Tubulovesicular Structures within Vesicular Stomatitis Virus G Protein-Pseudotyped Lentiviral Vector Preparations Carry DNA and Stimulate Antiviral Responses via Toll-Like Receptor 9

Recombinant lentiviral vectors (LVs) are commonly used as researchtools and are being tested in the clinic as delivery agentsfor gene therapy. Here, we show that Vesicular stomatitis virusG protein (VSV-G)-pseudotyped LV preparations produced by transienttransfection are heavily contaminated with tubulovesicular structures(TVS) of cellular origin, which carry nucleic acids, includingthe DNA plasmids originally used for LV generation. The DNAcarried by TVS can act as a stimulus for innate antiviral responses,triggering Toll-like receptor 9 and inducing alpha/beta interferonproduction by plasmacytoid dendritic cells (pDC). Removal ofTVS markedly reduces the ability of VSV-G-pseudotyped LV preparationsto activate pDC. Conversely, virus-free TVS are sufficient tostimulate pDC and act as potent adjuvants in vivo, elicitingT- and B-cell responses to coadministered proteins. These resultshighlight the role of by-products of virus production in determiningthe immunostimulatory properties of recombinant virus preparationsand suggest possible strategies for diminishing responses toLVs in gene therapy and in research use.

INTRODUCTION

Top

Introduction

Lentiviral vectors (LVs) are used extensively as research toolsand are promising agents for genetic therapy of human diseases(11, 24, 41, 66). They have several advantages over other virus-basedvectors, including a large gene-carrying ability coupled withthe capacity to integrate into the genomes of nondividing cells(11, 24, 41, 66). Furthermore, compared with the use of adenovirusand vaccinia virus vectors, the use of recombinant LVs in theclinic is not limited by preexisting immunity to viral proteins(18, 34). Gene transfer for therapeutic purposes should, ifpossible, be immunologically silent or provoke immunologicaltolerance. However, lentiviral vectors have been shown to elicitpowerful cytotoxic-T-lymphocyte (CTL) responses against transgene-encodedproteins (17, 20, 49, 52). Similarly, human immunodeficiencyvirus type 1 (HIV-1), from which most recombinant LVs are derived,elicits potent cell- and antibody-mediated responses in humans(45). Their immunogenicity indicates that lentiviruses and recombinantLVs must activate innate viral sensing pathways, which subsequentlycouple to adaptive immunity. Remarkably, little is known aboutinnate responses to recombinant LVs. Studying the interactionbetween LVs and cells of the innate immune system might thereforesuggest strategies to maximize the therapeutic use of LVs inthe clinic, as well as avoid transgene-independent effects inthe laboratory.

The pathways mediating innate sensing of virus infection arebecoming increasingly understood, in part through work on dendriticcells (DC), a type of leukocyte that is central for translatinginnate responses into adaptive immunity (1, 36). Exposure toviruses can lead to DC activation, inducing upregulation ofmajor histocompatibility complex and costimulatory molecules,as well as secretion of immunomodulatory cytokines (50). Thelatter include type I interferons (IFN- ${alpha}$ /ß), a groupof cytokines that are important for viral containment and foramplifying DC activation and T-cell priming (40, 62). Thus far,three distinct mechanisms that promote DC activation and IFN- ${alpha}$ /ßsynthesis upon exposure to viruses have been recognized. Directinfection can promote DC activation through cytoplasmic sensingof viral genomes or viral replication intermediates such asdouble-stranded DNA (dsDNA) or dsRNA (15, 33, 35, 60). DC canalso become activated upon phagocytosis of some virally infectedcells, whose dsRNA content acts as a trigger for Toll-like receptor3 (TLR3) (57). Finally, DC can directly recognize the presenceof genomes from single-stranded RNA (ssRNA) and DNA virusesin endosomes by means of TLR7 and TLR9, receptors for ssRNAand DNA, respectively (14, 30, 38, 39, 43, 44). The most likelystimuli for inducing innate and adaptive immunity to LVs aretherefore the nucleic acids carried by the virions, includingthe ssRNA viral genome and/or nascent DNA transcripts (63).In this regard, it has been reported that HIV-1 induces IFN- ${alpha}$ production by plasmacytoid dendritic cells (pDC), most probablyby triggering TLR7 (4, 22, 23, 55, 67). pDC constitute a subtypeof DC that is uniquely able to couple TLR7 and TLR9 signalingto IFN- ${alpha}$ gene expression (31) and plays an important role inimmunity to some viruses (1, 12, 42).

Recombinant lentiviruses are commonly produced by transienttransfection of producer cells with a plasmid encoding the viralRNA genome (bearing the transgene), as well as additional plasmidsthat provide in trans the necessary components for generationof infectious virus (Gag, Pol, Rev, and Env proteins) (41).Vesicular stomatitis virus G protein (VSV-G) is the most commonlyused Env glycoprotein because VSV-G-pseudotyped LVs are pantropic,can be concentrated by centrifugation, and are relatively resistantto freezing (41). To investigate whether recombinant LVs inducean innate immune response via TLR7 and/or other mechanisms,we monitored IFN- ${alpha}$ production by pDC-containing murine bone marrow(BM) cells upon exposure to standard preparations of VSV-G-pseudotypedLVs generated by transient transfection. We show here that suchpreparations act as strong activators of pDC and induce secretionof high levels of IFN- ${alpha}$ . However, we show that pDC stimulationis not due to the virus itself but rather is attributable totubulovesicular structures (TVS) that are produced by VSV-G-transfectedcells and copurify with virus particles during viral concentration.These TVS carry residual amounts of the DNA plasmids used inthe lentivirus production process and act as agonists for TLR9.These results indicate that contaminating TVS profoundly determinethe safety and immunostimulatory properties of recombinant LVpreparations and suggest strategies for optimizing the use ofrecombinant LVs in gene therapy and research.

MATERIALS AND METHODS

Top

Materials and Methods

Plasmids. pLentiLox 3.7, pMDLg/pRRE, and pRSV-Rev were kindly providedby Luc van Parijs (Massachusetts Institute of Technology, Cambridge,MA). The XbaI-XhoI fragment of pLentiLox 3.7, containing theU6 promoter, was excised to generate pLLCG, a lentiviral vectorcoding for enhanced green fluorescent protein (eGFP) under thecontrol of a cytomegalovirus (CMV) promoter. pVSV-G, encodingthe vesicular stomatitis virus envelope protein (Indiana strain),was from Invitrogen. pCAAGS-LCMV-G, encoding the lymphocyticchoriomeningitis virus (LCMV) glycoprotein (Armstrong strain),was kindly provided by Daniel Pinschewer, University HospitalZürich. pCAAGS-THOV-G, encoding the thogotovirus (THOV)glycoprotein, was a kind gift from Georg Kochs, University ofFreiburg. pMLV-A, encoding the murine leukemia virus (MLV) amphotropicenvelope protein, has been described previously (53). pLNC-VSV-G,a retroviral vector expressing VSV-G, was generated by replacingthe eGFP gene of pLeGFP-N1 (Clontech) with VSV-G. pMSCVneo wasfrom Clontech.

Cells. 293FT, 293T, 293GP, and STAR-HV cells were grown in Dulbeccomodified Eagle complete medium (containing 10% fetal calf serum[FCS], 200 µM L-glutamine [Gibcox, 10 U/ml penicillin[Gibco], and 10 µg/ml glutamine [Gibco]). Bone marrowcells were isolated from C57BL/6 (Charles River), MyD88^–/–,TLR9^–/–, or TLR7^–/– (a kind gift fromS. Akira, Osaka, Japan) mice or from Rag-2^–/– mice(all bred at Cancer Research UK). After red blood cells lysis,cells were cultured in RPMI 1640 complete medium at a densityof 10⁶ cells/well in 96-well U-bottom plates with various stimuli,and IFN- ${alpha}$ accumulation in supernatants was measured by enzyme-linkedimmunosorbent assay (ELISA) 18 to 24 h later as described previously(15). In some experiments, BM cells from Rag2^–/–mice were fractionated into B220⁺ and B220^– fractionsby using anti-CD45R (B220) magnetic MicroBeads and AutoMacsseparation (Miltenyi Biotec) and seeded at 2 x 10⁵ cells/well.Intracellular staining for IFN- ${alpha}$ was performed as described previously(15). BM-DC were grown in the presence of Flt3L as describedpreviously (14) and stimulated at 2 x 10⁵ cells in flat-bottom96-well plates.

Viruses and stimuli. LVs expressing eGFP were produced as follows. 293FT or 293Tcells (6 x 10⁶) were seeded in a 10-cm dish and transfectedusing Lipofectamine 2000 (Invitrogen) as per the manufacturer'sinstructions with pMDLg/pRRE (5 µg), pRSV-REV (5 µg),pLLCG (10 µg), and the plasmid encoding the desired envelopeprotein (5 µg; VSV-G unless stated otherwise). For LVslacking the envelope protein (LV ${Delta}$ env), the Env plasmid was omitted.For LVs without viral RNA (LV ${Delta}$ vRNA), pLLCG was omitted. For controlsupernatant, all plasmids were omitted. At 16 to 24 h aftertransfection, cells were washed and fresh medium added. Supernatantwas collected at 48, 60, and 72 h after transfection; filteredthough a 0.45-µm Millex-HV filter (Millipore); and storedat –80°C. Before use, supernatants were pooled andultracentrifuged through a 20% sucrose cushion for virus concentration.The virus titer was determined by transduction of 293FT cells.One infectious unit corresponds to one GFP-forming unit (GFU)on 293FT cells. Noninfectious virus (LV ${Delta}$ env and LV ${Delta}$ vRNA) was quantifiedby ELISA for HIV p24 (Aalto), using infectious virus of knownGFU as a standard.

For LV fractionation, concentrated supernatant containing to4 x 10⁸ GFU of virus was loaded on a 20 to 60% continuous sucrosegradient and ultracentrifuged for 16 h at 85,000 x g in a BeckmanSW40Ti rotor. Fractions of 1.5 ml were sequentially collected,diluted in phosphate-buffered saline (PBS), and ultracentrifugedfor 1.5 h. Pellets were resuspended in complete culture medium.

Retrovirus encoding VSV-G was generated by transfection of 6x 10⁶ 293GP cells with pLNC-VSV-G (10 µg) and pVSV-G (5µg). Supernatant was harvested, concentrated 10-fold byultracentrifugation, and used for infection of STAR-HV cells(32) to produce infectious LVs.

CpG 1668 (Sigma), poly(I:C) (Sigma), loxoribine (Invivogen),and R848 (Invivogen) were pretitrated and used at concentrationsthat induce maximal IFN- ${alpha}$ production from pDC. Neutralizationof VSV-G was accomplished using the V17 MAb (2).

Western blotting. Concentrated supernatant was mixed 1:1 with Laemmli buffer andheat inactivated at 94°C for 5 min. A 10-µl portionwas run on precast 10% sodium dodecyl sulfate-polyacrylamidegels (Invitrogen) and blotted onto an Immobilon P membrane byusing a Bio-Rad semidry transfer apparatus. After blocking in5% bovine serum albumin, the membrane was stained with mouseanti-VSV-G (MAb P5D4 (37) (Cancer Research UK), mouse anti-GFP(MAb GFP 3E1; Cancer Research UK), mouse anti-ß-actin(MAb clone AC-15; Sigma), or biotinylated mouse anti-HIVp24(Aalto). Secondary reagents were horseradish peroxidase (HRP)-conjugatedgoat anti-mouse antibody (Santa Cruz Biotechnology) or HRP-streptavidin(Sigma). The HRP signal was detected using the West Pico kit(Pierce).

PCR and reverse transcription-PCR (RT-PCR). DNA and RNA were extracted from 35 µl concentrated supernatant.RNA was prepared by DNase digestion (DNA-free; Ambion) and reversetranscribed using Superscript II reverse transcriptase (Gibco),1 µM deoxynucleoside triphosphates, and 10 µM randomhexanucleotides (Gibco). DNA and cDNA were amplified using 30PCR cycles, each consisting of 30 s at 94°C, 30 s at 55°C,and 60 s at 72°C. Sequences of primers were as follows:5' VSV-G, GAAGTGCCTTTTGTACTTAG; 3' VSV-G, GATCGGATGGAATGTGTTAT;5' GFP, GGCCACAAGTTCAGCGTGTC; 3' GFP, TTGCCGTCCTCCTTGAAGTC;5' Pol, TCAGAAGCAGGAGCCGATAG; 3' Pol, TGCAGCCAATCTGAGTCAAC;5' ß-actin, GTTTGAGACCTTCAACACCCC; and 3' ß-actin,GTGGCCATCTCCTGCTCGAAGTC.

Electron microscopy. Cells were fixed in 4% glutaraldehyde for 1 h before being processedfor routine araldite processing and sectioning on a Leica ultramicrotome.Sections were placed on 200-mesh nickel grids and poststainedin lead citrate and uranyl acetate. For negative staining ofvirus-containing supernatants, glutaraldehyde-fixed, concentratedsupernatants were spread on glow-discharged carbon-Formvar 400mesh nickel grids and allowed to settle in a moist chamber fora few minutes. The grids were washed twice in distilled waterand stained with aqueous 1% uranyl acetate. Specimens were examinedusing a JEOL 1010 (JEOL Ltd., Tokyo, Japan) electron microscope.

Immunization. Mice were immunized intraperitoneally with egg white (7) equivalentto 250 µg ovalbumin (OVA), in either PBS alone, mixedwith 320 µl VSV-G-TVS, or mixed with poly(I:C) (50 µg).At 1 week after immunization, blood was analyzed for the presenceof OVA/H2-K^b tetramer-positive T cells (57). At 10 to 12 daysafter immunization, CTL activity was assessed by in vivo targetkilling assay as described previously (57). For CD4⁺ T-cellresponses, splenocytes were incubated overnight in medium inthe presence or absence of FCS. Brefeldin A was added for thelast 3 h and cells stained for intracellular IFN- ${gamma}$ . For detectionof serum antibodies, ELISA plates were coated overnight withOVA (Calbiochem) or FCS before blocking with fish skin gelatin(1% in PBS) and addition of serially diluted serum samples.Biotinylated anti-mouse immunoglobulin G antibody (Jackson ImmunoResearch)and streptavidin-alkaline phosphatase diluted in PBS containing1% fish skin gelatin were used as detection reagents.

RESULTS

Top

Results

VSV-G-pseudotyped LV preparations elicit IFN- ${alpha}$ production by plasmacytoid dendritic cells. To determine the potential of LVs to stimulate innate immunity,we asked whether they could trigger leukocytes to produce IFN- ${alpha}$ /ß,one of the earliest hallmarks of innate antiviral defense. Uponexposure to graded doses of a standard LV preparation, BM cellsproduced IFN- ${alpha}$ at levels comparable to those maximally elicitedby a control stimulus, CpG-containing DNA oligonucleotide (CpG)(Fig. 1A). Although all nucleated cells have the potential tosecrete interferons (40), intracellular staining revealed thatonly a small subset of BM cells made high levels of IFN- ${alpha}$ inresponse to LVs. These cells were CD11c^low, B220⁺, and Ly6C⁺(Fig. 1B), a phenotype indicative of pDC. To confirm their identity,BM cells from lymphocyte-deficient RAG-2^–/– micewere fractionated on the basis of B220 expression. Only theB220-enriched population produced IFN- ${alpha}$ in response to CpG, indicatingthat the majority of pDC were contained in this fraction (Fig.1C). Similarly, only the B220⁺ fraction secreted significantlevels of IFN- ${alpha}$ in response to LV preparations (Fig. 1C). Weconclude that LV preparations can stimulate pDC, leading tothe production of high levels of IFN- ${alpha}$ .

View larger version (37K):
[in this window]
[in a new window]

FIG. 1. LV preparations induce IFN- ${alpha}$ production by pDC. (A) IFN- ${alpha}$ secretion by BM cells after treatment with preparations of VSV-G-pseudotyped LVs at the indicated multiplicity of infections (MOIs) or with CpG (0.5 µg/ml; positive control). Supernatant (SN) of untransfected cells was concentrated as for the LV preparation and used as a negative control. (B) Intracellular staining for IFN- ${alpha}$ in BM cells stimulated with LVs at an MOI of 0.2 for 6 h. Left panel, IFN- ${alpha}$ versus CD11c. Right panel, Ly6C and B220 expression on IFN- ${alpha}$ -positive cells gated as indicated in the left panel. Numbers represent the percentages of cells in each gate or quadrant. (C) IFN- ${alpha}$ secretion by B220⁺ and B220^– fractions of BM cells taken from RAG-2^–/– mice after treatment with VSV-G-pseudotyped LVs (MOI of 0.2) or CpG. The B220⁺ fraction consisted of >90% pDC; the B220^– fraction contained around 7% pDC (not shown). n.d., not detected. Error bars indicate standard deviations of triplicates.

The IFN- ${alpha}$ response of pDC to LV preparations is independent of viral RNA but dependent on VSV-G. We produced LV preparations pseudotyped with four distinct Envglycoproteins, VSV-G, MLV-A, LCMV-G, or THOV-G, and assessedtheir innate stimulatory ability. Notably, only VSV-G-pseudotypedLV preparations induced IFN- ${alpha}$ production by pDC (Fig. 2A). Wehypothesized that the viral genome acted as the innate triggerand that VSV-G glycoprotein was uniquely able to deliver thevirus to TLR7-accessible endocytic compartments. To test thishypothesis, we omitted the plasmid encoding the viral RNA andproduced VSV-G-pseudotyped virus preparations lacking viralgenomes (LV ${Delta}$ vRNA). Surprisingly, these preparations were almostas potent as preparations of conventional LVs in stimulatingan IFN- ${alpha}$ response (Fig. 2B). In contrast, preparations of LVslacking the VSV-G glycoprotein (LV ${Delta}$ env) were unable to stimulateIFN- ${alpha}$ production, as were preparations obtained by transfectingonly the plasmid encoding the viral RNA (Fig. 2B). Unexpectedly,preparations from cells transfected only with the Rev- and VSV-G-encodingplasmids were comparable to full LV preparations at stimulatingIFN- ${alpha}$ production (Fig. 2B). We asked whether expression of VSV-Gwas necessary for this response. Preincubation of VSV-G-transfectedcell supernatants with a neutralizing anti-VSV-G monoclonalantibody completely blocked their ability to induce IFN- ${alpha}$ fromBM cells, whereas the same antibody had no effect on the controlstimulus, CpG (Fig. 2C). Similarly, exposure of the supernatantsto low pH, which inactivates VSV-G, abrogated IFN- ${alpha}$ induction(data not shown). We conclude that viral RNA is not requiredfor the interferon-inducing properties of LV preparations andthat supernatants from cells transiently transfected with VSV-Gare sufficient to induce IFN- ${alpha}$ via a mechanism dependent on VSV-Gexpression.

View larger version (22K):
[in this window]
[in a new window]

FIG. 2. VSV-G expression is required for the IFN- ${alpha}$ response to LVs. (A) BM cells were stimulated with LV preparations (multiplicity of infection of 1) pseudotyped with the indicated glycoproteins; IFN- ${alpha}$ was measured after overnight culture. (B) Stimulation of BM with concentrated supernatants from 293FT cells transfected with the indicated combinations of plasmids to generate preparations of VSV-G-pseudotyped LV, LV lacking viral RNA (LV ${Delta}$ vRNA), or LV lacking the envelope protein (LV ${Delta}$ env). Concentrated supernatants from untransfected cells (SN) or from cells transfected with plasmids encoding Rev plus VSV-G (VSV-G) or Rev plus viral RNA (vRNA) were tested as controls. Where applicable, stimuli were normalized for HIV p24 content (data not shown). (C) Concentrated supernatant from VSV-G-transfected cells (VSV-G-SN) or CpG was preincubated with a neutralizing anti-VSV-G or control MAb before being added to BM cells. IFN- ${alpha}$ in supernatants was measured 16 h later. n.d., not detected. Error bars indicate standard deviations of triplicates.

VSV-G transfection leads to accumulation of VSV-G-bearing tubulovesicular structures in the extracellular milieu. The IFN- ${alpha}$ -inducing activity of VSV-G supernatants could be concentratedby ultracentrifugation, suggesting the presence of a particulatestimulus (data not shown). We therefore examined the transfectedcells and supernatants by electron microscopy for the presenceof potential VSV-G-bearing structures. Cells transfected withthe four plasmids used for virus production showed abundanttubulovesicular structures within intercellular spaces (Fig.3A, panel iv). These TVS were also found in purified LV preparations(Fig. 3A, panel i) and were far more abundant than actual virusparticles. TVS were not found upon transfection with the plasmidsencoding viral RNA, Gag-Pol, and Rev (Fig. 3A, panels iii andvi) but were generated after VSV-G transfection (Fig. 3A, panelsii and v). TVS were also detectable by flow cytometry as a populationwith distinct scatter properties (data not shown). Thus, VSV-G-pseudotypedLV preparations, as well as supernatants from VSV-G-transfectedcells, contain large amounts of TVS.

View larger version (75K):
[in this window]
[in a new window]

FIG. 3. VSV-G transfection induces formation of TVS that carry cellular proteins and constitute the main pDC stimulus in VSV-G-pseudotyped LV preparations. (A) Electron micrographs of supernatants (left column) and transfected cells (right column) producing VSV-G-pseudotyped LV, VSV-G only, or LV without envelope protein (LV ${Delta}$ env). Bars, 200 nm (left column) and 1 µm (right column). Black arrows indicate TVS; white arrows show virus particles. *, cell cytoplasm. (B) Aliquots of preparations of LVs, TVS, and LV ${Delta}$ env were blotted for the indicated proteins. (C) VSV-G-LV preparations were fractionated on a continuous sucrose gradient. Each fraction was assessed for IFN- ${alpha}$ induction in BM cells and for virus titer (GFU) on 293T cells. Western blots show the amounts of VSV-G and HIV p24 in each fraction. Fraction 8 represents the bottom of the gradient (dense fraction).

We asked whether VSV-G was associated with TVS. Western blotsshowed the presence of VSV-G in preparations of LVs and TVSbut not in control preparations of LV ${Delta}$ env (Fig. 3B). Notably,other proteins derived from the producer cells, including GFPand ß-actin, were also detectable in LV and TVS preparationsbut not in preparations of LV ${Delta}$ env (Fig. 3B and data not shown).We conclude that TVS contain both VSV-G and proteins of cellularorigin.

We next tried to determine whether virus particles and/or TVSwere responsible for the interferon-inducing activity of LVpreparations. We fractionated these preparations by continuoussucrose gradient ultracentrifugation and tested each fractionfor the presence of virus, as well as for interferon-inducingactivity. As can be seen in Fig. 3C, the interferonegenicityof LV preparations was found within a limited number of fractions,all of which contained both TVS and infectious virus (Fig. 3C,fractions 4 through 7). These fractions also contained the bulkof the VSV-G and p24 protein (Fig. 3C). In contrast, fraction8 did not induce interferon and contained little VSV-G despitehaving comparable levels of infectious virus. The latter observationsuggests that actual virus particles do not act as the majorstimulus for IFN- ${alpha}$ production by BM cells. Furthermore, the dataindicate that virions contribute only a small fraction of theVSV-G within LV preparations, even though this small amountof protein is clearly sufficient to mediate virus entry intocells. We conclude that VSV-G-pseudotyped LV preparations containlarge amounts of TVS produced as a by-product of VSV-G transfectionand that these TVS constitute the primary stimulus for IFN- ${alpha}$ production by pDC.

TVS carry plasmid DNA and are recognized via TLR9. MyD88-dependent signaling is a major pathway for eliciting interferonproduction by pDC. Notably, MyD88^–/– BM cells werecompletely unable to produce IFN- ${alpha}$ in response to LV preparationsbut responded normally to electroporation with the control stimuluspoly(I:C), which stimulates IFN- ${alpha}$ synthesis via a TLR-independentcytosolic pathway (15) (Fig. 4A). Because the main IFN- ${alpha}$ -inducingMyD88-coupled receptors in pDC are TLR7 and TLR9, we next examinedtheir possible involvement. The response to LV preparationswas preserved in TLR7^–/– BM cells, whereas thatto the control TLR7-dependent stimulus R848 was totally abrogated(Fig. 4B). In contrast, TLR9-deficient BM cells had a markedlydiminished ability to produce IFN- ${alpha}$ in response to LV preparationsor to the TLR9-dependent control stimulus CpG but respondednormally to R848 (not shown) or to another TLR7 agonist, loxoribine(Fig. 4C). Similarly, the response to supernatants of cellstransfected solely with VSV-G was reduced >100-fold in TLR9^–/–BM cells (Fig. 4C). Therefore, the innate stimulatory propertiesof TVS are largely dependent on signaling via TLR9.

View larger version (25K):
[in this window]
[in a new window]

FIG. 4. IFN- ${alpha}$ induction by LV preparations and TVS is dependent on TLR9 signaling. (A) BM cells from C57BL/6 or MyD88^–/– mice were cultured in medium alone (no stim), with LVs (multiplicity of infection of 0.1) or were electroporated with poly(I:C) (0.5 µg) as described previously (15). IFN- ${alpha}$ was measured after overnight incubation. (B) IFN- ${alpha}$ from TLR7^–/– or wild-type BM cells after stimulation with LVs (multiplicity of infection of 0.1), R848 (1 µg/ml), or CpG (0.5 µg/ml). (C) BM cells from wild type or TLR9^–/– mice were stimulated with LVs (multiplicities of infection of 0.1 and 0.01), VSV-G TVS (10x and 1x concentrated), Loxoribine (20 mM), or CpG. IFN- ${alpha}$ was measured after overnight culture. n.d., not detected. Error bars indicate standard deviations of triplicates.

Because TLR9 is a receptor for DNA, we examined the extent towhich this nucleic acid might be present within LV preparationsor in supernatants from cells transfected with VSV-G. In bothcases, fluorescence-activated cell sorter staining with an appropriatedye revealed the presence of nucleic acids within a populationhaving the scatter properties of TVS (data not shown). RT-PCRand PCR analyses of nucleic acids extracted from LV preparationsconfirmed the presence of RNA and DNA, respectively, correspondingto each of the plasmids that had been transfected into the producercells (Fig. 5A and data not shown). DNA for ß-actin,presumably derived from the genome of the producer cells, wasalso found in both preparations (Fig. 5A). In contrast, controlLV preparations lacking TVS (LV ${Delta}$ env) did not generate ampliconsfor plasmid or ß-actin DNA by PCR analysis (Fig. 5A).To confirm the presence of intact plasmids, DNA extracted fromLV preparations was used to transform bacteria. DNA correspondingto 1 ml of LV preparation generated five times as many antibiotic-resistantbacterial colonies as 10 pg of the control plasmid pUC19, andeach of the plasmids used for virus generation could be recoveredfrom the transformants (Fig. 5B and data not shown). In contrast,no plasmids could be recovered from preparations of LV ${Delta}$ env (datanot shown). Taken together, these experiments indicate thatVSV-G-pseudotyped LV preparations generated by transient transfectioncontain TVS that carry residual plasmid DNA, which may providethe major stimulus for triggering TLR9.

View larger version (28K):
[in this window]
[in a new window]

FIG. 5. TVS and LV preparations generated by transient transfection contain plasmid DNA. (A) RT-PCR and PCR on RNA and DNA isolated from preparations of LVs, LVs lacking the envelope protein (LV ${Delta}$ env), or TVS (concentrated supernatant from VSV-G-transfected cells). (B) DNA extracted from LV preparations was used to transform bacteria. Ampicillin-resistant individual colonies were picked, and the plasmid DNA extracted and analyzed by digestion with restriction enzymes. The graph shows the frequency of bacterial colonies containing each plasmid (average ± standard deviation from three experiments; n > 150 colonies). (C) LV preparations generated by retroviral transduction do not stimulate IFN- ${alpha}$ production by BM cells. VSV-G was introduced into STAR-HV cells by transient transfection or by retroviral transduction. Supernatant containing VSV-G-pseudotyped LV (multiplicity of infection of 0.1) was added to BM cells. IFN- ${alpha}$ was measured by ELISA 16 h after treatment. CpG (0.5 µg/ml) was used as a positive control. n.d., not detected.

Avoiding transient transfection of producer cells decreases the innate stimulatory potential of LV preparations. To confirm that the interferon-inducing potential of LV preparationsis largely determined by plasmid contamination itself, we resortedto a method for LV production that avoids exposure of the producercells to DNA. We made use of STAR-HV cells, which contain anHIV-based packaging vector encoding GFP and stably express HIVGag, Pol, and Rev proteins, needing only an exogenously providedEnv gene in order to secrete infectious LVs encoding GFP (32).

VSV-G gene introduction by either plasmid transfection or retroviraltransduction allowed LV production by STAR-HV cells as determinedby titration on 293T cells (data not shown). LV preparationsproduced by regular plasmid transfection induced IFN- ${alpha}$ production,as expected (Fig. 5C). In contrast, no IFN- ${alpha}$ was induced by LVpreparations containing the same viral titer but generated byretroviral transduction cells and not exposed to plasmid DNA(Fig. 5C). We conclude that the interferon-inducing abilityof LV preparations clearly depends on the method of virus generationand not on the viral particles themselves.

TVS act as adjuvants in vivo. Given that LV preparations can act as immunogens but their innatestimulatory properties in vitro appear highly dependent on thepresence of TVS contaminants, we wondered whether TVS were capableof acting as adjuvants in vivo. Mice immunized with egg white,a source of adjuvant-free ovalbumin (7), did not generate aCD8⁺ T-cell response, as noted by background levels of expansionof tetramer-positive cells and a lack of killing of OVA peptide-pulsedtargets in vivo (Fig. 6A and B). In contrast, egg white mixedwith TVS induced marked expansion of tetramer-positive cells,which was associated with OVA-specific cytotoxic activity andnearly comparable to the response induced by a control adjuvant,poly(I:C) (Fig. 6A and B). When spleen cells were restimulatedin vitro, a strong CD4⁺ Th1 response to FCS components was observedin mice that had received TVS (Fig. 6C). This correlated withthe presence of anti-FCS antibodies in the mice (Fig. 6D), indicatingin vivo priming of a Th- and B-cell response against TVS-associatedFCS proteins. Although anti-OVA CD4⁺ T cells were not detectableby ex vivo restimulation (data not shown), anti-OVA immunoglobulinG was found in mice receiving egg white plus TVS or egg white+ poly(I:C), showing that either adjuvant had also led to inductionof an anti-OVA CD4⁺ T-cell and B-cell response (Fig. 6D). Wetherefore conclude that TVS generated by transient transfectionwith VSV-G can act as adjuvants to promote adaptive immune responsesagainst associated antigens.

View larger version (43K):
[in this window]
[in a new window]

FIG. 6. TVS act as adjuvants to induce adaptive immune responses. C57BL/6 mice were immunized intraperitoneally with egg white in PBS (n = 2) or with added TVS (n = 4) or poly(I:C) (PIC) (n = 2). (A) Contour plots show OVA/H-2K^b tetramer-positive Thy1.2⁺ cells in blood of representative mice 1 week after immunization. The graph shows the average (±standard deviation) frequency of OVA/H2-K^b tetramer-positive Thy1.2⁺ cells for all mice. *, P < 0.05; (as determined by Student's t test, compared to PBS-OVA-immunized mice). (B) At 10 days after immunization, mice were challenged with congenic CD45.1 splenocytes loaded with 20 nM (carboxyfluorescein [CFSE] low), 200 nM (CFSE intermediate), or 0 nM (CFSE high) of OVA peptide (SIINFEKL). Histograms show target cells (gated on CD45.1) from representative mice at 48 h after injection. The graph shows the amount of specific killing (average ± standard deviation) in all groups from one representative experiment. *, P < 0.05; **, P < 0.001 (as determined by Student's t test, compared to PBS-OVA-immunized mice). n.d., not detected. (C) At 12 days after immunization, splenocytes were isolated, cultured overnight in the absence or presence of FCS, and stained for intracellular IFN- ${gamma}$ . Contour plots show gated Thy1.2⁺ cells from representative mice. Values in the bottom right panel ranged from 0.16 to 2.2% IFN- ${gamma}$ ⁺ Thy1.2⁺ CD4⁺ cells. (D) At 12 days after immunization, sera of mice were tested for the presence of specific antibodies against OVA and FCS. Data are displayed as titration curves from individual representative mice. IgG, immunoglobulin G; OD, optical density.

DISCUSSION

Top

Discussion

Recombinant LVs are used extensively to transduce nondividingcells, and they constitute attractive vehicles for gene therapy.However, although less immunogenic than other viral vectors,LVs can elicit immune responses in vivo, limiting their clinicalapplication in gene delivery (17, 20, 49, 52). The immunogenicityof LVs has been attributed to their ability to transduce dendriticcells (20, 49), although it is not clear why this factor aloneshould be sufficient, as antigen targeting to DC in the absenceof exogenous stimuli promotes tolerance rather than immunity(58, 59). Therefore, it seems likely that the ability of LVsto prime immune responses reflects their ability to deliverboth antigen and innate stimuli for DC activation (52). Theability of recombinant LVs to activate conventional DC is controversial(8, 10, 16, 19, 20, 28, 29, 56, 61). In contrast, their capacityto stimulate pDC has not been assessed, despite the potentialimportance of this cell type in priming antiviral responses.Here, we report that standard VSV-G-pseudotyped LVs preparedby transient-transfection methods activate pDC, resulting inhigh levels of IFN- ${alpha}$ production. However, most of this activityis attributable not to the viral particles themselves but tocontaminating tubulovesicular structures, which largely outnumbervirions and carry nucleic acids, including the plasmids usedin transfection. The observation that TVS carry DNA may accountfor previous reports of plasmid DNA presence within LV preparations(54) and implies that TVS can activate pathways of innate defenseagainst DNA viruses. Consistent with this notion, we show thatTVS induce strong innate responses via a TLR9-dependent pathwayand act as adjuvants in vivo for coadministered antigens.

TVS may be similar to microvesicles found within HIV preparations,which appear to be the actual source of many cellular proteinspreviously thought to be associated with the virus envelope(5, 26, 64). Like those microvesicles, TVS carry proteins ofproducer cell origin, including plasmid-encoded ones (VSV-Gand GFP) (Fig. 3B and data not shown), proteins of cellularorigin (ß-actin) (Fig, 3B), and proteins derived fromthe culture medium (FCS components) (Fig. 6C and D). Notably,TVS can mediate transfer of some of these proteins (e.g., GFP)into target cells (A. Pichlmair and C. Reis e Sousa, unpublishedobservations), likely explaining the phenomenon of "pseudotransduction"observed with LV preparations (46). The actual origin of TVSand microvesicles is unclear, although the presence of cell-derivedvesicular structures within supernatants of cultured cells isa long-established phenomenon (13). TVS are unlikely to be apoptoticbodies, because supernatants harvested early after transfectionwere more potent IFN- ${alpha}$ inducers yet cell death was more prominentat later time points (data not shown). Furthermore, deliberateinduction of apoptosis in cells transfected with MLV-A, THOV-G,or LCMV-G Env genes does not generate supernatants capable ofstimulating interferon production from BM cells (data not shown).Similarly, TVS are unlikely to be exosomes, which have a differentappearance by electron microscopy (21). We favor the possibilitythat TVS are distinct structures, which are actively inducedby VSV-G overexpression. Consistent with this notion, VSV-Gis known to promote budding of vesicular stomatitis virus (9),and an alphavirus replicon encoding VSV-G but not viral capsidproteins spontaneously generates infectious virus-like particles(51).

VSV-G not only is involved in TVS induction but also is necessaryfor TVS to act as a pDC stimulus, as demonstrated by monoclonalantibody blocking studies (Fig. 2C). This, together with thefact that VSV-G was unique among Env gene products (Fig. 2A),as well as sufficient (Fig. 2B), for generating interferon-stimulatingactivity in concentrated supernatants, initially led us to focuson the notion that the VSV-G itself was responsible for stimulatingpDC. We now think that this is unlikely, because fractionationstudies show that the presence of VSV-G does not absolutelycorrelate with interferon induction potential. This can be seenin Fig. 3C, in which fraction 3 contains immunodetectable VSV-Gbut does not stimulate IFN- ${alpha}$ production, likely because it containslittle DNA (data not shown). The TLR9 dependence of the innatestimulatory activity further suggests that TVS-associated DNArather than VSV-G constitutes the actual stimulus. Therefore,the most likely explanation for our results is that VSV-G actsto promote binding and uptake of TVS by pDC, effectively concentratingand delivering these structures to endocytic compartments wheretheir DNA content is sensed by TLR9 and initiates signalingvia MyD88. In this regard, TVS mimic DNA viruses such as herpessimplex virus types 1 and 2, which trigger pDC via a similarmechanism (39, 43). Notably, preparations of LV pseudotypedwith other viral glycoproteins (THOV-G, LCMV-G, or MLV-A) donot act as strong pDC stimuli (Fig. 2A). These glycoproteinsmay not induce TVS formation or may not permit TVS enrichmentduring viral concentration. Alternatively, THOV-G-, LCMV-G-,or MLV-A-coated TVS may be excluded from TLR9-accessible cellularcompartments.

Human pDC exposed to HIV-1 produce IFN- ${alpha}$ and display signs ofmaturation (4, 22, 23, 55, 67). Therefore, it is surprisingthat, in the absence of TVS, the recombinant LVs tested hereelicit only very weak IFN- ${alpha}$ responses from murine pDC. Althoughthis may reflect intrinsic differences between human and mousepDC in their responsiveness to lentiviruses, it also shows thatlentiviral particles are only poorly stimulatory compared toother ssRNA viruses such as influenza virus, Sendai virus, orVSV, all of which trigger strong murine pDC activation via TLR7(14, 44). However, recombinant LV particles are not totallyinert and promote low levels of cytokine secretion by pDC, probablyvia a TLR7-dependent pathway (data not shown). This may especiallybe relevant for responses in vivo, where opsonization of thevirus could increase pDC stimulation (48). Indeed, antibodiespresent in sera of HIV-infected patients can enhance IFN- ${alpha}$ productionif added together with HIV-1 to peripheral blood mononuclearcells (27), an effect likely explained by increased FcR-mediatedinternalization of HIV particles into pDC endosomes and recognitionvia TLR7. Nevertheless, we have recently found that LV preparationscan still induce CTL priming in MyD88-deficient mice (Pichlmairand Reis e Sousa, unpublished observations). Thus, there areimmunostimulatory properties of LVs in vivo that cannot be attributedto pDC or TLR7/9 stimulation, and, indeed, we do not excludethe possibility that LV and TVS may act in a synergistic mannerin some instances. The full elucidation of the mechanisms regulatingLV immunogenicity will have to wait further developments inthe rapidly evolving field of antiviral innate immunity (36).

Our results on the innate stimulatory potential of LV preparationshave important practical implications for the use of recombinantLVs. There are many examples in which innate responses to vectorshave adverse effects. For adenovirus vectors it has been notedthat induction of cytokines limits high expression of deliveredgenes (6). Similarly, interferons reduce gene expression fromretroviral vectors, which might contribute to the relativelypoor performance of such vectors in vivo (25). Delivery of VSV-G-pseudotypedLVs to mouse brain induces local inflammation and a systemicimmune response which can limit transduction efficiency (3).Therefore, gene therapy approaches, as well as in vitro transductionof immune cells, would likely benefit from having LVs with lowinnate stimulatory potential. In this regard, our results suggestthat pseudotyping with THOV-G, LCMV-G, or MLV-A may be preferableto that with the more widely used VSV-G. This needs to be weighedagainst the fact that THOV-G, LCMV-G, or MLV-A also resultsin production of LV preparations containing lower virus titersthan those obtained by VSV-G-pseudotyping (references 11 and65 and data not shown). Titration of the VSV-G plasmid provednot to be useful, as it resulted in a dramatic drop of virustiter without avoiding IFN- ${alpha}$ induction from BM (data not shown).If VSV-G pseudotyping is to be used, the immunogenic potentialof virus preparations may be decreased by generation of virusin stable producer cell lines by using retroviral transduction(Fig. 5C) or inducible VSV-G expression (47) or by careful purificationof virus particles. We have tried to formally correlate immunogenicitywith virus production methods but have been unable to purifylarge enough quantities of virus by gradient fractionation toset up animal experiments, and we have yet to obtain a stablecell line producing LVs encoding a suitable model antigen (datanot shown). However, it has been reported that sucrose gradientfractionation decreases LV immunogenicity (3). More work willbe needed to see how different virus generation and purificationmethods affect contamination by TVS and immune responses.

ACKNOWLEDGMENTS

This work was funded by Cancer Research UK.

We thank Robert Koechl for help with sucrose gradient experiments,Georg Kochs for the THOV-G plasmid, and Daniel Pinschewer forthe LCMV-G plasmid and VSV-G-neutralizing antibody. We thankmembers of the Immunobiology Laboratory, Cancer Research UK,for advice and critical reviews of the manuscript.

FOOTNOTES

* Corresponding author. Mailing address: Immunobiology Laboratory, Cancer Research UK, London Research Institute, Lincoln's Inn Fields Laboratories, 44 Lincoln's Inn Fields, London WC2A 3PX, United Kingdom. Phone: 44 20 7269 2832. Fax: 44 20 7269 2833. E-mail: caetano{at}cancer.org.uk.

Published ahead of print on 1 November 2006.

Present address: King's College London, Guy's, King's and St.Thomas Medical School, Peter Gorer Department of Immunobiology,Division of Immunology, Infection and Inflammatory Diseases,2nd Floor New Guy's House, Guy's Hospital, London Bridge, LondonSE1 9RT, United Kingdom.

Present address: Molecular Medicine Program, Guggenheim Building18-11c, Mayo Clinic College of Medicine, 200 First Street S.W.,Rochester, MN 55905.

REFERENCES

Top