Previous Article | Next Article 
Journal of Virology, August 2007, p. 8165-8179, Vol. 81, No. 15
0022-538X/07/$08.00+0 doi:10.1128/JVI.02792-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Conserved Changes in Envelope Function during Human Immunodeficiency Virus Type 1 Coreceptor Switching
Cristina Pastore,1
Rebecca Nedellec,1
Alejandra Ramos,1
Oliver Hartley,2
John L. Miamidian,3
Jacqueline D. Reeves,3,
and
Donald E. Mosier1*
Department of Immunology, The Scripps Research Institute, La Jolla, California,1
Department of Structural Biology and Bioinformatics, University of Geneva, Geneva, Switzerland,2
Department of Microbiology, University of Pennsylvania, Philadelphia, Pennsylvania3
Received 18 December 2006/
Accepted 5 May 2007

ABSTRACT
We studied the evolution of human immunodeficiency virus type
1 (HIV-1) envelope function during the process of coreceptor
switching from CCR5 to CXCR4. Site-directed mutagenesis was
used to introduce most of the possible intermediate mutations
in the envelope for four distinct coreceptor switch mutants,
each with a unique pattern of CCR5 and CXCR4 utilization that
extended from highly efficient use of both coreceptors to sole
use of CXCR4. Mutated envelopes with some preservation of entry
function on either CCR5- or CXCR4-expressing target cells were
further characterized for their sensitivity to CCR5 or CXCR4
inhibitors, soluble CD4, and the neutralizing antibodies b12-IgG
and 4E10. A subset of mutated envelopes was also studied in
direct CD4 or CCR5 binding assays and in envelope-mediated fusion
reactions. Coreceptor switch intermediates displayed increased
sensitivity to CCR5 inhibitors (except for a few envelopes with
mutations in V2 or C2) that correlated with a loss in CCR5 binding.
As use of CXCR4 improved, infection mediated by the mutated
envelopes became more resistant to soluble CD4 inhibition and
direct binding to CD4 increased. These changes were accompanied
by increasing resistance to the CXCR4 inhibitor AMD3100. Sensitivity
to neutralizing antibody was more variable, although infection
of CXCR4-expressing targets was generally more sensitive to
neutralization by both b12-IgG and 4E10 than infection of CCR5-expressing
target cells. These changes in envelope function were uniform
in all four series of envelope mutations and thus were independent
of the final use of CCR5 and CXCR4. Decreased CCR5 and increased
CD4 binding appear to be common features of coreceptor switch
intermediates.

INTRODUCTION
The high genomic variability of the primate lentiviruses, particularly
in the envelope region that determines virus interaction with
target cells, is probably responsible for the multiple cross-species
transmissions of human immunodeficiency virus type 1 (HIV-1)
and HIV-2 to humans (
18). Envelope variability in HIV-1 is also
responsible for the change in coreceptor preference from CCR5
to CXCR4 that occurs in about 50% of chronically infected humans
(
5,
36). In each instance, evolution of envelope protein function
must occur to allow infection of a new species or a new target
cell. Comparison of primate and human immunodeficiency viruses
suggests that the primate viruses are more dependent on CCR5
and less dependent on CD4 than HIV-1, and use of CXCR4 by primate
lentiviruses is exceedingly rare (reviewed in reference
21).
While the sequence correlates of HIV-1 coreceptor switching
are known, the functional consequences for the evolution of
protein function are less clear. Sequential virus isolates from
patients before and after coreceptor switching identify the
starting substrate and the highly selected final products, but
not the intermediate steps that might pose the greatest fitness
challenges (
37,
39). One can anticipate that increased binding
to CXCR4 is a necessary step in the evolution of envelope during
coreceptor switching, but loss of CCR5 binding may or may not
occur. Moreover, it is not clear that there is one evolutionary
pathway from CCR5 to CXCR4 use. A combination of stochastic
selection factors, including antibody and cytotoxic-T-lymphocyte
responses directed at the envelope (
14), target cell selection
(
56), and chemokine levels influenced by both genetic factors
(
17), and concurrent infections (
58) may influence the probability
of emergence of CXCR4-using variants.
We have reconstructed four potential pathways for HIV-1 envelope evolution from CCR5 to CXCR4 use by using site-directed mutagenesis to generate most of the possible intermediates separating parental R5 sequences from R5X4 or X4 variants that were generated by propagating infectious clones of R5 BaL or ADA isolates on target cells expressing only CXCR4 (37, 39). These four examples were chosen for detailed analysis because the coreceptor switch variants displayed different phenotypes, ranging from robust entry mediated by either CCR5 or CXCR4 to selective use of CXCR4 only. In the present study, we evaluated the impacts of these mutations in the envelope on interactions with CCR5, CD4, and CXCR4, as well as sensitivity to two broadly neutralizing antibodies, b12-IgG (6) and 4E10 (7). We present evidence that envelope evolution toward CXCR4 use is accompanied by diminished binding to CCR5, increased binding to CD4, and slowly increasing use of CXCR4. Sensitivity to neutralizing antibody is more variable, but each pathway of envelope evolution contains members that are significantly more sensitive to neutralization than parental R5 envelopes.

MATERIALS AND METHODS
Cell lines.
U87-CD4-CCR5 and U87-CD4-CXCR4 cells (
4,
11) were maintained
in Dulbecco's modified Eagle's medium supplemented with 10%
fetal bovine serum, 1 µg of puromycin/ml, and 300 µg
of G418/ml (in cell lines used at Scripps). 293T, NP2 (
59),
NP2/CD4 (
53), QT6, U87/CD4/CCR5 (
4,
11), and T-REx/CCR5 (
46)
cell lines were cultured in Dulbecco's modified Eagle's medium
supplemented with 10% fetal bovine serum, 100 U of penicillin,
and 100 µg of streptomycin per ml. In addition, 1 mg of
G418 per ml was used to maintain CD4 expression in NP2/CD4 cells
and 200 µg of zeocin plus 5 µg of blasticidin per
ml was used to maintain CCR5 and Tet repressor genes in T-REx/CCR5
cells (in cell lines used at the University of Pennsylvania).
High-level CCR5 expression was induced in T-REx/CCR5 cells by
the addition of 10 ng of doxycycline (Sigma) per ml to the culture
medium.
Cloning and mutagenesis.
The ADA and BaL full-length envelope (Env) glycoproteins were amplified by PCR from the virus plasmids pNL4-3-ADA and pR8-BaL (39), respectively, with two sets of primers spanning the 5' and 3' ends of the ADA and BaL env genes and inserting a 5' SalI and a 3' XhoI restriction site for ADA and a 5' SalI and a 3' HpaI site for BaL. The ADA SalI-XhoI and the BaL SalI-HpaI fragments of the PCR products were cloned into the expression plasmid pSVIII (54).
Each single mutation or combination of mutations was introduced into the cloned Env by site-directed mutagenesis (QuikChange Site-Directed Mutagenesis Kit; Stratagene, La Jolla, CA) by following the manufacturer's instructions. The sequence of each mutant Env was confirmed using four previously described primer pairs (39).
For fusion experiments, SalI-XhoI fragments of ADA or mutated ADA Envs were cloned into the XhoI site of the pSI expression vector (Promega) to generate gp160 expression constructs that contained both T7 and cytomegalovirus promoters. For binding experiments, stop codons were introduced at the gp120/gp41 cleavage junction of these constructs by site-directed mutagenesis (QuikChange Site-Directed Mutagenesis Kit) using GTGCAGAGAGAAAAAAGATAAGTGGGAACGATAGAAGCTTTGTTCCTTGG (forward) and CCAAGGAACAAAGCTTCTATCGTTCCCACTTATCTTTTTTCTCTCTGCAC (reverse) primers to generate gp120 expression constructs. These primers also introduced a HindIII restriction endonuclease site (underlined) downstream of the stop codon (underlined) for screening purposes. These constructs were verified by sequencing.
Entry assay.
The entry efficiencies of mutated Env proteins were measured in a single-cycle pseudovirus infection assay. Mutant Env clones inserted into the pSVIII plasmid were cotransfected with Env-negative, luciferase-positive (NL4-3-Luc+ E R [10]) reporter plasmids in 293T cells, and the resulting pseudoviruses were harvested, standardized for p24 content, and used to infect either U87-CD4-CCR5 cells or U87-CD4-CXCR4 cells. The luciferase activities from triplicate wells were measured on a luminometer (EG&G Berthold LB 96V; Perkin-Elmer, Gaithersburg, MD) with the Luciferase Assay System (Promega, Madison, WI) according to the manufacturer's instructions. Virus infectivity was compared to that of the parental R5 virus by calculating the slope of the infectivity curve by plotting p24 input versus light units of luciferase activity after 48 to 72 h of culture. The slope was calculated using linear regression analysis (Prism 4; GraphPad Software, San Diego, CA). Determination of infectivity was repeated in three replicate experiments, and the mean infectivity was compared to that of parental ADA or BaL Env by expressing the log change from the parental Env.
Inhibitors.
The CCR5 inhibitor PSC-RANTES (20) or TAK-779 (2) was used to block single-cycle infection of U87-CD4-CCR5 target cells by Env-pseudotyped viruses. AMD3100 (13) was used to block single-cycle infection of U87-CD4-CXCR4 cells. CD4-immunoglobulin G (IgG) (kindly provided by Michael Franti, Progenics) was used to inhibit single-cycle infection of U87-CD4-CCR5 or -CXCR4 cells. The broadly neutralizing monoclonal antibodies (nAb) b12-IgG and 4E10 were supplied by Dennis Burton and the NIH AIDS Research and Reference Reagent Program, respectively. All inhibitors were used over a broad concentration range that spanned 0 to 100% inhibition of infection, and 50% inhibitory concentrations (IC50) were calculated for each experiment using the sigmoidal curve-fitting program in GraphPad Prism 4 (GraphPad, San Diego, CA). Each inhibition experiment was repeated three times, and the log mean ± standard error (SE) of the three IC50 values was calculated. For inhibition of infection of U87-CD4-CCR5 cells, the log change in IC50 values from the parental ADA or BaL Env was calculated. These data are reported over a 4-log-unit scale to facilitate comparison of different mutant Env proteins and to accommodate the broad variation in IC50 values. For infection of U87-CD4-CXCR4 cells, the log mean IC50 values ± SE are reported, since there is no reference parental Env that is infectious for these target cells.
Env receptor binding assays.
gp120s were produced from 293T cells that were calcium phosphate transfected with gp120 expression constructs and infected with a vaccinia virus encoding T7 polymerase (vTF1.1 [1]) to drive expression from the T7 promoter. Cell culture supernatants were harvested 24 h posttransfection, and gp120 concentrations were determined by enzyme-linked immunosorbent assay as previously described (49), with the exception that gp120 was detected with an HIV-1 Env-specific rabbit serum and a horseradish peroxidase-conjugated anti-rabbit immunoglobulin antibody (Amersham Life Science), followed by TMB substrate (3,3',5,5'-tetramethylbenzidine; KPL). The receptor binding efficiencies of ADA and ADA mutant gp120s were determined with a cell surface binding assay in which bound protein was detected by immunostaining and flow cytometry analysis, as previously described (46, 49). CD4-negative T-REx/CCR5 cells, induced to express a high level of CCR5, were used to determine Env-CCR5 binding efficiency in the absence and presence of 5 µg of soluble CD4 per ml to induce coreceptor binding site exposure. NP2 and NP2/CD4 cells were used to determine Env-CD4 binding efficiency. Bound gp120 was detected with an HIV Env-specific rabbit serum and a phycoerythrin-conjugated anti-rabbit immunoglobulin antibody (Pharmingen).
Cell-cell fusion assay.
QT6 effector cells, transfected with Env expression plasmids and infected with vTF1.1 (1), were added to QT6 target cells cotransfected with a luciferase reporter construct under the control of a T7 promoter (pGEM2 T7-luc; Promega), CD4 (16), and CCR5 or CXCR4 (47) expression plasmids. Cell-cell fusion, resulting from a functional interaction between the Env-expressing effector cells and receptor-expressing target cells, was detected by assaying for T7 polymerase-driven luciferase expression within the linear range of the assay. This assay has been described in detail previously (50).
Env fusion kinetics.
The fusion kinetics of ADA wild-type (wt) and mutant Envs were determined in a ß-lactamase reporter cell-cell fusion assay, based on that described by Lineberger et al. and Reeves et al. (28, 48). QT6 effector cells, cotransfected with Env and ß-lactamase expression constructs and infected with vTF1.1, were added to U87-CD4-CCR5 target cells labeled with CCF2-AM as previously described (48). Cell-cell fusion was detected by assaying for a shift from green to blue fluorescence, indicating ß-lactamase cleavage of CCF2. Fluorescence was measured with a CytoFluor Series 4000 Fluorescence multiwell plate reader.

RESULTS
The generation of coreceptor switch mutants in vitro and an
initial analysis of the impacts of different mutations in Env
of the ADA- or BaL-derived variants have been described previously
(
37,
39). Table
1 shows the sites of the mutations in HIV-1
Env for the four coreceptor switch variants examined in these
studies, with each mutation site numbered sequentially from
N terminal to C terminal. The mutational pathways to CXCR4 use
for four independent variants were examined: ADA-1, a variant
with seven mutations resulting in a pure X4 phenotype (Fig.
1); ADA-3, a variant with five mutations resulting in a weak
R5X4 phenotype; BaL-1B, a variant with five mutations resulting
in a robust R5X4 phenotype; and BaL-2A, a variant with three
mutations in V2 plus V3 (Table
1) and one mutation in C5 (K490T)
with a somewhat weaker R5X4 phenotype. The assignment of entry
efficiency was made by single-cycle infection of either U87-CD4-CCR5
or U87-CD4-CXCR4 target cells with molecularly cloned Env mediating
entry of the reporter construct NL4-3-E
Luc
+ (
10) as
previously described (
37). The relative entry efficiency of
each final variant on both target cell lines is shown in Fig.
1. Note that the BaL Env is highly efficient at using CCR5 for
virus entry, and R5X4 variants of BaL retain efficient use of
CCR5 while acquiring the ability to use CXCR4. By contrast,
ADA Env is somewhat less efficient at using CCR5, and acquisition
of the ability to use CXCR4 is accompanied by either a major
or total loss of CCR5-mediated entry. Analysis of the mutational
pathways leading to these four variants thus spans the observed
spectrum of R5-to-X4 transitions. We also note that these assay
methods for assigning coreceptor use are very similar to those
used in recent clinical studies (
5,
22,
36) but that both target
cell lines express high levels of both CD4 and CCR5 or CXCR4
and thus are able to support infection by viruses that cannot
infect activated human CD4
+ T cells (
39). This feature is useful
for assessing the entry efficiencies of coreceptor switch intermediates
with very inefficient use of CCR5 or CXCR4, as well as in predicting
the response to CCR5 inhibitors in current clinical trials (
57),
but it should be noted that no such target cells are likely
to exist in human lymphoid tissue.
Functional changes in ADA-1 Env during the transition from R5 to X4.
Figure
2A summarizes the entry efficiencies of Env mutants representing
most of the combinations of seven mutations that separate the
parental ADA Env from ADA-1 (Table
1). The data in Fig.
2A extend
previously published observations (
37) and provide the basis
for selecting Env mutants for further study. Env mutants that
had less than a 1-log-unit change in entry efficiency
compared to ADA wt Env were evaluated for sensitivity to CCR5
inhibitors, nAb, and CD4 inhibition by CD4-IgG (Fig.
2B to F)
on CCR5-expressing target cells. Env mutants that had gained
weak or strong use of CXCR4 were evaluated for sensitivity to
AMD3100, nAb, and CD4-IgG (Fig.
3A to D) on CXCR4-expressing
target cells. The p24 content of each pseudovirion preparation
expressing a given Env mutant was adjusted to yield

100,000
relative light units for all inhibition studies to correct for
the differences in entry function shown in Fig.
2A. For inhibition
studies with CCR5 target cells, data are expressed as the log
change in IC
50 from ADA wt Env. Each experiment was repeated
three times, and changes of >0.5 log unit were highly significant
(
P < 0.05) for all inhibitors studied. The same 4-log-unit
scale was used for different inhibitors to facilitate comparison
of major changes in inhibitor sensitivity. Figure
2B and C show
that Env mutants that retained entry function via CCR5 were
generally more sensitive to inhibition by both PSC-RANTES and
TAK-779. In particular, mutation 5 (P313R) at the crown of the
V3 loop, alone or in combination with the C2 region mutations,
significantly increased susceptibility to both CCR5 inhibitors.
The ability of the nAb b12-IgG (directed at the CD4 binding
site) or 4E10 (directed at the membrane-proximal domain of gp41)
to inhibit entry mediated by the mutated Envs is shown in Fig.
2D and E. Sensitivity to b12-IgG inhibition was more variable,
with the majority of mutations causing increased sensitivity.
However, mutation 5 and mutations 2 plus 5 (P313R and A221T
plus P313R) increased resistance to b12-IgG. Sensitivity to
4E10 inhibition increased for most mutated Envs and was unchanged
for the remainder. Figure
2F shows the change in sensitivity
of the mutated Envs to inhibition by CD4-IgG. There was less
than a 0.5-log-unit change for most of the Envs, with two mutants
showing increased sensitivity and two showing decreased sensitivity
by greater than 0.5 log unit. The mutant 2 plus 5 (A221T plus
P313R), which was more resistant to b12-IgG, was also more resistant
to CD4-IgG, confirming that these two mutations diminished access
to the CD4 binding site.
Mutated ADA Envs with weak or strong entry function on CXCR4-expressing
target cells were evaluated for sensitivity to AMD3100, as well
as nAb and CD4-IgG. Data were expressed as the mean IC
50 ±
SE of three replicate experiments, with the IC50 value for the
nAb and CD4-IgG for ADA wt Env on CCR5 target cells shown for
reference. All Env mutants were equally or more sensitive to
AMD3100 inhibition than the final ADA-1 Env with all seven mutations
(Fig.
3A), but there was not a clear correlation between entry
efficiency via CXCR4 and sensitivity to AMD3100 inhibition.
Sensitivity to b12-IgG varied by almost 3 log units, with the
final ADA-1 mutant among the most sensitive to inhibition. Note
that the Env with mutations 1 plus 4 (N197D plus S306R) was
highly susceptible to b12-IgG inhibition on CCR5 target cells
(Fig.
2D) but not so susceptible on CXCR4 target cells, implying
that the choice of coreceptor impacts the neutralization sensitivity
of the same R5X4 Env. The same mutated Env was the most sensitive
to both 4E10 nAb and CD4-IgG inhibition of CXCR4-mediated entry
(Fig.
2C and D). All Env mutations increased sensitivity to
4E10 or CD4-IgG inhibition compared to ADA wt Env on CCR5 target
cells (Fig.
2C and D), but several of the mutated Envs were
more resistant to both inhibitors than the final ADA-1 mutant.
Functional changes in ADA-3 Env during the transition from R5 to R5X4.
Similar inhibition studies were performed with Env mutations involved in the R5-to-R5X4 evolution of the ADA-3 mutant (Fig. 1 and Table 1). As before, pseudovirion concentrations were adjusted to yield nearly equal levels of infection to correct for the varying levels of infectivity shown in Fig. 4A. Note that only mutant ADA-3, with all five Env mutations (Table 1), was capable of strong infection of CXCR4 target cells. The mutations in V2 tended to either decrease susceptibility to the CCR5 inhibitors or cause no change, whereas many of the combined V2 plus V3 mutations increased susceptibility to PSC-RANTES and, to a greater extent, TAK-779 (Fig. 4B and C). The sensitivities of the mutated Envs to b12-IgG were more variable, with V2 plus V3 mutations either increasing sensitivity by 1 log unit in three instances or decreasing sensitivity by 0.8 log unit in one instance (Fig. 4D). However, sensitivities to the nAb 4E10 were uniformly increased, with many mutated Envs showing a >0.5-log-unit decrease in IC50 values (Fig. 4E). All but one of the mutated Envs had increased resistance to CD4-IgG (Fig. 4F), with the Env with mutations 1, 2, and 5 (N160K, V181I, and E322K) showing the greatest increase in resistance to both CD4-IgG and b12-IgG (Fig. 4D and E).
Because most of the mutated Envs were poor at mediating entry
into CXCR4 target cells, we performed inhibition studies only
with AMD3100. The results are presented in Table
2 and show
an increase in resistance to AMD3100 inhibition as the CXCR4
entry function improved.
Impacts of ADA-3 envelope mutations on CD4 and CCR5 binding.
The efficiency of Env binding to CD4 or CCR5 (in the presence
of soluble CD4) was assayed by immunostaining of appropriate
target cells, as previously described (
46,
48). No mutation
significantly impaired the ability of Env to bind to CD4 (Fig.
5A), and several combinations of mutations significantly improved
CD4 binding. The combination of V3 mutation 5 (E322K) and either
V2 mutation 1 (N160K) or 2 (V181I) led to increased CD4 binding,
which was preserved in the ADA-3 envelope with all five mutations.
By contrast, several mutations on the pathway to improved CXCR4
use significantly decreased binding to CCR5 (Fig.
5B.) The V3
mutation 5 (E322K) alone reduced CCR5 binding substantially,
but this effect was countered by the introduction of either
the V2 mutation 1 (N160K) or 2 (V181I). As might have been predicted
from the single-round infection results (Fig.
4A), the combination
of all three V2 mutations led to increased CCR5 binding. Combining
these three V2 mutations with the V3 mutation 5 (E322K) led
to a significant reduction in CCR5 binding, indicating that
the negative impact of the V3 mutation outweighed the positive
benefits of the three V2 mutations. Binding of CCR5 was further
diminished by the introduction of all five mutations. There
was no consistent correlation between binding of CD4 and CCR5
and sensitivity to inhibition of infection of U87-CD4-CCR5 cells
by CD4-IgG (Fig.
4F). Mutations associated with the R5-to-R5X4
transition of ADA-3 thus generally improved CD4 binding and
increased resistance to CD4-IgG inhibition, and reduced binding
to CCR5 and increased sensitivity to CCR5 inhibitors.
Extent and kinetics of Env-mediated fusion.
On average, mutations associated with the R5-to-R5X4 evolution
of ADA-3 had relatively minor impacts on the extent of Env-mediated
fusion or the kinetics of fusion (Fig.
5C and D). The combination
of V2 mutation 1 (N160K) and V3 mutation 5 (E322K) accelerated
fusion kinetics by about twofold (Fig.
5C) but diminished the
extent of Env-mediated fusion with CCR5-expressing target cells
(Fig.
5D). The introduction of all five V2 and V3 mutations
slowed fusion kinetics with CCR5-expressing target cells by
about 50% and promoted the most efficient fusion with CXCR4-expressing
target cells (Fig.
5C and D). Compared to the major impact of
mutations in the coreceptor binding region of Env on the extent
of fusion and fusion kinetics (
48), mutations in V2 and V3 largely
preserved these Env-mediated functions. These results are also
consistent with CD4 binding having a larger impact on subsequent
fusion efficiency than CCR5 binding.
Functional changes in BaL-1B and BaL-2A during the transition from R5 to R5X4.
The two independent coreceptor switch mutants gained use of CXCR4 by five mutations in V2 and V3 (BaL-1B) or three mutations in V2 and V3 and one additional mutation in C5 (BaL-2A) (Table 1). By contrast with the ADA-derived coreceptor switch mutants, the two BaL-derived mutants maintained high entry function via CCR5 while gaining robust use of CXCR4. We were therefore interested to determine if they showed the same pattern of diminished binding to CCR5 and increased binding to CD4 as the ADA coreceptor switch intermediates discussed above.
Figure 6A summarizes the entry activities of the BaL-1B series of mutated Envs. Note that few mutations increased or decreased entry function >0.5 log unit, with the exception of two lethal combinations of mutations, 1 plus 4 and 2 plus 4 (A137T plus L317I and E178K plus L317I). Nonetheless, many of the Env mutations showed highly significant increased sensitivity to CCR5 inhibitors, with the final BaL-1B sequence with all five mutations being 2.75 log units (562-fold) more sensitive to TAK-779 than BaL wt Env (Fig. 6B and C). Many of the BaL-1B Env mutants were highly sensitive to entry inhibition by both b12-IgG and 4E10 nAb (Fig. 6D and E), and all Env mutants were more resistant to CD4-IgG inhibition than the parental BaL Env (Fig. 6F). When the functions of all the mutated Envs capable of CXCR4 use were tested on CXCR4-expressing target cells, similar results were seen. The sensitivity of nAb inhibition generally increased, and susceptibility to CD4-IgG inhibition decreased (Fig. 7B, C, and D). However, only a few of the BaL1-B mutated Envs were significantly more sensitive to AMD3100 inhibition than the final mutant with all five mutations. This may reflect the substantially better entry function of these Envs via CXCR4 than either ADA-1 or ADA-3 Envs (Fig. 1).
Figure
8 summarizes the impacts of the Env mutations resulting
in the BaL-2A coreceptor switch mutant. Mutation 4 in C2 had
little impact on Env function, so it was not examined in every
possible combination. The remaining mutations in V2 plus V3
resulted in less dramatic changes in sensitivity to inhibitors
than those seen with ADA-1, ADA-3, or BaL-1B, but similar trends
were observed. There were modest increases in susceptibility
to CCR5 inhibitors, particularly PSC-RANTES (Fig.
8B), and some
mutated Envs were more sensitive to b12-IgG. Only the final
BaL-2A mutant with all four mutations was significantly more
sensitive to 4E10 nAb, suggesting that the C5 mutation has some
impact on Env function (Fig.
8D and E). Finally, almost all
mutated Envs showed increased resistance to CD4-IgG inhibition
(Fig.
8F), although the increase was more than +0.5 log unit
for only two mutants in or adjacent to the V2 region (2 and
1 plus 2; E178K and N130D plus E178K).

DISCUSSION
HIV-1 evolved from primate lentiviruses that used CCR5 in a
CD4-independent manner (
3,
8,
21), so CCR5 may be viewed as
the primordial receptor, and adaptation to humans involved acquisition
of CD4 binding. The second step in adaptation to human hosts
was the ability to use CXCR4 as an additional or alternative
coreceptor, although this adaptation may be more evident in
subtype B and subtype D viruses than in some other subtypes
(
9,
34; W. Huang, S. Eshleman, J. Toma, S. Fransen, E. Stawiski,
B. Jackson, J. Whitcomb, N. Parkin, and C. J. Petropoulos, presented
at the 2nd International Workshop Targeting HIV Entry, Boston,
MA, October 20-21, 2006). The acquisition of CD4 binding can
be reasonably explained by selective pressure to hide the coreceptor
binding site from neutralizing antibody, since CD4-independent
isolates are generally more sensitive to neutralization (
15,
25,
32,
55). The switch in coreceptor preference from CCR5 to
CXCR4 is more difficult to explain, with the primary advantage
to the virus being the expansion of the target cell pool to
include naïve CD4
+ T cells that express very low levels
of CCR5 but higher levels of CXCR4 (
27,
56). However, the long
delay from infection until emergence of CXCR4-using variants,
their relatively low incidence in non-subtype B infections,
and their poor transmissibility (
29) all suggest that evolution
to CXCR4 use may be a dead-end pathway for the virus.
Prior studies from this laboratory have emphasized that the envelope mutations that drive coreceptor switching from CCR5 to CXCR4 reduce the fitness of switch intermediates (37, 39). It is possible that many poorly fit switch intermediates are generated in patients and are never detected because they fail to compete with larger and more robust R5 virus populations, even with the potential advantage of establishing infection of naïve CD4+ T cells. This would be consistent with the finding that coreceptor switch mutants selected in vitro often have few mutations (19, 39) while sequential isolates before and after coreceptor switching in patients have more dramatic sequence changes (31, 52, 56). The primary goal of the present study was to determine if potential coreceptor switch intermediates gained any functional properties that would aid their survival during the evolution from CCR5 to CXCR4 use. For example, there are prior studies indicating that the level of CD4 expression impacts the efficiency of CCR5 use (44), and it is possible that reduced binding to CCR5 is compensated for by increased binding to CD4 (42).
The changes in Env properties for the four coreceptor switch pathways analyzed are summarized in Table 3. We infer that increased sensitivity to CCR5 inhibitors reflects reduced binding to CCR5, an assumption validated for ADA-3 mutants (Fig. 5). Almost all mutated Envs with V3 substitutions had increased sensitivity to both PSC-RANTES and TAK-779, CCR5 inhibitors with two distinct modes of action (20, 26, 38). This was true even for the BaL-1B pathway that led to improved use of CCR5 compared to the parental BaL Env. It may not be surprising that Env mutations that allow some level of CXCR4 use come at the expense of CCR5 use, but the entry activity on CCR5-expressing target cells may not be impacted until the CCR5 binding affinity falls below a threshold required for productive infection (24, 40). Our data suggest that the threefold-less-efficient entry mediated by the ADA Env compared to the BaL Env may put the ADA Env mutants closer to this threshold. The evolutionary pathway of the ADA-1 mutant from pure R5 to pure X4 phenotype is littered with nonfunctional Envs (Fig. 2A) (37), suggesting that abandoning CCR5 use entirely is perilous. This is consistent with the small fraction of patient isolates that type as pure X4 viruses using similar entry assays (5, 36). Env mutants representing intermediate stages of gaining CXCR4 use were generally highly sensitive to AMD3100 inhibition. This implies that efficient use of CXCR4 is generally dependent upon several Env mutations, as is most obvious for the ADA-3 series of mutations (Table 2).
Most pathways of Env evolution led to apparent increased binding
to CD4, as directly measured for ADA-3 Env mutants (Fig.
5A)
and inferred by increasing resistance to inhibition of entry
by CD4-IgG for most other Env mutants (Table
3). Only the ADA-1
series of Env mutants did not show consistent increases in apparent
CD4 binding affinity, but this may reflect the smaller selection
of functional Env clones remaining after elimination of the
nonfunctional mutants. Increased binding to CD4 has been observed
during adaptation of HIV-1 IIIB to replication in infected laboratory
workers (
33), as well as laboratory adaptation of patient isolates
to growth in T-cell lines (
23). All four coreceptor switch mutants
studied here were initially selected for growth on U87-CD4-CXCR4
cells that have abundant CD4, but they were subsequently passaged
on MT-2 cells with lower levels of CD4 (
39). However, the nearly
uniform increase in apparent CD4 binding of all mutant Envs
representing intermediate stages of coreceptor switching implies
that improved CD4 binding is a necessary prerequisite for subsequent
improvements in CXCR4 binding. This would be compatible with
a model in which the loss of CCR5 binding is compensated for
by a gain in CD4 binding prior to or during improved CXCR4 binding.
We have previously shown that the Env mutations studied here lead to different patterns of chimeric coreceptor use, with binding to the second extracellular domain (EC2) of CXCR4 being the most common event during coreceptor switching (37). The hypothesis that mutations in V3 and at other sites in Env can cause differential engagement of CCR5 extracellular domains has received support from several studies (41, 43, 45). One can envision a multistep coreceptor-switching process in which Env binding to CCR5 EC2 is initially disrupted but binding to the CCR5 N-terminal domain is preserved, followed by mutations that allow improved engagement of CXCR4 EC2, and finally binding to multiple CXCR4 extracellular domains. A similar, if somewhat simpler, model has been proposed by Lu et al. (30) based on studies with CXCR4-CXCR2 chimeric coreceptors. It is also possible that other cell surface attachment receptors, e.g., proteoglycans, can contribute to Env binding and support the survival of coreceptor switch intermediates with poor affinity for either CCR5 or CXCR4 (12, 35, 51), although these impacts may be limited to infection of selected cell types. Improved CD4 binding of these postulated coreceptor switch intermediates could serve two functions: (i) to enhance the entry function of intermediates with poor binding to both CCR5 and CXCR4 and (ii) to protect more exposed coreceptor binding sites from immune recognition. The finding that many of the coreceptor switch intermediates were more sensitive to neutralizing antibodies suggests that autologous neutralizing antibodies could select against early R5X4 viruses and be one factor in the long delay preceding the emergence of X4 variants in patients.

ACKNOWLEDGMENTS
We thank Phillip Arca and Fang-Hua Lee for assistance with cloning
and sequence analysis.
This work was supported by NIH grant AI058701 and amfAR fellowship 106437-34-RFGN (J.D.R.), NIH grant AI051649 and Swiss National Science Foundation grant 3100A0-110042 (O.H.), and NIH grants AI052778 and AI051649 and The James B. Pendleton Charitable Trust (D.E.M.).
This is publication number 17989-IMM from The Scripps Research Institute.

FOOTNOTES
* Corresponding author. Mailing address: Department of ImmunologyIMM7, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA 92037. Phone: (858) 784-9121. Fax: (858) 784-9190. E-mail:
dmosier{at}scripps.edu 
Published ahead of print on 16 May 2007. 
Present address: Monogram Biosciences, 345 Oyster Point Blvd., South San Francisco, CA 94080. 

REFERENCES
1 - Alexander, W. A., B. Moss, and T. R. Fuerst. 1992. Regulated expression of foreign genes in vaccinia virus under the control of bacteriophage T7 RNA polymerase and the Escherichia coli lac repressor. J. Virol. 66:2934-2942.[Abstract/Free Full Text]
2 - Baba, M., O. Nishimura, N. Kanzaki, M. Okamoto, H. Sawada, Y. Iizawa, M. Shiraishi, Y. Aramaki, K. Okonogi, Y. Ogawa, K. Meguro, and M. Fujino. 1999. A small-molecule, nonpeptide CCR5 antagonist with highly potent and selective anti-HIV-1 activity. Proc. Natl. Acad. Sci. USA 96:5698-5703.[Abstract/Free Full Text]
3 - Bhattacharya, J., P. J. Peters, and P. R. Clapham. 2003. CD4-independent infection of HIV and SIV: implications for envelope conformation and cell tropism in vivo. Aids 17(Suppl. 4):S35-S43.[CrossRef][Medline]
4 - Bjorndal, A., H. Deng, M. Jansson, J. R. Fiore, C. Colognesi, A. Karlsson, J. Albert, G. Scarlatti, D. R. Littman, and E. M. Fenyo. 1997. Coreceptor usage of primary human immunodeficiency virus type 1 isolates varies according to biological phenotype. J. Virol. 71:7478-7487.[Abstract]
5 - Brumme, Z. L., J. Goodrich, H. B. Mayer, C. J. Brumme, B. M. Henrick, B. Wynhoven, J. J. Asselin, P. K. Cheung, R. S. Hogg, J. S. Montaner, and P. R. Harrigan. 2005. Molecular and clinical epidemiology of CXCR4-using HIV-1 in a large population of antiretroviral-naive individuals. J. Infect. Dis. 192:466-474.[CrossRef][Medline]
6 - Burton, D. R., J. Pyati, R. Koduri, S. J. Sharp, G. B. Thornton, P. W. Parren, L. S. Sawyer, R. M. Hendry, N. Dunlop, P. L. Nara, M. Lamacchia, E. Garratty, E. R. Stiehm, Y. J. Bryson, Y. Cao, J. P. Moore, D. Ho, and C. F. Barbas. 1994. Efficient neutralization of primary isolates of HIV-1 by a recombinant human monoclonal antibody. Science 266:1024-1027.[Abstract/Free Full Text]
7 - Cardoso, R. M., M. B. Zwick, R. L. Stanfield, R. Kunert, J. M. Binley, H. Katinger, D. R. Burton, and I. A. Wilson. 2005. Broadly neutralizing anti-HIV antibody 4E10 recognizes a helical conformation of a highly conserved fusion-associated motif in gp41. Immunity 22:163-173.[CrossRef][Medline]
8 - Chen, Z., A. Gettie, D. D. Ho, and P. A. Marx. 1998. Primary SIVsm isolates use the CCR5 coreceptor from sooty mangabeys naturally infected in West Africa: a comparison of coreceptor usage of primary SIVsm, HIV-2, and SIVmac. Virology 246:113-124.[CrossRef][Medline]
9 - Cilliers, T., J. Nhlapo, M. Coetzer, D. Orlovic, T. Ketas, W. C. Olson, J. P. Moore, A. Trkola, and L. Morris. 2003. The CCR5 and CXCR4 coreceptors are both used by human immunodeficiency virus type 1 primary isolates from subtype C. J. Virol. 77:4449-4456.[Abstract/Free Full Text]
10 - Connor, R. I., B. K. Chen, S. Choe, and N. R. Landau. 1995. Vpr is required for efficient replication of human immunodeficiency virus type-1 in mononuclear phagocytes. Virology 206:935-944.[CrossRef][Medline]
11 - Deng, H. K., D. Unutmaz, V. N. KewalRamani, and D. R. Littman. 1997. Expression cloning of new receptors used by simian and human immunodeficiency viruses. Nature 388:296-300.[CrossRef][Medline]
12 - de Parseval, A., M. D. Bobardt, A. Chatterji, U. Chatterji, J. H. Elder, G. David, S. Zolla-Pazner, M. Farzan, T. H. Lee, and P. A. Gallay. 2005. A highly conserved arginine in gp120 governs HIV-1 binding to both syndecans and CCR5 via sulfated motifs. J. Biol. Chem. 280:39493-39504.[Abstract/Free Full Text]
13 - Donzella, G. A., D. Schols, S. W. Lin, J. A. Este, K. A. Nagashima, P. J. Maddon, G. P. Allaway, T. P. Sakmar, G. Henson, E. De Clercq, and J. P. Moore. 1998. AMD3100, a small molecule inhibitor of HIV-1 entry via the CXCR4 co-receptor. Nat. Med. 4:72-77.[CrossRef][Medline]
14 - Draenert, R., T. M. Allen, Y. Liu, T. Wrin, C. Chappey, C. L. Verrill, G. Sirera, R. L. Eldridge, M. P. Lahaie, L. Ruiz, B. Clotet, C. J. Petropoulos, B. D. Walker, and J. Martinez-Picado. 2006. Constraints on HIV-1 evolution and immunodominance revealed in monozygotic adult twins infected with the same virus. J. Exp. Med. 203:529-539.[Abstract/Free Full Text]
15 - Edwards, T. G., T. L. Hoffman, F. Baribaud, S. Wyss, C. C. LaBranche, J. Romano, J. Adkinson, M. Sharron, J. A. Hoxie, and R. W. Doms. 2001. Relationships between CD4 independence, neutralization sensitivity, and exposure of a CD4-induced epitope in a human immunodeficiency virus type 1 envelope protein. J. Virol. 75:5230-5239.[Abstract/Free Full Text]
16 - Edwards, T. G., S. Wyss, J. D. Reeves, S. Zolla-Pazner, J. A. Hoxie, R. W. Doms, and F. Baribaud. 2002. Truncation of the cytoplasmic domain induces exposure of conserved regions in the ectodomain of human immunodeficiency virus type 1 envelope protein. J. Virol. 76:2683-2691.[Abstract/Free Full Text]
17 - Gonzalez, E., H. Kulkarni, H. Bolivar, A. Mangano, R. Sanchez, G. Catano, R. J. Nibbs, B. I. Freedman, M. P. Quinones, M. J. Bamshad, K. K. Murthy, B. H. Rovin, W. Bradley, R. A. Clark, S. A. Anderson, J. R. O'Connell, B. K. Agan, S. S. Ahuja, R. Bologna, L. Sen, M. J. Dolan, and S. K. Ahuja. 2005. The influence of CCL3L1 gene-containing segmental duplications on HIV-1/AIDS susceptibility. Science 307:1434-1440.[Abstract/Free Full Text]
18 - Hahn, B. H., G. M. Shaw, K. M. De Cock, and P. M. Sharp. 2000. AIDS as a zoonosis: scientific and public health implications. Science 287:607-614.[Abstract/Free Full Text]
19 - Harrowe, G., and C. Cheng-Mayer. 1995. Amino acid substitutions in the V3 loop are responsible for adaptation to growth in transformed T-cell lines of a primary human immunodeficiency virus type 1. Virology 210:490-494.[CrossRef][Medline]
20 - Hartley, O., H. Gaertner, J. Wilken, D. Thompson, R. Fish, A. Ramos, C. Pastore, B. Dufour, F. Cerini, A. Melotti, N. Heveker, L. Picard, M. Alizon, D. Mosier, S. Kent, and R. Offord. 2004. Medicinal chemistry applied to a synthetic protein: development of highly potent HIV entry inhibitors. Proc. Natl. Acad. Sci. USA 101:16460-16465.[Abstract/Free Full Text]
21 - Hartley, O., P. J. Klasse, Q. J. Sattentau, and J. P. Moore. 2005. V3: HIV's switch-hitter. AIDS Res. Hum. Retrovir. 21:171-189.[CrossRef][Medline]
22 - Hunt, P. W., P. R. Harrigan, W. Huang, M. Bates, D. W. Williamson, J. M. McCune, R. W. Price, S. S. Spudich, H. Lampiris, R. Hoh, T. Leigler, J. N. Martin, and S. G. Deeks. 2006. Prevalence of CXCR4 tropism among antiretroviral-treated HIV-1-infected patients with detectable viremia. J. Infect. Dis. 194:926-930.[CrossRef][Medline]
23 - Kozak, S. L., E. J. Platt, N. Madani, F. E. Ferro, Jr., K. Peden, and D. Kabat. 1997. CD4, CXCR-4, and CCR-5 dependencies for infections by primary patient and laboratory-adapted isolates of human immunodeficiency virus type 1. J. Virol. 71:873-882.[Abstract]
24 - Kuhmann, S. E., E. J. Platt, S. L. Kozak, and D. Kabat. 2000. Cooperation of multiple CCR5 coreceptors is required for infections by human immunodeficiency virus type 1. J. Virol. 74:7005-7015.[Abstract/Free Full Text]
25 - Labrijn, A. F., P. Poignard, A. Raja, M. B. Zwick, K. Delgado, M. Franti, J. Binley, V. Vivona, C. Grundner, C. C. Huang, M. Venturi, C. J. Petropoulos, T. Wrin, D. S. Dimitrov, J. Robinson, P. D. Kwong, R. T. Wyatt, J. Sodroski, and D. R. Burton. 2003. Access of antibody molecules to the conserved coreceptor binding site on glycoprotein gp120 is sterically restricted on primary human immunodeficiency virus type 1. J. Virol. 77:10557-10565.[Abstract/Free Full Text]
26 - Lagane, B., S. Ballet, T. Planchenault, K. Balabanian, E. Le Poul, C. Blanpain, Y. Percherancier, I. Staropoli, G. Vassart, M. Oppermann, M. Parmentier, and F. Bachelerie. 2005. Mutation of the DRY motif reveals different structural requirements for the CC chemokine receptor 5-mediated signaling and receptor endocytosis. Mol. Pharmacol. 67:1966-1976.[Abstract/Free Full Text]
27 - Lee, B., M. Sharron, L. J. Montaner, D. Weissman, and R. W. Doms. 1999. Quantification of CD4, CCR5, and CXCR4 levels on lymphocyte subsets, dendritic cells, and differentially conditioned monocyte-derived macrophages. Proc. Natl. Acad. Sci. USA 96:5215-5220.[Abstract/Free Full Text]
28 - Lineberger, J. E., R. Danzeisen, D. J. Hazuda, A. J. Simon, and M. D. Miller. 2002. Altering expression levels of human immunodeficiency virus type 1 gp120-gp41 affects efficiency but not kinetics of cell-cell fusion. J. Virol. 76:3522-3533.[Abstract/Free Full Text]
29 - Long, E. M., S. M. Rainwater, L. Lavreys, K. Mandaliya, and J. Overbaugh. 2002. HIV type 1 variants transmitted to women in Kenya require the CCR5 coreceptor for entry, regardless of the genetic complexity of the infecting virus. AIDS Res. Hum. Retrovir. 18:567-576.[CrossRef][Medline]
30 - Lu, Z., J. F. Berson, Y. Chen, J. D. Turner, T. Zhang, M. Sharron, M. H. Jenks, Z. Wang, J. Kim, J. Rucker, J. A. Hoxie, S. C. Peiper, and R. W. Doms. 1997. Evolution of HIV-1 coreceptor usage through interactions with distinct CCR5 and CXCR4 domains. Proc. Natl. Acad. Sci. USA 94:6426-6431.[Abstract/Free Full Text]
31 - Lukashov, V. V., and J. Goudsmit. 1997. Evolution of the human immunodeficiency virus type 1 subtype-specific V3 domain is confined to a sequence space with a fixed distance to the subtype consensus. J. Virol. 71:6332-6338.[Abstract]
32 - Lusso, P., P. L. Earl, F. Sironi, F. Santoro, C. Ripamonti, G. Scarlatti, R. Longhi, E. A. Berger, and S. E. Burastero. 2005. Cryptic nature of a conserved, CD4-inducible V3 loop neutralization epitope in the native envelope glycoprotein oligomer of CCR5-restricted, but not CXCR4-using, primary human immunodeficiency virus type 1 strains. J. Virol. 79:6957-6968.[Abstract/Free Full Text]
33 - Miller, E. D., K. M. Duus, M. Townsend, Y. Yi, R. Collman, M. Reitz, and L. Su. 2001. Human immunodeficiency virus type 1 IIIB selected for replication in vivo exhibits increased envelope glycoproteins in virions without alteration in coreceptor usage: separation of in vivo replication from macrophage tropism. J. Virol. 75:8498-8506.[Abstract/Free Full Text]
34 - Morris, L., T. Cilliers, H. Bredell, M. Phoswa, and D. J. Martin. 2001. CCR5 is the major coreceptor used by HIV-1 subtype C isolates from patients with active tuberculosis. AIDS Res. Hum. Retrovir. 17:697-701.[CrossRef][Medline]
35 - Moulard, M., H. Lortat-Jacob, I. Mondor, G. Roca, R. Wyatt, J. Sodroski, L. Zhao, W. Olson, P. D. Kwong, and Q. J. Sattentau. 2000. Selective interactions of polyanions with basic surfaces on human immunodeficiency virus type 1 gp120. J. Virol. 74:1948-1960.[Abstract/Free Full Text]
36 - Moyle, G. J., A. Wildfire, S. Mandalia, H. Mayer, J. Goodrich, J. Whitcomb, and B. G. Gazzard. 2005. Epidemiology and predictive factors for chemokine receptor use in HIV-1 infection. J. Infect. Dis. 191:866-872.[CrossRef][Medline]
37 - Pastore, C., R. Nedellec, A. Ramos, S. Pontow, L. Ratner, and D. E. Mosier. 2006. Human immunodeficiency virus type 1 coreceptor switching: V1/V2 gain-of-fitness mutations compensate for V3 loss-of-fitness mutations. J. Virol. 80:750-758.[Abstract/Free Full Text]
38 - Pastore, C., G. R. Picchio, F. Galimi, R. Fish, O. Hartley, R. E. Offord, and D. E. Mosier. 2003. Two mechanisms for human immunodeficiency virus type 1 inhibition by N-terminal modifications of RANTES. Antimicrob. Agents Chemother. 47:509-517.[Abstract/Free Full Text]
39 - Pastore, C., A. Ramos, and D. E. Mosier. 2004. Intrinsic obstacles to human immunodeficiency virus type 1 coreceptor switching. J. Virol. 78:7565-7574.[Abstract/Free Full Text]
40 - Platt, E. J., J. P. Durnin, and D. Kabat. 2005. Kinetic factors control efficiencies of cell entry, efficacies of entry inhibitors, and mechanisms of adaptation of human immunodeficiency virus. J. Virol. 79:4347-4356.[Abstract/Free Full Text]
41 - Platt, E. J., S. E. Kuhmann, P. P. Rose, and D. Kabat. 2001. Adaptive mutations in the V3 loop of gp120 enhance fusogenicity of human immunodeficiency virus type 1 and enable use of a CCR5 coreceptor that lacks the amino-terminal sulfated region. J. Virol. 75:12266-12278.[Abstract/Free Full Text]
42 - Platt, E. J., N. Madani, S. L. Kozak, and D. Kabat. 1997. Infectious properties of human immunodeficiency virus type 1 mutants with distinct affinities for the CD4 receptor. J. Virol. 71:883-890.[Abstract]
43 - Platt, E. J., D. M. Shea, P. P. Rose, and D. Kabat. 2005. Variants of human immunodeficiency virus type 1 that efficiently use CCR5 lacking the tyrosine-sulfated amino terminus have adaptive mutations in gp120, including loss of a functional N-glycan. J. Virol. 79:4357-4368.[Abstract/Free Full Text]
44 - Platt, E. J., K. Wehrly, S. E. Kuhmann, B. Chesebro, and D. Kabat. 1998. Effects of CCR5 and CD4 cell surface concentrations on infections by macrophage-tropic isolates of human immunodeficiency virus type 1. J. Virol. 72:2855-2864.[Abstract/Free Full Text]
45 - Pontow, S., and L. Ratner. 2001. Evidence for common structural determinants of human immunodeficiency virus type 1 coreceptor activity provided through functional analysis of CCR5/CXCR4 chimeric coreceptors. J. Virol. 75:11503-11514.[Abstract/Free Full Text]
46 - Reeves, J. D., S. A. Gallo, N. Ahmad, J. L. Miamidian, P. E. Harvey, M. Sharron, S. Pohlmann, J. N. Sfakianos, C. A. Derdeyn, R. Blumenthal, E. Hunter, and R. W. Doms. 2002. Sensitivity of HIV-1 to entry inhibitors correlates with envelope/coreceptor affinity, receptor density, and fusion kinetics. Proc. Natl. Acad. Sci. USA 99:16249-16254.[Abstract/Free Full Text]
47 - Reeves, J. D., A. McKnight, S. Potempa, G. Simmons, P. W. Gray, C. A. Power, T. Wells, R. A. Weiss, and S. J. Talbot. 1997. CD4-independent infection by HIV-2 (ROD/B): use of the 7-transmembrane receptors CXCR-4, CCR-3, and V28 for entry. Virology 231:130-134.[CrossRef][Medline]
48 - Reeves, J. D., J. L. Miamidian, M. J. Biscone, F. H. Lee, N. Ahmad, T. C. Pierson, and R. W. Doms. 2004. Impact of mutations in the coreceptor binding site on human immunodeficiency virus type 1 fusion, infection, and entry inhibitor sensitivity. J. Virol. 78:5476-5485.[Abstract/Free Full Text]
49 - Reeves, J. D., and T. F. Schulz. 1997. The CD4-independent tropism of human immunodeficiency virus type 2 involves several regions of the envelope protein and correlates with a reduced activation threshold for envelope-mediated fusion. J. Virol. 71:1453-1465.[Abstract]
50 - Rucker, J., B. J. Doranz, A. L. Edinger, D. Long, J. F. Berson, and R. W. Doms. 1997. Cell-cell fusion assay to study role of chemokine receptors in human immunodeficiency virus type 1 entry. Methods Enzymol. 288:118-133.[Medline]
51 - Saphire, A. C., M. D. Bobardt, Z. Zhang, G. David, and P. A. Gallay. 2001. Syndecans serve as attachment receptors for human immunodeficiency virus type 1 on macrophages. J. Virol. 75:9187-9200.[Abstract/Free Full Text]
52 - Shankarappa, R., J. B. Margolick, S. J. Gange, A. G. Rodrigo, D. Upchurch, H. Farzadegan, P. Gupta, C. R. Rinaldo, G. H. Learn, X. He, X. L. Huang, and J. I. Mullins. 1999. Consistent viral evolutionary changes associated with the progression of human immunodeficiency virus type 1 infection. J. Virol. 73:10489-10502.[Abstract/Free Full Text]
53 - Soda, Y., N. Shimizu, A. Jinno, H. Y. Liu, K. Kanbe, T. Kitamura, and H. Hoshino. 1999. Establishment of a new system for determination of coreceptor usages of HIV based on the human glioma NP-2 cell line. Biochem. Biophys. Res. Commun. 258:313-321.[CrossRef][Medline]
54 - Sullivan, N., Y. Sun, J. Li, W. Hofmann, and J. Sodroski. 1995. Replicative function and neutralization sensitivity of envelope glycoproteins from primary and T-cell line-passaged human immunodeficiency virus type 1 isolates. J. Virol. 69:4413-4422.[Abstract]
55 - Sullivan, N., Y. Sun, Q. Sattentau, M. Thali, D. Wu, G. Denisova, J. Gershoni, J. Robinson, J. Moore, and J. Sodroski. 1998. CD4-induced conformational changes in the human immunodeficiency virus type 1 gp120 glycoprotein: consequences for virus entry and neutralization. J. Virol. 72:4694-4703.[Abstract/Free Full Text]
56 - van Rij, R. P., H. Blaak, J. A. Visser, M. Brouwer, R. Rientsma, S. Broersen, A. M. de Roda Husman, and H. Schuitemaker. 2000. Differential coreceptor expression allows for independent evolution of non-syncytium-inducing and syncytium-inducing HIV-1. J. Clin. Investig. 106:1039-1052.[Medline]
57 - Westby, M., M. Lewis, J. Whitcomb, M. Youle, A. L. Pozniak, I. T. James, T. M. Jenkins, M. Perros, and E. van der Ryst. 2006. Emergence of CXCR4-using human immunodeficiency virus type 1 (HIV-1) variants in a minority of HIV-1-infected patients following treatment with the CCR5 antagonist maraviroc is from a pretreatment CXCR4-using virus reservoir. J. Virol. 80:4909-4920.[Abstract/Free Full Text]
58 - Williams, C. F., D. Klinzman, T. E. Yamashita, J. Xiang, P. M. Polgreen, C. Rinaldo, C. Liu, J. Phair, J. B. Margolick, D. Zdunek, G. Hess, and J. T. Stapleton. 2004. Persistent GB virus C infection and survival in HIV-infected men. N. Engl. J. Med. 350:981-990.[Abstract/Free Full Text]
59 - Yamanaka, R., R. Tanaka, and S. Yoshida. 1993. Effects of irradiation on cytokine production in glioma cell lines. Neurol. Med. Chir. 33:744-748.
Journal of Virology, August 2007, p. 8165-8179, Vol. 81, No. 15
0022-538X/07/$08.00+0 doi:10.1128/JVI.02792-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Nedellec, R., Coetzer, M., Shimizu, N., Hoshino, H., Polonis, V. R., Morris, L., Martensson, U. E. A., Binley, J., Overbaugh, J., Mosier, D. E.
(2009). Virus Entry via the Alternative Coreceptors CCR3 and FPRL1 Differs by Human Immunodeficiency Virus Type 1 Subtype. J. Virol.
83: 8353-8363
[Abstract]
[Full Text]
-
Coetzer, M., Nedellec, R., Salkowitz, J., McLaughlin, S., Liu, Y., Heath, L., Mullins, J. I., Mosier, D. E.
(2008). Evolution of CCR5 Use before and during Coreceptor Switching. J. Virol.
82: 11758-11766
[Abstract]
[Full Text]
-
Tasca, S., Ho, S.-H., Cheng-Mayer, C.
(2008). R5X4 Viruses Are Evolutionary, Functional, and Antigenic Intermediates in the Pathway of a Simian-Human Immunodeficiency Virus Coreceptor Switch. J. Virol.
82: 7089-7099
[Abstract]
[Full Text]
-
Huang, W., Toma, J., Fransen, S., Stawiski, E., Reeves, J. D., Whitcomb, J. M., Parkin, N., Petropoulos, C. J.
(2008). Coreceptor Tropism Can Be Influenced by Amino Acid Substitutions in the gp41 Transmembrane Subunit of Human Immunodeficiency Virus Type 1 Envelope Protein. J. Virol.
82: 5584-5593
[Abstract]
[Full Text]