Previous Article | Next Article 
Journal of Virology, September 2007, p. 9437-9442, Vol. 81, No. 17
0022-538X/07/$08.00+0 doi:10.1128/JVI.02216-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Rate of Recombinational Deletion among Human Endogenous Retroviruses
Robert Belshaw,1*
Jason Watson,2
Aris Katzourakis,1
Alexis Howe,1,2
John Woolven-Allen,2,3
Austin Burt,2 and
Michael Tristem2
Department of Zoology, University of Oxford, Oxford OX1 3PS,1
Division of Biology, Imperial College London, Silwood Park Campus, Ascot, Berkshire Sl5 7PY,2
Plymouth Marine Laboratory, Prospect Place, The Hoe, Plymouth PL1 3DH, United Kingdom3
Received 9 October 2006/
Accepted 12 June 2007

ABSTRACT
The fate of most human endogenous retroviruses (HERVs) has been
to undergo recombinational deletion. This process involves homologous
recombination between the flanking long terminal repeats (LTRs)
of a full-length element, leaving a relic structure in the genome
termed a solo LTR. We examined loci in one family, HERV-K(HML2),
and found that the deletion rate decreased markedly with age:
the rate among recently integrated loci was almost 200-fold
higher than that among loci whose insertion predated the divergence
of humans and chimpanzees (8
x 10
–5 and 4
x 10
–7 recombinational deletion events per locus per generation, respectively).
One hypothesis for this finding is that increasing mutational
divergence between the flanking LTRs reduces the probability
of homologous recombination and thus the rate of solo LTR formation.
Consistent with this idea, we were able to replicate the observed
rates by a simulation in which the probability of recombinational
deletion was reduced 10-fold by a single mutation and 100-fold
by any additional mutations. We also discuss the evidence for
other factors that may influence the relationship between locus
age and the rate of deletion, for example, host recombination
rates and selection, and highlight the consequences of recombinational
deletion for dating recent HERV integrations.

INTRODUCTION
Endogenous retroviruses (ERVs) are the proviral form of exogenous
viruses that have integrated into germ line cells and are passed
vertically from parent to offspring (
4). Each provirus is composed
of several genes bounded by two noncoding regions termed long
terminal repeats (LTRs), which are 500 to 1,000 bp in length
and are identical upon insertion (integration). Approximately
98,000 human ERVs (HERVs), or fragments of HERVs, in the published
human genome sequence have been located (reference
27; also
see
http://herv.img.cas.cz), and estimates of the percentage
of the human genome that they represent range from 3 to 8% (
19,
27). Many of these HERVs have existed for tens of millions of
years, during which time approximately 85% of them have undergone
recombinational deletion involving the two LTRs. This process
results in the replacement of the full-length provirus by a
single LTR sequence termed a solo LTR (
20,
27,
34) and is a
key determinant in the long-term outcome of HERV infection (
17).
HERVs are divided into a relatively small number of lineages (or families), each of which is considered to represent the proliferation of an initial independent infection of the ancestor of the human genome up to 70 million years ago (mya) (36). With one possible exception, HERV-K(HML2), all these families have ceased proliferating and have effectively become extinct. The HERV-K(HML2) family, whose method of proliferation appears to be representative of that of other HERVs (2), is therefore the most suitable one for investigating the process of recombinational deletion. The family has homologues in Old World but not New World monkeys (24, 25, 29). The dates of the divergence of humans from Old World monkeys and of humans from New World monkeys are estimated to be approximately 21 to 25 mya and 32 to 36 mya, respectively (11). The family, therefore, must have initially invaded the ancestor of the human genome between these two periods, with 30 mya being a generally accepted estimate. The family appears to have been integrating continuously up to the present day (1, 3, 37) at an approximately steady rate (1).
The rate of recombinational deletion among HERVs may be expected to be related to the increasing mutational divergence between the LTRs as a provirus ages (22). With increasing age, the sequence similarity between the two LTRs of the provirus will decrease due to mutations acquired during host DNA replication. Recombinational deletion is likely to occur via intrachromosomal fold-back loops within the germ line, which are known to be dependent on the similarity between the two recombining sequences (33). Thus, increasing mutational divergence between the LTRs should reduce the probability of homologous pairing and hence of recombinational deletion.
We tested this prediction by determining the rates of recombinational deletion among loci of three different age classes in the family HERV-K(HML2), and we then attempted to recreate these rates in a simulation in which the probability of deletion was dependent upon the mutational divergence between the LTRs.

MATERIALS AND METHODS
Calculating the proportion of full-length proviruses.
Loci in the oldest age category were detected and analyzed by
mining the published human and chimpanzee genome sequences (
3).
We identified all HERV-K(HML2) loci in the human genome sequence
whose homologues in the chimpanzee genome sequence are full-length
proviruses (the loci we selected do not represent an exhaustive
list because the chimpanzee genome project is incomplete). For
the two younger age categories, we determined the mean proportion
of full-length proviruses among 19 human DNA samples for 63
loci that are represented by solo LTRs in the published human
genome sequence. Previously, we have screened these 19 samples
for insertional polymorphisms (unfixed loci) (
1). In the present
study, we rescreened all samples that had an insertion, using
a primer (5' ATTTTACTTTTAGTTAGCCCC 3') designed against a conserved
region within the leader sequence, in order to determine whether
the insertion was a full-length provirus or a solo LTR. Flanking
primer sequences are available on request. PCR conditions were
40 cycles of 94°C for 1 min, 45 to 55°C for 1 min, and
72°C for 100 s and a final extension step for 10 min (25
pmol of each primer was used with 250 to 500 ng of template
DNA). We then combined our findings with previously published
data for an additional 11 loci that are represented by full-length
proviruses in the published human genome sequence (
16). This
gave us the proportions of full-length proviruses for a total
of 74 loci.
Simulation.
To simulate the mutational divergence between the LTRs, we used a background rate of mutation within humans of 2 x 10–8 per bp per generation (7). The integration rate was assumed to be constant (1), and mutations in the two LTRs (each 968 bp, the mean length for the family) were randomly acquired in accordance with a Poisson distribution. The probability of deletion per generation was set as 10–4, 10–5, and 10–6 for zero, one, and two or more mutations in the LTRs, respectively. For the category corresponding to ages of 6 to 0.8 million years, we excluded those loci that represented the youngest age category. For the oldest category, we simulated the integration and aging of loci over a period of 24 million years prior to the chimpanzee-human divergence, and then for those loci that had survived as full-length proviruses to 6 mya, we simulated the recombinational deletion that occurred over the subsequent 6 million years. The perl script to implement this simulation is available upon request.
Our simulation ignored the positions of mutations in the LTRs. If the critical determinant of homologous recombination is the length of a region of identical nucleotides, mutations occurring close together in an LTR (or near the corresponding position in the other LTR) may reduce the probability of homologous recombination less than mutations that occur farther apart. We investigated this idea within our simulation by ignoring mutations occurring less than 500 bp from an existing mutation. This practice led to a slightly increased rate of deletion in older loci but did not affect the overall pattern, giving proportions of full-length proviruses in the three age categories very similar to those produced without this modification (0.30, 0.04, and 0.69 compared to 0.33, 0.05, and 0.74, respectively).
Recombinational deletion and host recombination rate.
The effect of variation in local host recombination rates was investigated by assigning every HERV locus a recombination rate. For this assignment, we used a high-resolution recombination map (18) based on 5,136 microsatellite markers and calculated average recombination rates across 3-Mb windows centered on the markers. Each HERV locus was assigned a recombination rate based on the nearest marker (only loci within 1.5 Mb of a marker were included in the analysis), and the means of the recombination rates for the loci were compared using a t test.

RESULTS
Division of HERV-K(HML2) loci into three age categories.
We analyzed HERV-K(HML2) loci belonging to three age categories.
(i) The first category comprised loci present as full-length
proviruses in the published chimpanzee genome sequence that
correspond to either a solo LTR or a full-length provirus at
the orthologous position in the human sequence. These elements
therefore integrated between 30 mya and the human-chimpanzee
divergence, which is dated at 6 mya (
11,
12). The other two
categories were loci, either full-length proviruses or solo
LTRs, whose insertion postdated the human-chimpanzee divergence
(chimpanzees have the preintegration site) and which were either
fixed (ii) or unfixed (iii) in samples from diverse human individuals.
We estimated the cutoff point between the latter two age categories
to be 0.8 mya, which is the average time of fixation for a neutral
allele (
14) given a long-term effective human population size
of 10,000 and a generation time of 20 years (
6,
13,
39).
Calculating rates of recombinational deletion.
For a full-length provirus that inserted t generations earlier, the probability P that now it is still full-length (that is, it has not undergone recombinational deletion) is expressed as follows:
 | (1) |
where
r is the probability of deletion in any one generation, assumed
to be constant. For the oldest age class, there were 25 full-length
proviruses (Table
1) in the common ancestor of chimpanzees and
humans, estimated to have existed 6 mya, giving
t of 3
x 10
5 generations. Twenty-two of them are still present as full-length
proviruses in a single randomly chosen human genome, giving
P of 0.88. Using equation
1, we therefore calculate
r to be
4.3
x 10
–7. The 2-unit support limits on
P (equivalent
to 95% confidence limits [
8]) are 0.71 and 0.97, giving bounds
on
r of 1.0
x 10
–7 and 1.1
x 10
–6. These calculations
ignore the possibility of independent recombinational deletion
in both human and chimpanzee lineages, but assuming equal rates
for all insertions, this probability is small. Similar results
are obtained if we include full-length elements from the human
lineage and their full-length or solo LTR orthologues in the
chimpanzee, expanding the sample size by examining the proportion
of shared, homologous loci that have been deleted in the chimpanzee
lineage while remaining full-length in the human. We found that
2 of 24 such loci have undergone recombinational deletion in
the chimpanzee lineage. Recent evidence suggests that a common
generation time of 15 years can be used for much of the human
and chimpanzee lineages (
9), and applying this figure to the
combined data set, we get a probability
P of 0.90, with 2-unit
support limits of 0.79 and 0.96. From these probabilities, we
can derive a value of
r of 2.6
x 10
–7 (
t = 4
x 10
5 generations)
with bounds of 1.0
x 10
–7 and 5.9
x 10
–7.
View this table:
[in this window]
[in a new window]
|
TABLE 1. Locations of all HERV-K(HML2) loci found to correspond to homologous full-length proviruses in the chimpanzee genomea
|
The intermediate age class includes elements that are present
(either as full-length proviruses or as solo LTRs) in the published
human genome sequence and in all other humans surveyed but are
absent in chimpanzees (that is, chimpanzees have a preintegration
site). We found 66 such elements (Table
2): for 7 of them, all
humans surveyed still had the full-length provirus; for 56 of
them, all humans surveyed had a solo LTR; and for 3 of them,
we (or the authors of previous reports) found both full-length
proviruses and solo LTRs, with frequencies of full-length proviruses
of 0.46, 0.84, and 0.95 (average, 0.75). The (unweighted) average
frequency of full-length proviruses across these loci thus corresponds
to a
P of 0.14. We assume that all these elements integrated
in the period between the splitting of humans from chimpanzees
and the average date for the coalescence of nuclear genes, that
is, in the period between 6 and 0.8 mya, or 300,000 and 40,000
generations ago. If we assume a constant rate of insertion over
this period and a constant rate of recombinational deletion
between insertion and the present, then the expected proportion
of full-length proviruses in modern humans is expressed as follows:
 | (2) |
Combining this equation with
our observed value of
P of 0.14, we get
r of 1.5
x 10
–5.
The 2-unit support limits on
P are approximately 0.067 and 0.25
(calculated assuming a binomial distribution with
n of 66),
giving bounds on
r of 9.5
x 10
–6 and 2.3
x 10
–5.
Finally, the youngest age class includes elements that are present
(either as full-length proviruses or as solo LTRs) in the published
human genome sequence but were absent from at least one human
in our survey (that is, some humans had a preintegration site).
We found eight such elements (Table
2), and the average proportion
of full-length proviruses among all insertions (ignoring alleles
with a preintegration site) was 0.30. We assume that all these
elements integrated in the time since the average coalescence
of nuclear genes, that is, in the last 0.8 million years, or
40,000 generations. If we assume constant rates of insertion
and recombinational deletion over this period, then the expected
proportion of full-length proviruses in modern humans is expressed
as follows:
 | (3) |
Combining
this equation with our observed value of
P of 0.30, we get
r of 8.0
x 10
–5. It is not clear how to calculate support
limits on this estimate, but if we assume a binomial distribution
with a sample size of eight, we get conservative bounds on
P of 0.044 and 0.72, giving bounds on
r of 1.8
x 10
–5 and
5.6
x 10
–4.
The rate of recombinational deletion inferred from the observed mean proportions thus decreases markedly with the increasing age of the locus (Table 3). There is an almost 200-fold decrease between the rates of the youngest and the oldest age categories of 8.0 x 10–5 and 4.3 x 10–7 per locus per generation, respectively.
View this table:
[in this window]
[in a new window]
|
TABLE 3. Proportions of HERV-K(HML2) loci that are full-length proviruses, and inferred recombinational deletion rates, among the three different age categoriesa
|
Reproduction of observed recombinational deletion rates by computer simulation.
We found that the decreasing rate of recombinational deletion
with increasing locus age could be reproduced approximately
in a simple simulation in which the probability of recombinational
deletion of 10
–4 per generation was reduced 10-fold by
the acquisition of one mutation in the LTRs and reduced 100-fold
by the acquisition of two or more mutations (Table
3 and Fig.
1). These parameter values were based on experimental data on
the rates of homologous recombination within mammals. For example,
it appears that 150 to 500 bp of uninterrupted sequence identity
is required for full efficiency, with the rate of homologous
recombination declining from threefold to more than 100-fold
with a variety of 1- or 2-bp mismatches (
21,
28,
38). The observed
numbers of mutations in the LTRs of human-specific proviruses
lend additional support for the accuracy of our simulation:
we observed a mean of nine mutations in these LTRs (
n = 17),
and our simulation predicted a mean of six. We therefore suggest
that mutational divergence determines the rate of recombinational
deletion among HERVs. The marked decline in the deletion rate
explains why most unfixed (insertionally polymorphic) HERV loci
are represented only by a solo LTR (even though they are probably
only a few hundred thousand years old) yet some proviruses can
persist in their full-length state for tens of millions of years.
In our simulation, 50% of integrations became solo LTRs within
150,000 years.

DISCUSSION
There is an earlier and higher estimate (2
x 10
–3 deletion
events per locus per generation) of the rate of recombinational
deletion among members of the HERV-K(HML2) family (
16). This
rate was calculated by counting the number of deletion events
that have taken place in 13 human-specific loci and then using
standard population genetics theory to extrapolate the number
lost by genetic drift. Our figures, which are based on a larger
sample size and a different method, are more in agreement with
observed recombinational deletion rates among relatively recent
integrations in the mouse. For example, the rate is 4.5
x 10
–6 deletion events in the single ecotropic
Emv-3 locus per generation
(
31) and averages around 4
x 10
–6 deletion events per
generation (1 in 250,000 meiotic generations) among 103 nonecotropic
murine leukemia virus loci (
10); both rates were calculated
from direct observations of deletions among progeny. Our lower
confidence limit for the two younger HERV-K(HML2) categories
(ca. 10
–5) is close to the upper confidence limits for
the mouse loci, which are 8
x10
–6 for
Emv-3 (
31) and 10
–5 for the other murine leukemia virus loci (our calculation from
data presented in reference
10).
The earlier study on HERV-K(HML2) (16) used sequence data to show that multiple deletion events have occurred at a single solo LTR locus (11q22, or 154c11). Furthermore, the three deletion events observed were estimated to have occurred up to 1.5 million years after the integration of the original full-length element (the LTRs had diverged by several mutations prior to each deletion event). We suggest that this particular locus is either an exception to the general trend that we have proposed (our oldest age category includes a few loci that underwent recombinational deletion at an even greater age) or, as suggested by the authors of the other study, that we may be observing the effect of recombination and/or gene conversion after a deletion event.
We have shown that the rate of recombinational deletion declines with locus age in a fashion that can be explained by the increasing mutational divergence between the LTRs. However, there are two other factors that may complicate this relationship.
First, the background local rate of recombination varies substantially across the human genome (18), and therefore, old, full-length proviruses may have persisted simply because they are situated in genomic regions experiencing low levels of recombination. A pooled analysis of all HERV families (17a) has shown that local variation in the host recombination rate does have an effect on the rate of recombinational deletion, but this effect is small: we estimate that it is sufficient to produce only an approximately threefold difference in the proportion of full-length HERV-K(HML2) proviruses, not the 200-fold difference observed. The effect of the background recombination rate would require a larger sample size and a longer time period to manifest itself, and we thus observe no tendency for the old HERV-K(HML2) proviruses to be in regions of lower host recombination rates than human-specific insertions represented today by solo LTRs (t test; P = 0.44).
Second, there may be greater selection against full-length proviruses than solo LTRs. There is considerable evidence that ERVs are generally harmful to their hosts (15, 23, 26, 32), and solo LTRs are likely to be less harmful than full-length replication-competent proviruses. Although solo LTRs are unlikely to be neutral in all cases (because the regulatory sequences capable of disrupting host gene expression are present in the LTR), they cannot themselves give rise to further insertions. Additionally, the somatic effects of some ERVs are known to be caused only by the full-length provirus: for example, the mutations d (dilute coat color) and hr (hairless) caused by ERV integration into the mouse are reversed following recombinational deletion (31, 35). Also, although a medical effect of HERV-K(HML2) is unproven, the injection of the accessory gene rec (cORF), which is found only in full-length HERV-K(HML2) proviruses, induces tumor formation in immunocompromised nude mice (5). The splice sites in the internal region may also interfere with host transcription. Therefore, among recent insertions, more full-length proviruses than solo LTRs may be lost from the host population as a result of selection factors acting on the host, and thus, fewer full-length viruses would drift towards fixation. If this phenomenon has occurred, it would lead us to overestimate the recombinational deletion rate by reducing the observed proportion of full-length proviruses. However, at the present we have no data on selection that would allow us to correct for this possibility. A point that arises from our analysis is that recently inserted full-length proviruses are perhaps as likely to be inactivated (in the sense of being unable to replicate further) by recombinational deletion as by point mutation. Our inferred recombinational deletion rate for the youngest age category approaches 10–4 per generation, and the probability of acquiring a point mutation approximates that figure (given a background mutation rate in humans of 10–8/bp and a typical provirus length of 104 bp), with perhaps 40% of these mutations being lethal (30).
One consequence of the differences in recombinational deletion rates demonstrated above is that the estimated dates of integration of full-length HERVs may, in general, be too old when there are only a few mutational differences between their paired LTRs. This is because such dates are typically estimated from the pairwise differences between LTRs by assuming a neutral average rate of human evolution since their integration. However, as we have shown, proviruses that acquire (by chance) mutations in their LTRs at, or soon after, integration are less likely to undergo recombinational deletion and therefore persist in their full-length state, whereas most other elements rapidly decay into solo LTRs.

ACKNOWLEDGMENTS
This work was funded by the Wellcome Trust. J.W. and A.K. were
supported by Natural Environment Research Council studentships,
and A.K. was also supported by a Medical Research Council fellowship.
We thank Vini Pereira and Anna Dawson for help with the genome mining and experimental work, respectively.

FOOTNOTES
* Corresponding author. Mailing address: Department of Zoology, University of Oxford, Oxford OX1 3PS, United Kingdom. Phone: 44 1865 281997. Fax: 44 1865 271249. E-mail:
robert.belshaw{at}zoo.ox.ac.uk 
Published ahead of print on 20 June 2007. 

REFERENCES
1 - Belshaw, R., A. L. A. Dawson, J. Woolven-Allen, J. Redding, A. Burt, and M. Tristem. 2005. Genomewide screening reveals high levels of insertional polymorphism in the human endogenous retrovirus family HERV-K(HML2): implications for present-day activity. J. Virol. 79:12507-12514.[Abstract/Free Full Text]
2 - Belshaw, R., A. Katzourakis, J. Pa
es, A. Burt, and M. Tristem. 2005. High copy number in human endogenous retrovirus families is associated with copying mechanisms in addition to reinfection. Mol. Biol. Evol. 22:814-817.[Abstract/Free Full Text] 3 - Belshaw, R., V. Pereira, A. Katzourakis, G. Talbot, J. Pa
es, A. Burt, and M. Tristem. 2004. Long-term reinfection of the human genome by endogenous retroviruses. Proc. Natl. Acad. Sci. USA 101:4894-4899.[Abstract/Free Full Text] 4 - Boeke, J. D., and J. P. Stoye. 1997. Retrotransposons, endogenous retroviruses, and the evolution of retroelements, p. 343-435. In J. M. Coffin, S. H. Hughes, and H. E. Varmus (ed.), Retroviruses. CSHL Press, New York, NY.
5 - Boese, A., M. Sauter, U. Galli, B. Best, H. Herbst, J. Mayer, E. Kremmer, K. Roemer, and N. Mueller-Lantzsch. 2000. Human endogenous retrovirus protein cORF supports cell transformation and associates with the promyelocytic leukemia zinc finger protein. Oncogene 19:4328-4336.[CrossRef][Medline]
6 - Chen, F. C., E. J. Vallender, H. Wang, C. S. Tzeng, and W. H. Li. 2001. Genomic divergence between human and chimpanzee estimated from large-scale alignments of genomic sequences. J. Hered. 92:481-489.[CrossRef][Medline]
7 - Drake, J. W., B. Charlesworth, D. Charlesworth, and J. F. Crow. 1998. Rates of spontaneous mutation. Genetics 148:1667-1686.[Abstract/Free Full Text]
8 - Edwards, A. W. F. 1992. Likelihood, expanded ed. John Hopkins University Press, Baltimore, MD.
9 - Elango, N., J. W. Thomas, and S. V. Yi. 2006. Variable molecular clocks in hominoids. Proc. Natl. Acad. Sci. USA 103:1370-1375.[Abstract/Free Full Text]
10 - Frankel, W. N., J. P. Stoye, B. A. Taylor, and J. M. Coffin. 1990. A linkage map of endogenous murine leukemia proviruses. Genetics 124:221-236.[Abstract]
11 - Glazko, G. V., and M. Nei. 2003. Estimation of divergence times for major lineages of primate species. Mol. Biol. Evol. 20:424-434.[Abstract/Free Full Text]
12 - Goodman, M., C. A. Porter, J. Czelusniak, S. L. Page, H. Schneider, J. Shoshani, G. Gunnell, and C. P. Groves. 1998. Toward a phylogenetic classification of primates based on DNA evidence complemented by fossil evidence. Mol. Phylogenet. Evol. 9:585-598.[CrossRef][Medline]
13 - Harpending, H. C., M. A. Batzer, M. Gurven, L. B. Jorde, A. R. Rogers, and S. T. Sherry. 1998. Genetic traces of ancient demography. Proc. Natl. Acad. Sci. USA 95:1961-1967.[Abstract/Free Full Text]
14 - Hartl, D. L., and A. G. Clark. 1997. Principles of population genetics. Sinauer, Sunderland, MA.
15 - Hirsch, H. H., A. P. K. Nair, and C. Moroni. 1993. Suppressible and nonsuppressible autocrine mast-cell tumors are distinguished by insertion of an endogenous retroviral element (IAP) into the interleukin-3 gene. J. Exp. Med. 178:403-411.[Abstract/Free Full Text]
16 - Hughes, J. F., and J. M. Coffin. 2004. Human endogenous retrovirus K solo-LTR formation and insertional polymorphisms: implications for human and viral evolution. Proc. Natl. Acad. Sci. USA 101:1668-1672.[Abstract/Free Full Text]
17 - Katzourakis, A., A. Rambaut, and O. G. Pybus. 2005. The evolutionary dynamics of endogenous retroviruses. Trends Microbiol. 13:463-468.[CrossRef][Medline]
17 - Katzourakis, A., V. Pereira, and M. Tristem. Effects of recombination rate on human endogenous retrovirus fixation and persistence. J. Virol., in press.
18 - Kong, A., D. F. Gudbjartsson, J. Sainz, G. M. Jonsdottir, S. A. Gudjonsson, B. Richardsson, S. Sigurdardottir, J. Barnard, B. Hallbeck, G. Masson, A. Shlien, S. T. Palsson, M. L. Frigge, T. E. Thorgeirsson, J. R. Gulcher, and K. Stefansson. 2002. A high-resolution recombination map of the human genome. Nat. Genet. 31:241-247.[CrossRef][Medline]
19 - Lander, E. S., L. M. Linton, B. Birren, C. Nusbaum, M. C. Zody, J. Baldwin, K. Devon, K. Dewar, M. Doyle, W. FitzHugh, R. Funke, D. Gage, K. Harris, A. Heaford, J. Howland, L. Kann, et al. 2001. Initial sequencing and analysis of the human genome. Nature 409:860-921.[CrossRef][Medline]
20 - Lower, R., J. Lower, and R. Kurth. 1996. The viruses in all of us: characteristics and biological significance of human endogenous retrovirus sequences. Proc. Natl. Acad. Sci. USA 93:5177-5184.[Abstract/Free Full Text]
21 - Lukacsovich, T., and A. S. Waldman. 1999. Suppression of intrachromosomal gene conversion in mammalian cells by small degrees of sequence divergence. Genetics 151:1559-1568.[Abstract/Free Full Text]
22 - Mager, D. L., and P. Medstrand. 2003. Retroviral repeat sequences, p. 57-63. In D. Cooper (ed.), Encyclopedia of the human genome, vol. 5. Nature Publishing Group, London, United Kingdom.
23 - Marchetti, A., J. Robbins, G. Campbell, F. Buttitta, F. Squartini, M. Bistocchi, and R. Callahan. 1991. Host genetic background effect on the frequency of mouse mammary tumor virus-induced rearrangements of the int-1 and int-2 loci in mouse mammary tumors. J. Virol. 65:4550-4554.[Abstract/Free Full Text]
24 - Mariani-Costantini, R., T. M. Horn, and R. Callahan. 1989. Ancestry of a human endogenous retrovirus family. J. Virol. 63:4982-4985.[Abstract/Free Full Text]
25 - Medstrand, P., and D. L. Mager. 1998. Human-specific integrations of the HERV-K endogenous retrovirus family. J. Virol. 72:9782-9787.[Abstract/Free Full Text]
26 - Medstrand, P., L. N. van de Lagemaat, and D. L. Mager. 2002. Retroelement distributions in the human genome: variations associated with age and proximity to genes. Genome Res. 12:1483-1495.[Abstract/Free Full Text]
27 - Pa
es, J., A. Pavlí
ek, and V. Pa
es. 2002. HERVd: database of human endogenous retroviruses. Nucleic Acids Res. 30:205-206.[Abstract/Free Full Text] 28 - Reiter, L. T., P. J. Hastings, E. Nelis, P. De Jonghe, C. Van Broeckhoven, and J. R. Lupski. 1998. Human meiotic recombination products revealed by sequencing a hotspot for homologous strand exchange in multiple HNPP deletion patients. Am. J. Hum. Genet. 62:1023-1033.[CrossRef][Medline]
29 - Reus, K., J. Mayer, M. Sauter, H. Zischler, N. Müller-Lantzsch, and E. Meese. 2001. HERV-K(OLD): ancestor sequences of the human endogenous retrovirus family HERV-K(HML-2). J. Virol. 75:8917-8926.[Abstract/Free Full Text]
30 - Sanjuán, R., A. Moya, and S. F. Elena. 2004. The distribution of fitness effects caused by single-nucleotide substitutions in an RNA virus. Proc. Natl. Acad. Sci. USA 101:8396-8401.[Abstract/Free Full Text]
31 - Seperack, P. K., M. C. Strobel, D. J. Corrow, N. A. Jenkins, and N. G. Copeland. 1988. Somatic and germ-line reverse mutation rates of the retrovirus-induced dilute coat-color mutation of DBA mice. Proc. Natl. Acad. Sci. USA 85:189-192.[Abstract/Free Full Text]
32 - Spence, S. E., D. J. Gilbert, D. A. Swing, N. G. Copeland, and N. A. Jenkins. 1989. Spontaneous germ line virus infection and retroviral insertional mutagenesis in eighteen transgenic Srev lines of mice. Mol. Cell. Biol. 9:177-184.[Abstract/Free Full Text]
33 - Stankiewicz, P., and J. R. Lupski. 2002. Genome architecture, rearrangements and genomic disorders. Trends Genet. 18:74-82.[CrossRef][Medline]
34 - Stoye, J. P. 2001. Endogenous retroviruses: still active after all these years? Curr. Biol. 11:R914-R916.[CrossRef][Medline]
35 - Stoye, J. P., S. Fenner, G. E. Greenoak, C. Moran, and J. M. Coffin. 1988. Role of endogenous retroviruses as mutagens: the hairless mutation of mice. Cell 54:383-391.[CrossRef][Medline]
36 - Tristem, M. 2000. Identification and characterization of novel human endogenous retrovirus families by phylogenetic screening of the Human Genome Mapping Project database. J. Virol. 74:3715-3730.[Abstract/Free Full Text]
37 - Turner, G., M. Barbulescu, M. Su, M. I. Jensen-Seaman, K. K. Kidd, and J. Lenz. 2001. Insertional polymorphisms of full-length endogenous retroviruses in humans. Curr. Biol. 11:1531-1535.[CrossRef][Medline]
38 - Waldman, A. S., and R. M. Liskay. 1988. Dependence of intrachromosomal recombination in mammalian cells on uninterrupted homology. Mol. Cell. Biol. 8:5350-5357.[Abstract/Free Full Text]
39 - Wall, J. D. 2003. Estimating ancestral population sizes and divergence times. Genetics 163:395-404.[Abstract/Free Full Text]
Journal of Virology, September 2007, p. 9437-9442, Vol. 81, No. 17
0022-538X/07/$08.00+0 doi:10.1128/JVI.02216-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Gifford, R. J., Katzourakis, A., Tristem, M., Pybus, O. G., Winters, M., Shafer, R. W.
(2008). From the Cover: A transitional endogenous lentivirus from the genome of a basal primate and implications for lentivirus evolution. Proc. Natl. Acad. Sci. USA
105: 20362-20367
[Abstract]
[Full Text]
-
Katzourakis, A., Pereira, V., Tristem, M.
(2007). Effects of Recombination Rate on Human Endogenous Retrovirus Fixation and Persistence. J. Virol.
81: 10712-10717
[Abstract]
[Full Text]