FV1b significantly enhanced the sensitivity to neutralization by SIV-positive plasma. Fifty percent neutralization of SIV239FV1b was achieved at a dilution of 1/400.


Figure 6
View larger version (14K):
[in this window]
[in a new window]

 
FIG. 6. Neutralization of SIV239 and SIV239FLAG variants by M2 and plasmas from SIV-positive monkeys. The graphs show comparative neutralization of parental SIV239 and SIV239FLAG variant viruses by anti-FLAG M2 (A) and pooled positive rhesus plasma (B).

Comparative neutralization of SIV239FLAG variants by selected MAbs. To investigate whether the substitution of FLAG in the gp120 variable loops globally altered accessibility of the trimer to MAbs, we measured the neutralization sensitivities of the three SIV239FLAG variant viruses to a panel of selected RhMAbs (Table 1). Twelve anti-gp120 MAbs were selected based on the following three criteria: (i) these antibodies comprise five distinct competition groups (8), (ii) they have previously been shown to have significant neutralizing activity against neutralization-sensitive derivatives of SIV239 (23, 51), and (iii) antibodies targeting the V1-V2 loops were excluded because the majority of FLAG substitutions were made in this region. As expected, SIV239 was not neutralized by any of the MAbs screened. SIV239FV2b and SIV239FV4a, which were resistant to M2 neutralization, were both highly resistant to neutralization by the majority of the MAbs tested, with the exception of RhMAb 3.7C and RhMAb 3H3, respectively. SIV239FV1b was observed to be globally more sensitive to antibody-mediated neutralization than parental SIV239 for the majority of RhMAbs screened.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Neutralization of viruses by anti-gp120 RhMAbsa

Detection of envelope on the cell surface by anti-FLAG antibody M2. To determine the accessibility of the FLAG epitope tag to detection by the anti-FLAG MAb M2 in the context of native, presumably oligomeric, Env protein on the cell surface, 293T cells were transiently transfected with the full-length proviral DNA constructs of SIV239, SIV239FV1b, SIV239FV2b, and SIV239FV4a. Detection of the FLAG epitope tag was performed using M2 (Fig. 7). A strong signal of M2 binding to the FLAG epitope was detected in the context of neutralization-sensitive SIV239FV1b envelope expression. Little or no detection of the FLAG epitope by M2 was observed with the neutralization-resistant variants SIV239FV2b and SIV239FV4a.


Figure 7
View larger version (18K):
[in this window]
[in a new window]

 
FIG. 7. Analysis of envelope cell surface expression by flow cytometry. 293T cells were transfected with the full-length DNA proviral clones of SIV239 and the replication-competent SIV FLAG variants. Exposure of the FLAG tag was detected using the anti-FLAG MAb M2 at 20 µg/ml.


arrow
DISCUSSION
 
The HIV and SIV surface envelope glycoprotein, gp120, has been shown to contain four distinct regions of high sequence variability, set apart by intrachain disulfide bonds, known as the variable loops (4, 17, 19, 29, 36, 43, 47). In addition to having functions involved in viral entry and cell tropism, the variable loops are known to be targeted by neutralizing antibodies and are thought to act to occlude to one extent or another more conserved epitopes on the gp120 core from antibody recognition (5, 8, 11, 12, 14, 20, 22-24, 32, 40, 42-45, 49). Here we have investigated the accessibility of specific sites within the variable loops to antibody recognition and neutralization through the substitution of the independent FLAG epitope tag at six locations within three of the four SIV239 variable loops. FLAG substitutions were initially constructed in the gp120 envelope glycoproteins of both the neutralization-resistant strain SIV239 and the more neutralization-sensitive variant SIV316 (33). Only three of the six SIV239 FLAG variants (SIV239FV1b, SIV239FV2b, and SIV239FV4a) replicated robustly enough to be included in further neutralization assays. Two of the four SIV316FLAG variants (SIV316FV1b and SIV316FV4a) replicated to measurable titers, although this growth occurred with a substantial lag compared to that of the parental SIV316 strain. SIV316 containing a full-length cytoplasmic tail is known to have substantially reduced infectivity for CEMx174 cells compared to that of parental SIV239, despite differing by only eight amino acids (50). Seemingly, the combination of the FLAG epitope tag and the eight amino acid changes in the already replication-hindered SIV316 grossly reduced the ability of the variant viruses to replicate. The variant viruses that eventually did grow may have contained compensatory or reversional changes that arose with time, which allowed readily detectable productive replication.

To discern at what stage in the viral life cycle the replication-defective variants were blocked, immunoprecipitations were performed with the anti-gp120 MAb 3.11H and a modified gp120 ligand, CD4-Ig. Both immunoprecipitation assays demonstrated that cells transfected with the proviral DNAs of the noninfectious SIV239 variants produced primarily gp160, the precursor to the functional gp120 envelope glycoprotein. De novo envelope is generated in cells as gp160, which is later cleaved into the surface subunit, gp120, and the transmembrane/cytoplasmic domain, gp41. Cleavage of gp160 into the two functional glycoprotein units is absolutely necessary for the production of viable virus (10). Observations that the cells producing the noninfectious FLAG variants contained gp160 primarily or exclusively strongly suggest that a defect in envelope processing induced by FLAG substitutions at those three particular sites was responsible for the lack of replication. Both the 3.11H and CD4-Ig immunoprecipitations imply that there was strong interference with envelope processing by FLAG at those specific locations.

Although the immunoprecipitation data strongly correlated the block in replication with inhibition of envelope processing, it is the envelope species present on the surfaces of virions, not what is present as the majority in the cell, that determines infectivity. It is possible, as alluded to by the CD4-Ig immunoprecipitation results with SIV239FV4b, that the deficient variants could make extremely low levels of gp120 that may be incorporated into virions, although they would be nonfunctional. To assess the incorporation levels and differing envelope species on the variant viruses, virions from all FLAG variants were pelleted, normalized by p27 content, and blotted with 3.11H. These virion incorporation assays confirmed the immunoprecipitation data by showing that only productively infectious SIV239FLAG variant virions incorporated detectable levels of processed gp120, while the noninfectious variants did not. Differences in infectivity between the parental SIV239 strain and the replication-competent FLAG variants were correspondingly minor, suggesting that substitution with the FLAG tag did not overwhelmingly hinder virion assembly or infectivity.

When assayed for sensitivity to neutralization by the anti-FLAG MAb M2, the SIV239FV1b FLAG virus variant was sensitive, with a measured 50% inhibitory concentration of 1 µg/ml. The sensitivity of this FLAG variant to M2 indicates that the V1 loop can serve as an effective target for neutralization in the context of SIV239FV1b. Interestingly, 90% neutralization of SIV239FV1b was not achieved even with very high M2 MAb concentrations. M2 achieved only 80% maximal neutralization of SIV239FV1b. Although M2 is known to recognize and bind FLAG-tagged proteins internally, it is possible that the affinity and kinetics of M2 binding in this context are not high and that obtaining complete neutralization cannot be accomplished with this antibody-antigen pair. Next, the FLAG variant viruses were screened for the ability of a panel of 12 RhMAbs to neutralize them. SIV239FV1b demonstrated substantial sensitivity to 8 of the 12 RhMAbs, and 6 of these 8 had 50% inhibitory concentrations of <1 µg/ml. Interestingly, the FLAG substitution in the V1 loop of gp120 resulted in a virus that was not only sensitive to the anti-FLAG MAb M2 but also sensitive to neutralization by many MAbs that target the region downstream of the V3 loop, in the C-terminal half of the envelope, rather than the V1 loop, in which the original substitution was made (8, 23). These data show that the substitution of FLAG in the V1 loop of SIV239 resulted in a variant virus that was globally more sensitive to antibody-mediated neutralization. This globally enhanced sensitivity to neutralization suggests that the presence of the FLAG tag may have opened up the trimeric envelope spike structure, allowing for increased accessibility to epitopes that are normally occluded. A slightly decreased envelope content in virions as well as other factors could potentially contribute to the enhanced neutralization sensitivity of this variant. However, strong M2 detection of the FLAG epitope on envelope expressed on the cell surface occurred only with FLAG present in the neutralization-sensitive variant SIV239FV1b; little or no detection occurred with the neutralization-resistant variants SIV239FV2b and SIV239FV4a. These data suggest that increased accessibility of the epitope in the context of SIV239FV1b is the principal determinant of sensitivity to neutralization. This correlation between the accessibility of FLAG to M2 within the SIV239FV1b envelope expressed on the cell surface and the ability of M2 to neutralize SIV239FV1b virions is consistent with the observations of others, in which neutralization of HIV-1 by anti-gp120 MAbs is closely correlated with the binding of those MAbs to the oligomeric envelope spike on the cell surface, irrespective of epitope specificity (13, 35).

Despite the fact that their variant envelope glycoproteins could be immunoprecipitated by the M2 MAb, both SIV239FV2b and SIV239FV4a remained resistant to neutralization by the anti-FLAG MAb M2, even at the highest concentration tested, i.e., 85 µg/ml. Notably, SIV239FV2b and SIV239FV4a remained resistant to neutralization by most of the RhMAbs tested. Wild-type SIV239 is also highly resistant to antibody-mediated neutralization by the wide range of MAbs tested. This neutralization-resistant phenotype suggests that the envelope of SIV239 has a tightly packed, compact structure. The correspondingly neutralization-resistant phenotypes of SIV239FV2b and SIV239FV4a suggest that these variants maintain that compact structure and that, in the context of SIV239, even some variable loops may not be that accessible on the envelope trimer, as they are present on the virion surface.

Recently, Ren and colleagues analyzed the properties of HIV-1 strain YU-2 with an insertion of the FLAG epitope tag within V4 (37). They observed that HIVYU-2 with the V4 FLAG tag was sensitive to M2 neutralization, whereas SIV239FV4a in our current study was not. Several differences in the two systems may have contributed to the differing outcomes. These include possible differences in the gp120 structure between HIV-1 and SIV, structural differences that may exist between different strains of the same virus, and differences in the nature and site of epitope inclusion within V4. The V4 loops of HIV-1YU2 and SIV differ significantly in sequence, length, and posttranslational modification. The tolerance and flexibility of the HIV-1 V4 loop are suggested by the prevalence of length polymorphisms in addition to extensive sequence variation (15, 26). The eight-amino-acid FLAG tag insertion created by Ren et al. increased the total V4 loop size by approximately 30% yet apparently did not affect envelope function. Additionally, the V4 loops from HIV-1 and SIV differ greatly in their glycosylation patterns. HIV-1 contains a number of N-linked glycans in the V4 loop (46), but the SIV239 V4 loop does not contain sites for N-linked glycosylation. Although it may be counterintuitive that the HIV-1 V4 loop, which appears to have increased shielding of epitopes due to glycan coverage, should be more sensitive to neutralization, the increased flexibility and tolerance of this region in HIV-1 may allow for more efficient accessibility of the FLAG tag to its cognate antibody in an in vitro neutralization assay. It is quite possible that inclusion of FLAG in V1 or V4 of either SIV or HIV-1 may or may not result in sensitivity to neutralization by the M2 MAb, depending on the strain used and the nature of FLAG epitope incorporation.

The results in this report confirm that variable loops V1, V2, and V4 of SIV239 can support the substitution of an independent epitope tag at specific sites. These SIV239FLAG variant viruses can replicate in both human and rhesus cell lines and appear to process envelope similar to wild-type SIV239. The substitution of the highly charged epitope tag impacted the infectivities of the FLAG variant viruses in single-round assays only slightly, and during productive infection the viruses replicated with kinetics and titers similar to those of parental SIV239. Interestingly, although the variable loops are thought to be extremely flexible and exposed on the surface of the trimer, only one FLAG variant virus, SIV239FV1b, presented the FLAG epitope tag appropriately to confer sensitivity to anti-FLAG neutralization. SIV239FV1b was also observed to be highly sensitive to neutralization by many anti-SIV RhMAbs, suggesting that upon FLAG substitution, there was a global conformational change that increased accessibility of the variable loops and sensitivity to antibody-mediated neutralization. SIV239 is relatively quite resistant to antibody-mediated neutralization; a MAb that can effectively neutralize SIV239 infectivity has yet to be identified (21-23, 30, 31, 36, 46). These data suggest that even the variable loops on the surface of SIV239 are difficult for antibodies to access effectively and that alterations of the envelope sequence that allow for neutralization have a global impact on epitope accessibility and envelope structure.


arrow
ACKNOWLEDGMENTS
 
This work was supported by PHS grants AI 025328 (R.C.D.) and RR 00168 (NEPRC) and by the Neutralizing Antibody Consortium of the International AIDS Vaccine Initiative.

We thank Dennis Burton for the gift of CD4-Ig and James Robinson for the RhMAbs. We also thank John Bilello and the flow cytometry core of the NEPRC Immunology Division for technical assistance and advice.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: New England Primate Research Center, One Pine Hill Drive, Box 9102, Southborough, MA 01772-9102. Phone: (508) 624-8040. Fax: (508) 624-8190. E-mail: ronald_desrosiers{at}hms.harvard.edu Back

{triangledown} Published ahead of print on 8 August 2007. Back


arrow
REFERENCES
 
    1
  1. Babas, T., B. Belhadj-Jrad, R. Le Grand, D. Dormont, L. Montagnier, and E. Bahraoui. 1995. Specificity and neutralizing capacity of three monoclonal antibodies produced against the envelope glycoprotein of simian immunodeficiency virus isolate 251. Virology 211:339-344.[CrossRef][Medline]
  2. 2
  3. Brizzard, B. L., R. G. Chubet, and D. L. Vizard. 1994. Immunoaffinity purification of FLAG epitope-tagged bacterial alkaline phosphatase using a novel monoclonal antibody and peptide elution. BioTechniques 16:730-735.[Medline]
  4. 3
  5. Burns, D. P., and R. C. Desrosiers. 1991. Selection of genetic variants of simian immunodeficiency virus in persistently infected rhesus monkeys. J. Virol. 65:1843-1854.[Abstract/Free Full Text]
  6. 4
  7. Burns, D. P., and R. C. Desrosiers. 1990. Sequence variability of simian immunodeficiency virus in a persistently infected rhesus monkey. J. Med. Primatol. 19:317-326.[Medline]
  8. 5
  9. Cao, J., N. Sullivan, E. Desjardin, C. Parolin, J. Robinson, R. Wyatt, and J. Sodroski. 1997. Replication and neutralization of human immunodeficiency virus type 1 lacking the V1 and V2 variable loops of the gp120 envelope glycoprotein. J. Virol. 71:9808-9812.[Abstract]
  10. 6
  11. Chen, B., E. M. Vogan, H. Gong, J. J. Skehel, D. C. Wiley, and S. C. Harrison. 2005. Structure of an unliganded simian immunodeficiency virus gp120 core. Nature 433:834-841.[CrossRef][Medline]
  12. 7
  13. Choi, W. S., C. Collignon, C. Thiriart, D. P. Burns, E. J. Stott, K. A. Kent, and R. C. Desrosiers. 1994. Effects of natural sequence variation on recognition by monoclonal antibodies neutralize simian immunodeficiency virus infectivity. J. Virol. 68:5395-5402.[Abstract/Free Full Text]
  14. 8
  15. Cole, K. S., M. Alvarez, D. H. Elliott, H. Lam, E. Martin, T. Chau, K. Micken, J. L. Rowles, J. E. Clements, M. Murphey-Corb, R. C. Montelaro, and J. E. Robinson. 2001. Characterization of neutralization epitopes of simian immunodeficiency virus (SIV) recognized by rhesus monoclonal antibodies derived from monkeys infected with an attenuated SIV strain. Virology 290:59-73.[CrossRef][Medline]
  16. 9
  17. Cormier, E. G., and T. Dragic. 2002. The crown and stem of the V3 loop play distinct roles in human immunodeficiency virus type 1 envelope glycoprotein interactions with the CCR5 coreceptor. J. Virol. 76:8953-8957.[Abstract/Free Full Text]
  18. 10
  19. Dedera, D., R. L. Gu, and L. Ratner. 1992. Conserved cysteine residues in the human immunodeficiency virus type 1 transmembrane envelope protein are essential for precursor envelope cleavage. J. Virol. 66:1207-1209.[Abstract/Free Full Text]
  20. 11
  21. Edinger, A. L., M. Ahuja, T. Sung, K. C. Baxter, B. Haggarty, R. W. Doms, and J. A. Hoxie. 2000. Characterization and epitope mapping of neutralizing monoclonal antibodies produced by immunization with oligomeric simian immunodeficiency virus envelope protein. J. Virol. 74:7922-7935.[Abstract/Free Full Text]
  22. 12
  23. Etemad-Moghadam, B., Y. Sun, E. K. Nicholson, G. B. Karlsson, D. Schenten, and J. Sodroski. 1999. Determinants of neutralization resistance in the envelope glycoproteins of a simian-human immunodeficiency virus passaged in vivo. J. Virol. 73:8873-8879.[Abstract/Free Full Text]
  24. 13
  25. Fouts, T. R., J. M. Binley, A. Trkola, J. E. Robinson, and J. P. Moore. 1997. Neutralization of the human immunodeficiency virus type 1 primary isolate JR-FL by human monoclonal antibodies correlates with antibody binding to the oligomeric form of the envelope glycoprotein complex. J. Virol. 71:2779-2785.[Abstract]
  26. 14
  27. Fung, M. S., C. R. Sun, W. L. Gordon, R. S. Liou, T. W. Chang, W. N. Sun, E. S. Daar, and D. D. Ho. 1992. Identification and characterization of a neutralization site within the second variable region of human immunodeficiency virus type 1 gp120. J. Virol. 66:848-856.[Abstract/Free Full Text]
  28. 15
  29. Gaschen, B., C. Kuiken, B. Korber, and B. Foley. 2001. Retrieval and on-the-fly alignment of sequence fragments from the HIV database. Bioinformatics 17:415-418.[Abstract/Free Full Text]
  30. 16
  31. Gorny, M. K., C. Williams, B. Volsky, K. Revesz, S. Cohen, V. R. Polonis, W. J. Honnen, S. C. Kayman, C. Krachmarov, A. Pinter, and S. Zolla-Pazner. 2002. Human monoclonal antibodies specific for conformation-sensitive epitopes of V3 neutralize human immunodeficiency virus type 1 primary isolates from various clades. J. Virol. 76:9035-9045.[Abstract/Free Full Text]
  32. 17
  33. Gregory, T., J. Hoxie, C. Watanabe, and M. Spellman. 1991. Structure and function in recombinant HIV-1 gp120 and speculation about the disulfide bonding in the gp120 homologs of HIV-2 and SIV. Adv. Exp. Med. Biol. 303:1-14.[Medline]
  34. 18
  35. Hopp, T. P., K. S. Prickett, V. L. Price, R. T. Libby, C. J. March, D. P. Cerretti, D. L. Urdal, and P. J. Conlon. 1988. A short polypeptide marker sequence useful for recombinant protein identification and purification. Biol. Technol. 6:1204-1210.
  36. 19
  37. Hoxie, J. A. 1991. Hypothetical assignment of intrachain disulfide bonds for HIV-2 and SIV envelope glycoproteins. AIDS Res. Hum. Retrovir. 7:495-499.[Medline]
  38. 20
  39. Javaherian, K., A. J. Langlois, S. Schmidt, M. Kaufmann, N. Cates, J. P. Langedijk, R. H. Meloen, R. C. Desrosiers, D. P. Burns, D. P. Bolognesi, et al. 1992. The principal neutralization determinant of simian immunodeficiency virus differs from that of human immunodeficiency virus type 1. Proc. Natl. Acad. Sci. USA 89:1418-1422.[Abstract/Free Full Text]
  40. 21
  41. Johnson, W. E., J. D. Lifson, S. M. Lang, R. P. Johnson, and R. C. Desrosiers. 2003. Importance of B-cell responses for immunological control of variant strains of simian immunodeficiency virus. J. Virol. 77:375-381.[CrossRef][Medline]
  42. 22
  43. Johnson, W. E., J. Morgan, J. Reitter, B. A. Puffer, S. Czajak, R. W. Doms, and R. C. Desrosiers. 2002. A replication-competent, neutralization-sensitive variant of simian immunodeficiency virus lacking 100 amino acids of envelope. J. Virol. 76:2075-2086.[Abstract/Free Full Text]
  44. 23
  45. Johnson, W. E., H. Sanford, L. Schwall, D. R. Burton, P. W. Parren, J. E. Robinson, and R. C. Desrosiers. 2003. Assorted mutations in the envelope gene of simian immunodeficiency virus lead to loss of neutralization resistance against antibodies representing a broad spectrum of specificities. J. Virol. 77:9993-10003.[Abstract/Free Full Text]
  46. 24
  47. Kang, S. M., F. S. Quan, C. Huang, L. Guo, L. Ye, C. Yang, and R. W. Compans. 2005. Modified HIV envelope proteins with enhanced binding to neutralizing monoclonal antibodies. Virology 331:20-32.[CrossRef][Medline]
  48. 25
  49. Kinsey, N. E., M. G. Anderson, T. J. Unangst, S. V. Joag, O. Narayan, M. C. Zink, and J. E. Clements. 1996. Antigenic variation of SIV: mutations in V4 alter the neutralization profile. Virology 221:14-21.[CrossRef][Medline]
  50. 26
  51. Kuiken, C., B. Korber, and R. W. Shafer. 2003. HIV sequence databases. AIDS Rev. 5:52-61.[Medline]
  52. 27
  53. Kwong, P. D., R. Wyatt, J. Robinson, R. W. Sweet, J. Sodroski, and W. A. Hendrickson. 1998. Structure of an HIV gp120 envelope glycoprotein in complex with the CD4 receptor and a neutralizing human antibody. Nature 393:648-659.[CrossRef][Medline]
  54. 28
  55. Leitner, T., B. Foley, B. Hahn, P. Marx, F. McCutchan, J. Mellors, S. Wolinsky, and B. Korber. 2005. HIV sequence compendium 2005. LA-UR number 06-0680. Theoretical Biology and Biophysics Group, Los Alamos National Laboratory, Los Alamos, NM.
  56. 29
  57. Leonard, C. K., M. W. Spellman, L. Riddle, R. J. Harris, J. N. Thomas, and T. J. Gregory. 1990. Assignment of intrachain disulfide bonds and characterization of potential glycosylation sites of the type 1 recombinant human immunodeficiency virus envelope glycoprotein (gp120) expressed in Chinese hamster ovary cells. J. Biol. Chem. 265:10373-10382.[Abstract/Free Full Text]
  58. 30
  59. Means, R. E., T. Greenough, and R. C. Desrosiers. 1997. Neutralization sensitivity of cell culture-passaged simian immunodeficiency virus. J. Virol. 71:7895-7902.[Abstract]
  60. 31
  61. Means, R. E., T. Matthews, J. A. Hoxie, M. H. Malim, T. Kodama, and R. C. Desrosiers. 2001. Ability of the V3 loop of simian immunodeficiency virus to serve as a target for antibody-mediated neutralization: correlation of neutralization sensitivity, growth in macrophages, and decreased dependence on CD4. J. Virol. 75:3903-3915.[Abstract/Free Full Text]
  62. 32
  63. Moore, J. P., P. W. Parren, and D. R. Burton. 2001. Genetic subtypes, humoral immunity, and human immunodeficiency virus type 1 vaccine development. J. Virol. 75:5721-5729.[Free Full Text]
  64. 33
  65. Mori, K., D. J. Ringler, T. Kodama, and R. C. Desrosiers. 1992. Complex determinants of macrophage tropism in env of simian immunodeficiency virus. J. Virol. 66:2067-2075.[Abstract/Free Full Text]
  66. 34
  67. Naidu, Y. M., H. W. Kestler III, Y. Li, C. V. Butler, D. P. Silva, D. K. Schmidt, C. D. Troup, P. K. Sehgal, P. Sonigo, M. D. Daniel, et al. 1988. Characterization of infectious molecular clones of simian immunodeficiency virus (SIVmac) and human immunodeficiency virus type 2: persistent infection of rhesus monkeys with molecularly cloned SIVmac. J. Virol. 62:4691-4696.[Abstract/Free Full Text]
  68. 35
  69. Parren, P. W., I. Mondor, D. Naniche, H. J. Ditzel, P. J. Klasse, D. R. Burton, and Q. J. Sattentau. 1998. Neutralization of human immunodeficiency virus type 1 by antibody to gp120 is determined primarily by occupancy of sites on the virion irrespective of epitope specificity. J. Virol. 72:3512-3519.[Abstract/Free Full Text]
  70. 36
  71. Puffer, B. A., S. Pohlmann, A. L. Edinger, D. Carlin, M. D. Sanchez, J. Reitter, D. D. Watry, H. S. Fox, R. C. Desrosiers, and R. W. Doms. 2002. CD4 independence of simian immunodeficiency virus Envs is associated with macrophage tropism, neutralization sensitivity, and attenuated pathogenicity. J. Virol. 76:2595-2605.[Abstract/Free Full Text]
  72. 37
  73. Ren, X., J. Sodroski, and X. Yang. 2005. An unrelated monoclonal antibody neutralizes human immunodeficiency virus type 1 by binding to an artificial epitope engineered in a functionally neutral region of the viral envelope glycoproteins. J. Virol. 79:5616-5624.[Abstract/Free Full Text]
  74. 38
  75. Resch, W., N. Hoffman, and R. Swanstrom. 2001. Improved success of phenotype prediction of the human immunodeficiency virus type 1 from envelope variable loop 3 sequence using neural networks. Virology 288:51-62.[CrossRef][Medline]
  76. 39
  77. Rizzuto, C. D., R. Wyatt, N. Hernandez-Ramos, Y. Sun, P. D. Kwong, W. A. Hendrickson, and J. Sodroski. 1998. A conserved HIV gp120 glycoprotein structure involved in chemokine receptor binding. Science 280:1949-1953.[Abstract/Free Full Text]
  78. 40
  79. Sanders, R. W., L. Schiffner, A. Master, F. Kajumo, Y. Guo, T. Dragic, J. P. Moore, and J. M. Binley. 2000. Variable-loop-deleted variants of the human immunodeficiency virus type 1 envelope glycoprotein can be stabilized by an intermolecular disulfide bond between the gp120 and gp41 subunits. J. Virol. 74:5091-5100.[Abstract/Free Full Text]
  80. 41
  81. Smith, T. F., A. Srinivasan, G. Schochetman, M. Marcus, and G. Myers. 1988. The phylogenetic history of immunodeficiency viruses. Nature 333:573-575.[CrossRef][Medline]
  82. 42
  83. Stamatatos, L., and C. Cheng-Mayer. 1998. An envelope modification that renders a primary, neutralization-resistant clade B human immunodeficiency virus type 1 isolate highly susceptible to neutralization by sera from other clades. J. Virol. 72:7840-7845.[Abstract/Free Full Text]
  84. 43
  85. Starcich, B. R., B. H. Hahn, G. M. Shaw, P. D. McNeely, S. Modrow, H. Wolf, E. S. Parks, W. P. Parks, S. F. Josephs, R. C. Gallo, et al. 1986. Identification and characterization of conserved and variable regions in the envelope gene of HTLV-III/LAV, the retrovirus of AIDS. Cell 45:637-648.[CrossRef][Medline]
  86. 44
  87. Sullivan, N., M. Thali, C. Furman, D. D. Ho, and J. Sodroski. 1993. Effect of amino acid changes in the V1/V2 region of the human immunodeficiency virus type 1 gp120 glycoprotein on subunit association, syncytium formation, and recognition by a neutralizing antibody. J. Virol. 67:3674-3679.[Abstract/Free Full Text]
  88. 45
  89. Torres, J. V., A. Malley, B. Banapour, D. E. Anderson, M. K. Axthelm, M. B. Gardner, and E. Benjamini. 1993. An epitope on the surface envelope glycoprotein (gp130) of simian immunodeficiency virus (SIVmac) involved in viral neutralization and T cell activation. AIDS Res. Hum. Retrovir. 9:423-430.[Medline]
  90. 46
  91. Wei, X., J. M. Decker, S. Wang, H. Hui, J. C. Kappes, X. Wu, J. F. Salazar-Gonzalez, M. G. Salazar, J. M. Kilby, M. S. Saag, N. L. Komarova, M. A. Nowak, B. H. Hahn, P. D. Kwong, and G. M. Shaw. 2003. Antibody neutralization and escape by HIV-1. Nature 422:307-312.[CrossRef][Medline]
  92. 47
  93. Willey, R. L., R. A. Rutledge, S. Dias, T. Folks, T. Theodore, C. E. Buckler, and M. A. Martin. 1986. Identification of conserved and divergent domains within the envelope gene of the acquired immunodeficiency syndrome retrovirus. Proc. Natl. Acad. Sci. USA 83:5038-5042.[Abstract/Free Full Text]
  94. 48
  95. Wyatt, R., P. D. Kwong, E. Desjardins, R. W. Sweet, J. Robinson, W. A. Hendrickson, and J. G. Sodroski. 1998. The antigenic structure of the HIV gp120 envelope glycoprotein. Nature 393:705-711.[CrossRef][Medline]
  96. 49
  97. Wyatt, R., J. Moore, M. Accola, E. Desjardin, J. Robinson, and J. Sodroski. 1995. Involvement of the V1/V2 variable loop structure in the exposure of human immunodeficiency virus type 1 gp120 epitopes induced by receptor binding. J. Virol. 69:5723-5733.[Abstract]
  98. 50
  99. Yuste, E., W. Johnson, G. N. Pavlakis, and R. C. Desrosiers. 2005. Virion envelope content, infectivity, and neutralization sensitivity of simian immunodeficiency virus. J. Virol. 79:12455-12463.[Abstract/Free Full Text]
  100. 51
  101. Yuste, E., J. D. Reeves, R. W. Doms, and R. C. Desrosiers. 2004. Modulation of Env content in virions of simian immunodeficiency virus: correlation with cell surface expression and virion infectivity. J. Virol. 78:6775-6785.[Abstract/Free Full Text]


Journal of Virology, October 2007, p. 10838-10848, Vol. 81, No. 20
0022-538X/07/$08.00+0     doi:10.1128/JVI.00831-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Pantophlet, R., Wang, M., Aguilar-Sino, R. O., Burton, D. R. (2009). The Human Immunodeficiency Virus Type 1 Envelope Spike of Primary Viruses Can Suppress Antibody Access to Variable Regions. J. Virol. 83: 1649-1659 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Laird, M. E.
Right arrow Articles by Desrosiers, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Laird, M. E.
Right arrow Articles by Desrosiers, R. C.