Previous Article | Next Article ![]()
Journal of Virology, September 2007, p. 9072-9077, Vol. 81, No. 17
0022-538X/07/$08.00+0 doi:10.1128/JVI.00587-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

William L. Schneider,
and
Marilyn J. Roossinck*
Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, Oklahoma 73402
Received 20 March 2007/ Accepted 25 May 2007
|
|
|---|
|
|
|---|
CMV, genus Cucumovirus, family Bromoviridae, is related to several other plant and animal viruses, such as Sindbis virus, and is a well-established model system for RNA virus evolution studies (21). It sometimes harbors molecular parasites known as satellite RNAs (satRNAs). The satRNAs are noncoding, highly structured small RNAs that are completely dependent on the virus for replication and dissemination. They make excellent reporters for evolution studies (21). Since the structure of the plus strand of D4 satRNA is well established (20), we used this satellite as a reporter to measure CMV polymerase fidelity, and we correlated mutations with RNA structure.
|
|
|---|
5' D4 satRNA. The amplified products were digested with restriction enzymes EcoRI and BamHI (underlined in the respective primers) and cloned into the analogous sites in pBluescript KS(+) (Stratagene, La Jolla, CA), resulting in
5' pDsat4. Linearization of this plasmid with XhoI followed by transcription with bacteriophage SP6 polymerase (Ambion, Austin, TX) generated a precise
5' D4 satRNA transcript. The transcript was then digested with RNase-free DNase (RQ1; Promega) to remove the plasmid template and purified from a 6% denaturing polyacrylamide gel (24). Synthesis of infectious transcripts of the Fny strain of CMV (helper virus) was described previously (22).
Plants and plant inoculations.
Plant hosts used were tobacco (Nicotiana tabacum cv. Xanthi nc) and pepper (Capsicum annuum cv. Morengo). Plants were maintained in a greenhouse with daytime temperatures of 28°C, nighttime temperatures of 22°C, and a 16-h day length. Fny CMV infectious transcripts were inoculated onto 3-week-old pepper and tobacco plants. As soon as CMV symptoms appeared (3 and 6 days postinoculation for tobacco and pepper, respectively), we inoculated the plants with
5' D4 satRNA transcript. Control plants were healthy plants inoculated with the buffer only (50 mM Na2HPO4, pH 9) or with
5' D4 satRNA transcript only.
Total RNA extraction and HiFi RT-PCR.
Twenty-four hours after inoculation of the
5' D4 satRNA reporter, total RNA was isolated from inoculated or systemically infected leaves (upper leaves above satRNA-inoculated leaves) using Tri-Reagent, according to the manufacturer's protocol (Molecular Research Center Inc., Cincinnati, OH). One-fifth of the total RNA extraction was then used in a strand-specific high-fidelity reverse transcriptase (HiFi RT) thermal cycling reaction designed to prevent amplification of any self-primed cDNAs.
For the RT reaction, we used Superscript RT as recommended by the manufacturer (Invitrogen) with the first-strand primer, GCAGACCGAATTCGGGTTATATCTACG, which is specific for the 3' end of the minus strand of
5' D4 satRNA and has a 5' sequence tag (underlined). After a 30-min incubation at 37°C, the excess of the first-strand primer was removed using a purification column (QIAGEN) to avoid any carryover to the thermal cycling reaction. The purified cDNAs were used as templates for the thermal cycling reactions with a primer specific for the sequence tag (underlined), CGCCGATATAGCAGACCGAAT, and primer CGGGCTGCAGCATAAGCCTTAGC, specific for the 5' end of the
5' D4 satRNA. The thermal cycling reactions were carried out in capillary tubes with an Idaho Technology Rapid Cycler for 15 cycles (94°C denaturation for 6 s, 50°C annealing for 6 s, and 72°C extension for 20 s). Products from this HiFi RT-PCR were purified from a 6% nondenaturing polyacrylamide gel (24) and used as the template for the indel assay.
Two regions of the reporter named nonstop (a region without an in-frame stop codon) region A and nonstop region B were identified for this assay. Nonstop region A contains 96 nt (nt 88 to 183), and nonstop region B contains 84 nt (nt 178 to 261). The indel assay primers were designed such that the entire sequence inserted in the multiple cloning site renders the lacZ gene out of frame unless an insertion or a deletion (except those in multiples of 3 nt) has occurred (Fig. 1 and data not shown).
![]() View larger version (33K): [in a new window] |
FIG. 1. The cDNA sequence of D4 satRNA plus-strand. Stop codons in the plus strand are shown in boldface, and stop codons in the minus strand are underlined. Primer sites for the nonstop A region are shown above the sequence line (AF, A region forward; AR, A region reverse). The forward primer contains two changes from the wild-type sequence to eliminate stop codons. The TGA in the reverse primer is in the same frame as the engineered stop codon and will be shifted out of frame in the event of an insertion or a deletion. Following the same strategy, primers BF (forward) and BR (reverse) were designed for the nonstop region B. The forward and reverse primers contain a PstI site and an EcoRI site (respectively) for directional cloning. The regions assayed include the sequences between (exclusive of) the primers.
|
Cloning and sequence analysis of mutant progenies.
Products from the second HiFi PCR step (amplifying the nonstop A and nonstop B regions) were digested with restriction enzymes PstI and EcoRI and ligated into the LacZ open reading frame (ORF) of pUC 19 such that they contain an ORF disrupted with a stop codon. DH5
competent cells were then transformed with ligated PCR products and plated onto LB agar containing IPTG (isopropyl-ß-D-thiogalactopyranoside) and X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside). The total number of colonies was counted with a gel documentation system (Ultra-Lum, Inc.).
All the blue colonies were transferred to a broth culture, grown overnight, and used for a small-scale plasmid preparation. The sequence of the inserts of the resulting plasmids was determined using the DNA analyzer ABI 3730. The controls for the white and blue colony color screening consisted of the circularized pUC19 without insert (positive control, blue colony) and the pUC19 containing an insert of known size in the multiple cloning site that disrupted the lacZ gene (negative control, white colony). The error rate of the HiFi RT-PCR was determined by a control reaction done simultaneously, using in vitro generated transcripts (Table 1). For comparison to mutation frequencies of the CMV replicase, the incidence of indels in pepper and tobacco were calculated from experiments described previously (25) (Table 2).
|
View this table: [in a new window] |
TABLE 1. Analysis of background mutations from SP6 transcription, RT-PCR, and cDNA cloning
|
|
View this table: [in a new window] |
TABLE 2. Indel incidence in pepper and tobacco populations of CMVa
|
Alignment of satRNA sequences. Seventy-eight satRNA sequences were obtained from the GenBank database (accession numbers available upon request) and aligned with D4 satRNA (accession number M30584) using ClustalW.
|
|
|---|
|
View larger version (10K): [in a new window] |
FIG. 2. D4 satRNA cDNA and 5' deletion mutant. The putative plus-strand promoter was deleted to allow only half a round of replication. MCS, multiple cloning site.
|
![]() View larger version (34K): [in a new window] |
FIG. 3. Strand specificity. Lane a, positive control reaction using plus-strand-specific RT-PCR and the plus-strand transcript used in lane d; lane b, 1-kb ladder marker; lane c, minus-strand-specific RT-PCR on minus-strand transcript; lane d, minus-strand-specific RT-PCR on plus-strand transcript. The size of the targeted fragment is indicated with the black arrow.
|
![]() View larger version (13K): [in a new window] |
FIG. 4. Distribution of indels observed in planta and relationship to D4 satRNA secondary structure (revised from reference 18). The nonstop regions A and B are shown in red and blue, respectively. Deletions are indicated with blue circles or red circles (for hot spots). The nucleotide number is arbitrary when deletions occurred in runs of a single nucleotide. The box marks the nucleotides involved in the 4-base insertion event.
|
|
View this table: [in a new window] |
TABLE 3. CMV replicase indel rates in planta
|
We used Octave, version 2.1.73 (J. W. Eaton; http://www.octave.org), to calculate 95% confidence intervals for the deletion rates using a bootstrap program that takes into account variation present in the data (Fig. 5). Using these intervals, the deletion rates from the in planta controls and those from systemically infected leaves were not significantly different from 0 or from each other. For inoculated leaves, most deletion rate estimates were significantly different from 0 (Fig. 5), although two samples (pepper plant 3 and tobacco plant 4) had relatively low numbers of colonies recovered during blue/white screening, which adversely affected the confidence intervals for these estimates. The deletion rate estimates were higher for the pepper-derived rates than for tobacco-derived rates, confirming trends detected in the raw data. It is difficult to precisely measure deletion rates because of the rare occurrence of indel events. Nevertheless, it was possible to estimate a deletion rate of CMV replicase in planta (Table 3).
![]() View larger version (10K): [in a new window] |
FIG. 5. Estimates of deletion rates and 95% confidence interval for each experiment. Samples are labeled according to the following key: P, pepper plant; T, tobacco plant; C, control. Samples were from inoculated leaves (Inoc.) or systemic leaves (Sys.). A description of the statistical analysis is available on request.
|
|
|
|---|
Since CMV satRNAs are noncoding, all of their biological activity resides in the primary sequence or the RNA structure. All of the deletions were found in the nonstop A region, which is highly structured, and most deletions were found more than once in these experiments (Table 3), with three occurring as often as seven or eight times, indicating potential hot spots. Pathak and Temin (19) demonstrated that the introduction of an artificial 34-bp stem-loop structure in an RT template triggered a threefold increase in the mutation rate, with 59% of the mutations consisting of deletions associated with the added stem-loop. Template secondary structure has also been shown to influence the generation of internal deletions in the genomic RNAs of Flock house virus and Tomato bushy stunt virus (14, 27). However, the mechanisms underlying RNA deletion mutation are unknown. Hence, structure seems to be important in the generation of deletion mutations, although we cannot discount the possibility that in our system there is something else that is unique about the nonstop A region that increases deletion rates.
Nagy and Bujarsky (17) proposed that pausing by Brome mosaic virus replicase within or close to an A-U-rich region of Brome mosaic virus RNA 3 induced deletions and imprecise homologous recombination. In vitro experiments suggested that viral RT pausing near the base of an extended hairpin triggered deletion events that truncated the structure (10), which correlates with recombination in vivo. Pausing during synthesis of RNA templates has also been attributed to stretches of G or C (28) and is more frequent when the template 6 to 10 nt ahead of the enzyme is base paired (8). Likewise, pausing diminishes when single unpaired nucleotides are introduced (12). Replicase pausing may explain why two deletions, G-113 and C-171, occurred so frequently (seven or eight times) (Table 3). C-171 is within a stretch of five Cs that were never methylated in in vivo analyses of satRNA structure (20), indicating that they were almost certainly involved in base pairing. G-113 is located within a stretch of four G residues; however, because G methylation by dimethyl sulfoxide is undetectable, their status (base paired or not) is uncertain. The other hypermutated nucleotide, U-178, is in the same highly structured region as the other nucleotides but is not in a homopolymer region. Since U-residue methylation by dimethyl sulfoxide is also undetectable, the base-pairing status of this nucleotide is also uncertain.
From analysis of systemically infected leaves in tobacco, we found that most of the deletions observed on the inoculated leaves do not move systemically. Several scenarios including a negative selection during the packaging process, a bottleneck during systemic movement (13), or the instability of the deleted molecules could explain this observation.
In previous studies, mutation frequencies of CMV populations were higher in pepper than in tobacco (25) (Table 2). These populations had undergone an unknown number of rounds of replication and were subjected to a variety of selective forces; thus, a role for replicase fidelity under these conditions is only one of several possibilities. Here, we clearly established a difference in replicase fidelity between pepper and tobacco, the first report of a viral replicase exhibiting variable fidelity in different hosts. The identification and manipulation of factors that regulate viral replicase fidelity in these hosts may offer a new set of tools to predict or control emerging diseases.
This work was supported by the Samuel Roberts Noble Foundation.
Published ahead of print on 6 June 2007. ![]()
Present address: School of Biological Sciences, Queen's University Belfast, BT9 7BL Belfast, Northern Ireland. ![]()
Present address: USDA-ARS, 1301 Ditto Ave., Frederick, MD 21702. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»