Previous Article | Next Article 
Journal of Virology, August 2007, p. 8356-8360, Vol. 81, No. 15
0022-538X/07/$08.00+0 doi:10.1128/JVI.00484-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Expression of Extremely Low Levels of Thymidine Kinase from an Acyclovir-Resistant Herpes Simplex Virus Mutant Supports Reactivation from Latently Infected Mouse Trigeminal Ganglia
Michael I. Besecker,1
Caroline L. Furness,2,
Donald M. Coen,2 and
Anthony Griffiths1,2*
Department of Virology and Immunology, Southwest Foundation for Biomedical Research, San Antonio, Texas 78227,1
Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, Massachusetts 021152
Received 7 March 2007/
Accepted 10 May 2007

ABSTRACT
A single-cytosine-deletion in the herpes simplex virus gene
encoding thymidine kinase (TK) was previously found in an acyclovir-resistant
clinical isolate. A laboratory strain engineered to carry this
mutation did not generate sufficient TK activity for detection
by plaque autoradiography, which detected 0.25% wild-type activity.
However, a drug sensitivity assay suggested that extremely low
levels of TK are generated by this virus. The virus was estimated
to express 0.09% of wild-type TK activity via a ribosomal frameshift
24 nucleotides upstream of the mutation. Remarkably, this appeared
to be sufficient active TK to support a low level of reactivation
from latently infected mouse trigeminal ganglia.

TEXT
Herpes simplex virus (HSV) thymidine kinase (TK) selectively
activates a number of highly effective antiviral drugs, including
acyclovir (ACV). However, pathogenic viruses that are resistant
to ACV frequently arise in immunocompromised patients (
3,
9).
Many drug-resistant HSV isolates generate low levels of active
TK, and it has been proposed that these viruses generate insufficient
TK to activate ACV but enough to support pathogenesis in an
immunocompromised patient (
14,
19). The mutation that most commonly
confers resistance is a single-guanine (G) insertion in a run
of seven Gs ("G string") in
tk (
10,
11,
22,
23). Viruses with
this mutation generate low levels of full-length active TK via
a net +1 ribosomal frameshift that compensates for the added
base (
12,
18,
19,
26). Further studies revealed that the wild-type-length
(G
7) G string appeared to support both +1 and 1 ribosomal
frameshifting (
15).
A drug-resistant virus shown to have a deletion of a cytosine (C) in a run of 5 Cs 24 nucleotides downstream of the G string was previously isolated from the oropharynx of an individual with an unknown history of immunosuppression (10). (Fig. 1). Given that the wild-type G string (G7) was sufficient for 1 ribosomal frameshifting (15), we hypothesized that a 1 ribosomal frameshift on the G string could compensate for the deleted C downstream. In this scenario, the ribosome would shift the reading frame on the G string and translate non-wild-type amino acids between the G string and the deleted C. The wild-type reading frame would be restored due to the deleted C. Enzyme activity would be dependent on the efficiency of the 1 ribosomal frameshift on the wild-type G string, previously estimated to be 0.25% (15), in addition to the effect of the non-wild-type amino acids between the G string and the Cs.
Construction of recombinant virus TK1C5-1C.
To permit comparison with previously reported viruses, the deleted-C
mutation was engineered into the laboratory strain KOS (Fig.
1). Strain KOS was chosen because KOS mutants that lack TK activity
are unable to reactivate from latently infected mouse trigeminal
ganglia (
2,
6,
12,
13,
15,
20). The C deletion was introduced
into plasmid pAG5 (
13), which contains the entire BamHI "P"
fragment from KOS, by site-directed mutagenesis (QuickChange;
Stratagene) using a duplex of oligonucleotides (forward primer,
CTGGGAGCTCACATGCCCCGCCCCGGCCCTCACCCTCATC) according to the manufacturer's
instructions. The resulting plasmid was named pTK1C5-1C. The
presence of the deletion and the absence of other mutations
in
tk were confirmed by sequencing. Two isolates of the recombinant
viruses (TK1C5-1C.1 and TK1C5-1C.2) were generated from separate
transfections by cotransfecting pTK1C5-1C with
tkLTRZ1 DNA (
13).
tkLTRZ1 is a recombinant virus generated from strain KOS that
has
lacZ driven by the Moloney murine leukemia virus long terminal
repeat (LTR) inserted into
tk (
8). Recombination between pTK1C5-1C
and
tkLTRZ1 yields viruses that have "white" plaques when stained
with X-Gal (5-bromo-4-chloro-3-indolyl-ß-
D-galactopyranoside),
which are easily distinguished from "blue"
tkLTRZ1 plaques.
White viruses were purified by limiting dilution (
13,
16).
tk genes from the purified isolates were sequenced to confirm the
presence of the single-C deletion in the absence of other mutations.
A TK enzyme assay and PA both failed to detect active TK in TK1C5-1C-infected cells.
Plaque autoradiography (PA) and measurements of enzymatic activity in cell lysates are sensitive techniques used to detect HSV TK activity. In our hands, the enzyme assay can detect approximately 0.4% of wild-type TK activity (17), and PA can detect approximately 0.25% of wild-type TK activity (15). We first asked whether we could detect TK activity in lysates of TK1C5-1C-infected cells using an enzyme assay described previously (17), except that Vero cells were used and dried filters were digested in 4 ml of 75 mM sodium acetate, pH 5.0, and 10 mg cellulase for 60 min at 37°C in the scintillation tube. Scintillation fluid was added to the samples, which were then analyzed in a scintillation counter. Levels of active TK above background (tkLTRZ1-infected cell lysates) were not detected in cells infected with either TK1C5-1C.1 or TK1C5-1C.2 (data not shown). Next, with PA (2, 12, 13, 15), active TK was not detected in TK1C-1C-infected plaques (Fig. 2). In contrast, TK activity was readily detected with viruses LS-29/-18 and TKG7dG (Fig. 2), which have, respectively, been shown to synthesize 0.5% and 0.25% of wild-type TK (7, 15). Therefore, virus TK1C-1C generated less than 0.25% of wild-type TK activity.
Pharmacological assay to detect active TK.
We considered the possibility that virus TK1C-1C may generate
levels of active TK that were below the limits of detection
of the above assays. It has been shown that susceptibility to
antiviral drugs that require TK for activation is a sensitive
method of detecting TK activity (
4,
5,
7). We performed plaque
reduction assays (PRA) to test the susceptibility of virus TK1C5-1C
to the antiviral drug ganciclovir (GCV). For comparison, we
included strains KOS (100% TK activity), TKG7+1G (0.5% [
12]),
and
tkLTRZ1 (0% [
8]). Assays were performed as previously described
(
4). As expected, KOS was most sensitive to GCV, and
tkLTRZ1
was the least sensitive (Fig.
3). TK1C5-1C.1, TK1C5-1C.2, and
TKG7+1G had similar GCV 50% effective doses (ED
50) (11 µM,
8 µM, and 10 µM, respectively), which were all lower
than the GCV ED
50 for
tkLTRZ1 (40 µM). At 10 µM,
25 µM, and 50 µM, the differences in sensitivity
to GCV of
tkLTRZ1 compared to TK1C5-1C.1, TK1C5-1C.2, or TKG7+1G
were highly significant (
P [for each], <0.004 [Student's
t test]). These data strongly suggest that like TKG7+1G, TK1C5-1C
generated a low level of active TK. Although this assay was
sensitive, we were unable to differentiate between the levels
of TK expression from the TK1C5-1C viruses and TKG7+1G.
Translation of mutant amino acids between the G string and the TK1C5-1C mutation reduces TK activity.
We hypothesized that a 1 ribosomal frameshift on the
G string upstream of the TK1C5-1C mutation shifts the frame
translated by the ribosome such that nine out-of-frame amino
acids are translated before the wild-type frame is restored
by the TK1C5-1C mutation (Fig.
1). Therefore, the TK activity
of TK1C5-1C would be a product of the frameshifting efficiency
on the G string (0.25%) and the effect of the non-wild-type
amino acids. Importantly, the crystal structure of HSV TK shows
that these residues are physically distant from the nucleoside
and triphosphate binding sites (
1,
24,
25). To estimate the
effect of these amino acids on TK, we generated a virus with
wild-type TK sequence, except for the amino acids between the
G string and the TK1C5-1C mutation, by adding a G to the G string
of a TK gene that already included the TK1C5-1C mutation (Fig.
1). Plasmid pTKG7+1G.1C5-1C was generated by site-directed mutagenesis
(as described above) of pTK1C5-1C, with a duplex of oligonucleotides
(forward primer, CTGGCTCCTCATATCGGGGGGGGAGGCTGGGAGCTC). The
recombinant virus, TKG7+1G.1C5-1C, was generated from pTKG7+1G.1C5-1C,
as described above. Viral TK activity in cell lysates was measured
with the enzyme assay described above. Values from triplicate
infections were averaged, and the enzyme activities in TKG7+1G.1C5-1C-infected
cells were compared to serial dilutions of KOS-infected cell
lysates. Using this assay we determined that virus TKG7+1G.1C5-1C
had 35% (standard deviation, 3%) of the TK activity of KOS.
Therefore, accounting for a 1 frameshifting efficiency
of 0.25% and the effect of the out-of-frame amino acids on the
enzyme activity, the TK activity of TK1C5-1C was estimated to
be 0.09% of the wild-type level (35% of 0.25%).
Virus TK1C5-1C reactivated from latently infected mouse trigeminal ganglia, albeit at a low frequency.
We had previously determined that levels of TK as low as 0.25% support reactivation of HSV from latently infected mouse trigeminal ganglia (virus reactivated from 2 of 28 ganglia) (15). To determine whether virus TK1C5-1C could reactivate from latency, male 8-week-old CD-1 mice (Charles River Laboratories) were infected via the cornea with 1 x 106 PFU of KOS or 7 x 107 PFU of TK1C5-1C.1, TK1C5-1C.2, or tkLTRZ1, as described previously (5, 21). At 30 days postinfection, the mice were sacrificed and the ganglia were harvested, enzymatically dissociated, and plated onto Vero cells, as described previously (21). Virus reactivated from 1 of 13 ganglia latently infected with TK1C5-1C.1, and no reactivation was observed from 13 ganglia latently infected with TK1C5-1C.2. Virus reactivated from all of the ganglia latently infected with KOS (38 ganglia), and virus did not reactivate from any of the ganglia latently infected with tkLTRZ1 (46 ganglia). The low frequency of reactivation of TK1C5-1C was similar to that previously observed with viruses that express levels of TK of
0.5% of wild type (15).
Reactivation of TKC5-1C.R appeared not to be due to reversion and was most likely dependent on TK activity.
The virus that reactivated from TK1C5-1C-infected ganglia (TK1C5-1C.R) was analyzed by PA (Fig. 2) and PRA (data not shown). In both assays, TK1C5-1C.R behaved like TK1C5-1C, indicating that the virus had not reverted to the wild-type TK phenotype. Sequencing confirmed that the TK open reading frame of TK1C-1C.R was identical to that of TK1C-1C. Additionally, given these observations and that TK1C5-1C virus was not handled during the incubation of the ganglia, contamination of the sample with virus TK1C5-1C was highly unlikely to be the source of TK1C5-1C.R.
Previous reports have shown that certain clinical isolates may be able to reactivate from latently infected mouse trigeminal ganglia in the absence of TK, suggesting the existence of alleles that may compensate for the lack of active TK (12, 17). To address whether TK1C5-1C.R reactivated from latency in a TK-dependent manner, we removed the capacity of the reactivated virus to synthesize active TK. To this end, we recombined the LTR-lacZ (from plasmid ptkLTRZ1 [8]) into TK1C5-1C.R to yield TK1C5-1C.R.lacZ (Fig. 1). This virus behaved similarly to tkLTRZ1 in a PRA (data not shown). Virus did not reactivate from any of the ganglia latently infected with TK1C5-1C.R.lacZ (14 ganglia). In contrast, the previous reports of TK-independent reactivation show it to be relatively efficient, with at least 30% of latently infected ganglia supporting reactivation (12, 17). Therefore, it seems unlikely that virus TK1C5-1C.R had acquired any mutations that conferred the ability to reactivate in the absence of TK. These observations are consistent with the notion that the very low levels of TK synthesized by TK1C5-1C were sufficient to support reactivation from latently infected mouse trigeminal ganglia.
Herein, we describe the characterization of a virus with a mutation that has been reported in drug-resistant HSV disease: a single-C deletion in a run of five Cs. We have estimated that this virus generates only 0.09% of wild-type TK activity and provided evidence that this is sufficient to support reactivation from latently infected mouse trigeminal ganglia, albeit weakly. This supports previous work suggesting that HSV-1 expresses much more TK than is required for ganglionic function, at least in the mouse (2, 12, 15).
It is important to note that TK1C5-1C generated levels of TK that could be detected only pharmacologically. Viruses with this mutation have previously been characterized as TK (10). However, the data presented in this paper suggest that it is possible that other viruses reported to be phenotypically TK based on PA (10; also reviewed in reference 11) may actually express low levels of TK.

ACKNOWLEDGMENTS
We thank Jean Pesola for assistance with the animal experiments.
This work was supported by grants PO1 NS35138, RO1 AI26126, and T32 AI07245 from the National Institutes of Health.

FOOTNOTES
* Corresponding author. Mailing address: Dept. of Virology and Immunology, Southwest Foundation for Biomedical Research, San Antonio, TX 78227. Phone: (210) 258-9557. Fax: (210) 670-3329. E-mail:
agriffiths{at}sfbr.org 
Published ahead of print on 23 May 2007. 
Present address: Grand Union Ward, Department of Paediatrics, St. Mary's Hospital, Praed Street, London W2 1NY, United Kingdom. 

REFERENCES
1 - Brown, D. G., R. Visse, G. Sandhu, A. Davies, P. J. Rizkallah, C. Melitz, W. C. Summers, and M. R. Sanderson. 1995. Crystal structures of the thymidine kinase from herpes simplex virus type-1 in complex with deoxythymidine and ganciclovir. Nat. Struct. Biol. 2:876-881.[CrossRef][Medline]
2 - Chen, S. H., W. J. Cook, K. L. Grove, and D. M. Coen. 1998. Human thymidine kinase can functionally replace herpes simplex virus type 1 thymidine kinase for viral replication in mouse sensory ganglia and reactivation from latency upon explant. J. Virol. 72:6710-6715.[Abstract/Free Full Text]
3 - Christophers, J., J. Clayton, J. Craske, R. Ward, P. Collins, M. Trowbridge, and G. Darby. 1998. Survey of resistance of herpes simplex virus to acyclovir in northwest England. Antimicrob. Agents Chemother. 42:868-872.[Abstract/Free Full Text]
4 - Coen, D. M., H. E. Fleming, Jr., L. K. Leslie, and M. J. Retondo. 1985. Sensitivity of arabinosyladenine-resistant mutants of herpes simplex virus to other antiviral drugs and mapping of drug hypersensitivity mutations to the DNA polymerase locus. J. Virol. 53:477-488.[Abstract/Free Full Text]
5 - Coen, D. M., A. F. Irmiere, J. G. Jacobson, and K. M. Kerns. 1989. Low levels of herpes simplex virus thymidine-thymidylate kinase are not limiting for sensitivity to certain antiviral drugs or for latency in a mouse model. Virology 168:221-231.[CrossRef][Medline]
6 - Coen, D. M., M. Kosz Vnenchak, J. G. Jacobson, D. A. Leib, C. L. Bogard, P. A. Schaffer, K. L. Tyler, and D. M. Knipe. 1989. Thymidine kinase-negative herpes simplex virus mutants establish latency in mouse trigeminal ganglia but do not reactivate. Proc. Natl. Acad. Sci. USA 86:4736-4740.[Abstract/Free Full Text]
7 - Coen, D. M., S. P. Weinheimer, and S. L. McKnight. 1986. A genetic approach to promoter recognition during trans induction of viral gene expression. Science 234:53-59.[Abstract/Free Full Text]
8 - Davar, G., M. F. Kramer, D. Garber, A. L. Roca, J. K. Andersen, W. Bebrin, D. M. Coen, M. Kosz Vnenchak, D. M. Knipe, X. O. Breakefield, and O. Isacson. 1994. Comparative efficacy of expression of genes delivered to mouse sensory neurons with herpes virus vectors. J. Comp. Neurol. 339:3-11.[CrossRef][Medline]
9 - Englund, J. A., M. E. Zimmerman, E. M. Swierkosz, J. L. Goodman, D. R. Scholl, and H. H. Balfour, Jr. 1990. Herpes simplex virus resistant to acyclovir. A study in a tertiary care center. Ann. Intern. Med. 112:416-422.[Abstract/Free Full Text]
10 - Gaudreau, A., E. Hill, H. H. Balfour, Jr., A. Erice, and G. Boivin. 1998. Phenotypic and genotypic characterization of acyclovir-resistant herpes simplex viruses from immunocompromised patients. J. Infect. Dis. 178:297-303.[Medline]
11 - Gilbert, C., J. Bestman-Smith, and G. Boivin. 2002. Resistance of herpesviruses to antiviral drugs: clinical impacts and molecular mechanisms. Drug Resist. Updat. 5:88-114.[CrossRef][Medline]
12 - Griffiths, A., S. H. Chen, B. C. Horsburgh, and D. M. Coen. 2003. Translational compensation of a frameshift mutation affecting herpes simplex virus thymidine kinase is sufficient to permit reactivation from latency. J. Virol. 77:4703-4709.[Abstract/Free Full Text]
13 - Griffiths, A., and D. M. Coen. 2003. High-frequency phenotypic reversion and pathogenicity of an acyclovir-resistant herpes simplex virus mutant. J. Virol. 77:2282-2286.[Abstract/Free Full Text]
14 - Griffiths, A., and D. M. Coen. 2005. An unusual internal ribosome entry site in the herpes simplex virus thymidine kinase gene. Proc. Natl. Acad. Sci. USA 102:9667-9672.[Abstract/Free Full Text]
15 - Griffiths, A., M. A. Link, C. L. Furness, and D. M. Coen. 2006. Low-level expression and reversion both contribute to reactivation of herpes simplex virus drug-resistant mutants with mutations on homopolymeric sequences in thymidine kinase. J. Virol. 80:6568-6574.[Abstract/Free Full Text]
16 - Griffiths, A., S. Renfrey, and T. Minson. 1998. Glycoprotein C-deficient mutants of two strains of herpes simplex virus type 1 exhibit unaltered adsorption characteristics on polarized or non-polarized cells. J. Gen. Virol. 79:807-812.[Abstract]
17 - Horsburgh, B. C., S. H. Chen, A. Hu, G. B. Mulamba, W. H. Burns, and D. M. Coen. 1998. Recurrent acyclovir-resistant herpes simplex in an immunocompromised patient: can strain differences compensate for loss of thymidine kinase in pathogenesis? J. Infect. Dis. 178:618-625.[Medline]
18 - Horsburgh, B. C., H. Kollmus, H. Hauser, and D. M. Coen. 1996. Translational recoding induced by G-rich mRNA sequences that form unusual structures. Cell 86:949-959.[CrossRef][Medline]
19 - Hwang, C. B., B. C. Horsburgh, E. Pelosi, S. Roberts, P. Digard, and D. M. Coen. 1994. A net +1 frameshift permits synthesis of thymidine kinase from a drug-resistant herpes simplex virus mutant. Proc. Natl. Acad. Sci. USA 91:5461-5465.[Abstract/Free Full Text]
20 - Jacobson, J. G., S. H. Chen, W. J. Cook, M. F. Kramer, and D. M. Coen. 1998. Importance of the herpes simplex virus UL24 gene for productive ganglionic infection in mice. Virology 242:161-169.[CrossRef][Medline]
21 - Leib, D. A., D. M. Coen, C. L. Bogard, K. A. Hicks, D. R. Yager, D. M. Knipe, K. L. Tyler, and P. A. Schaffer. 1989. Immediate-early regulatory gene mutants define different stages in the establishment and reactivation of herpes simplex virus latency. J. Virol. 63:759-768.[Abstract/Free Full Text]
22 - Morfin, F., D. Thouvenot, M. Aymard, and G. Souillet. 2000. Reactivation of acyclovir-resistant thymidine kinase-deficient herpes simplex virus harbouring single base insertion within a 7 Gs homopolymer repeat of the thymidine kinase gene. J. Med. Virol. 62:247-250.[CrossRef][Medline]
23 - Sasadeusz, J. J., F. Tufaro, S. Safrin, K. Schubert, M. M. Hubinette, P. K. Cheung, and S. L. Sacks. 1997. Homopolymer mutational hot spots mediate herpes simplex virus resistance to acyclovir. J. Virol. 71:3872-3878.[Abstract]
24 - Wild, K., T. Bohner, A. Aubry, G. Folkers, and G. E. Schulz. 1995. The three-dimensional structure of thymidine kinase from herpes simplex virus type 1. FEBS Lett. 368:289-292.[CrossRef][Medline]
25 - Wild, K., T. Bohner, G. Folkers, and G. E. Schulz. 1997. The structures of thymidine kinase from herpes simplex virus type 1 in complex with substrates and a substrate analogue. Protein Sci. 6:2097-2106.[Medline]
26 - Zook, M. B., M. T. Howard, G. Sinnathamby, J. F. Atkins, and L. C. Eisenlohr. 2006. Epitopes derived by incidental translational frameshifting give rise to a protective CTL response. J. Immunol. 176:6928-6934.[Abstract/Free Full Text]
Journal of Virology, August 2007, p. 8356-8360, Vol. 81, No. 15
0022-538X/07/$08.00+0 doi:10.1128/JVI.00484-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Atkins, J. F., Bjork, G. R.
(2009). A Gripping Tale of Ribosomal Frameshifting: Extragenic Suppressors of Frameshift Mutations Spotlight P-Site Realignment. Microbiol. Mol. Biol. Rev.
73: 178-210
[Abstract]
[Full Text]