Previous Article | Next Article ![]()
Journal of Virology, July 2007, p. 7683-7694, Vol. 81, No. 14
0022-538X/07/$08.00+0 doi:10.1128/JVI.02839-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
B in Human Cytomegalovirus-Mediated Monocyte Diapedesis and Adhesion: Strategy for Viral Persistence
Department of Microbiology and Immunology,1 Center for Molecular and Tumor Virology,2 and Feist-Weiller Cancer Center, Louisiana State University Health Sciences Center, Shreveport, Louisiana 71130-39323
Received 21 December 2006/ Accepted 7 May 2007
|
|
|---|
B activities were crucial for the HCMV induction of monocyte motility and firm adhesion to endothelial cells. We found that the ß1 integrins, the ß2 integrins, intracellular adhesion molecule 1 (ICAM-1), and ICAM-3 were upregulated following HCMV infection and that they played a key role in the firm adhesion of infected monocytes to the endothelium. The viral regulation of adhesion molecule expression is complex, with PI(3)K and NF-
B affecting the expression of each adhesion molecule at different stages of the expression cascade. Our data demonstrate key roles for PI(3)K and NF-
B signaling in the HCMV-induced cellular changes in monocytes and identify the biological rationale for the activation of these pathways in infected monocytes, which together suggest a mechanism for how HCMV promotes viral spread to and persistence within host organs. |
|
|---|
The association of HCMV with a wide range of pathological complications is due to the ability of the virus to spread to multiple organ systems (43). HCMV dissemination to organ tissue occurs during both symptomatic and asymptomatic infections and is preceded by and dependent on a cell-associated viremia (42, 44, 52). Aside from aspects of HCMV disease, HCMV hematogenous dissemination is a critical facet of the viral life cycle in that it is a prerequisite for the establishment of viral persistence in organ tissue, latency in the bone marrow, and spread to additional hosts through viral secretion in bodily fluids (42, 45).
We previously provided evidence that monocytes serve as "Trojan horses" to promote the hematogenous dissemination of HCMV and began to dissect the mechanisms by which HCMV manipulates these cells, allowing for this spread from the blood (45, 46). Our studies documented that primary HCMV infection of peripheral blood monocytes, which are nonpermissive for viral gene expression, induced their transendothelial migration and monocyte-to-macrophage differentiation and that these HCMV-differentiated macrophages became productive for the replication of the original input virus at 3 to 4 weeks postinfection (45, 46). From these data, we proposed the following model for the hematogenous spread of the virus: monocytes are infected in the blood and carry the virus to various organ systems during their migration out of the blood; once the monocytes enter organ tissue, they differentiate into macrophages, which in turn stimulates viral replication and the "viral seeding" of host organ tissue. This proposed role for monocytes in HCMV dissemination is supported by in vivo studies. For instance, monocytes have been shown to be the primary cell type infected during HCMV-associated viremia (51) and to be the predominant infiltrating cell type at sites of infection (6). It has also been shown in mice and rats that intravenous injection of monocytes infected ex vivo with mouse and rat CMV, respectively, results in organ dissemination (48, 54). Finally, it has been shown that infected macrophages can be found in multiple host organs following viremia in seropositive hosts (28, 42).
Due to this role that monocytes play in viral spread and persistence, it is critical to understand how HCMV manipulates their function and promotes the cellular changes associated with viral dissemination. Because monocytes are nonpermissive for HCMV gene expression, HCMV must induce cellular changes through activation of cellular signal transduction pathways during the viral attachment/entry or the postentry process (7, 59). Evidence suggests that viral binding to the cell surface is the principal mediator of signal transduction in nonpermissive cell types (58) and that the major HCMV glycoproteins initiate signal transduction events through the ligation of receptors, including epidermal growth factor receptor (57),
2ß1 integrin (17),
6ß1 integrin (17),
vß3 integrin (17, 56), and Toll-like receptor 2 (5, 10).
In our investigation of cellular signal transduction pathways activated in human peripheral blood monocytes by HCMV, we found that HCMV activates both NF-
B (58) and phosphatidylinositol 3-kinase [PI(3)K] (46) in monocytes. We further demonstrated that NF-
B activation led to enhanced inflammatory cytokine production in monocytes (58). In regard to PI(3)K activity, we found that activation of this pathway was essential for the viral induction of transendothelial migration, motility, and chemokine production in monocytes (46). These studies suggest that the HCMV-induced cellular changes involved in transendothelial migration occur through the perturbation of cellular signal transduction pathways. In addition to its role as a central facet in the viral life cycle, we propose that HCMV-induced activation of monocytes is a critical element involved in the development of HCMV-associated chronic inflammatory diseases. Specifically, the aberrant induction of transendothelial migration, chemokine production, and proinflammatory-cytokine production could promote the pathogenesis associated with HCMV infection.
Because the early events regulating transendothelial migration of monocytes "set the stage" for both viral spread and the promotion of HCMV-associated inflammatory diseases, we focused this investigation on the viral upregulation of adhesion molecule expression in order to decipher the mechanisms involved in the enhancement of the transendothelial migration of infected monocytes. We specifically examined the viral regulation of ß1 integrins, ß2 integrins, intracellular adhesion molecule 1 (ICAM-1) (CD54), and ICAM-3 (CD50) due to their roles in the early events in transendothelial migration (30, 36). Furthermore, we wanted to elucidate the signal transduction pathways responsible for the changes in HCMV-induced monocyte migration. To accomplish this goal, we investigated how NF-
B and PI(3)K activities mediate changes in monocyte diapedesis, firm adhesion, and adhesion molecule expression.
Integrins are heterodimeric receptors composed of an
subunit noncovalently associated with a ß subunit (30). Integrins are recognized as the dominant cell adhesion receptors involved in firm adhesion of monocytes to endothelial cells and to extracellular matrix (ECM) components (3). Peripheral blood monocytes primarily express the ß1 (CD29) and ß2 (CD18) integrin subunits (13, 15), which predominately form the following heterodimeric integrin molecules in monocytes: CD49d/CD29 (
4ß1; VLA-4), CD49e/CD29 (
5ß1; VLA-5), CD49f/CD29 (
6ß1; VLA-6), CD11a/CD18 (
Lß2; LFA-1), CD11b/CD18 (
Mß2; Mac1; CR3), and CD11c/CD18 (
xß2; gp150/95) (15).
ß1 integrins have a wide tissue distribution and are involved primarily in interactions with ECM proteins, such as laminin (CD49f/CD29) and fibronectin (CD49d/CD29; CD49e/CD29) (15). In addition to ECM adhesion, CD49d/CD29 can mediate firm adhesion of monocytes to endothelial cells through the binding of vascular cell adhesion molecule 1 (VCAM-1) and ICAM-2 (15). ß2 integrins function primarily in cell-cell interactions and are expressed exclusively on leukocytes (13). ß2 integrins can bind to the endothelial cell adhesion molecules ICAM-1 (CD11a/CD18; CD11b/CD18) and ICAM-2 (CD11a/CD18) as well as the leukocyte adhesion molecule ICAM-3 (CD11a/CD18) (13, 15). Therefore, the ß1 and ß2 integrins involved primarily in monocyte-endothelial interactions are CD49d/CD29, CD11a/CD18, and CD11b/CD18, although evidence also suggests that CD11c/CD18 is involved in firm adhesion to activated endothelial cells (15, 37, 39, 53).
ICAM-1 and ICAM-3, which belong to the immunoglobulin (Ig) domain superfamily, are adhesion molecules that regulate cell-cell interactions in such biological processes as cell migration and antigen presentation (11, 35, 40). ICAM-1 and ICAM-3 are highly glycosylated type I transmembrane proteins and consist structurally of five extracellular IgG-like domains, a transmembrane region, and a short cytoplasmic tail (12, 26, 47). ICAM-1 is expressed primarily on activated endothelial cells and leukocytes and binds to both CD11a/CD18 and CD11b/CD18 (18, 36). ICAM-3 binds to CD11a/CD18, dendritic cell-specific ICAM-3-grabbing nonintegrin (DC-SIGN), and CD11d/CD18 and is expressed primarily by monocytes, macrophages, T cells, and B cells (15, 55).
In this study, we initiated experiments to test the hypothesis that the viral induction of cellular signaling pathways induced specific functional changes in monocytes that promoted monocyte diapedesis (and consequently would promote viral spread). Here, we show that PI(3)K- and NF-
B-dependent signaling pathways are required for infected monocyte diapedesis, the acquisition of motility, and firm adhesion to endothelial cells. We then focused on HCMV-induced firm adhesion of monocytes and found that infected monocytes showed increased cell surface expression of ß1 integrins, ß2 integrins, ICAM-1, and ICAM-3 and that neutralization of these molecules inhibited HCMV-induced firm adhesion. The mechanisms by which HCMV upregulated the surface expression of individual adhesion molecules was complex and varied, with PI(3)K and NF-
B regulating either mRNA levels or adhesion molecule trafficking. Together, this study documents in detail the mechanisms by which HCMV infection utilizes host cell signal transduction to manipulate specific cellular changes in monocytes required for their firm adhesion to the endothelium and subsequent spread to organ tissue.
|
|
|---|
Monocyte isolation, treatment, and culture.
Human peripheral blood monocytes were purified by double-density gradient centrifugation (60). Samples (240 ml) of whole blood were taken from donors by venipuncture and centrifuged though a Ficoll Histopaque 1077 (Sigma, St. Louis, MO) gradient. Mononuclear cells were washed six times to remove platelets. Monocytes were further purified by centrifugation through a Percoll (Pharmacia, Piscataway, NJ) gradient. For immunofluorescence staining assays and phagokinetic track motility assays (adherent conditions), the monocytes were plated on fibronectin (Calbiochem, San Diego, CA)-coated glass coverslips in 24-well plates at a cell density of 5.0 x 104 cells per well or on colloidal gold-coated glass coverslips in 24-well plates at a cell density of 1.0 x 103 cells per well. Monocytes were cultured in RPMI supplemented with 10% human serum (Sigma) at 37°C with 5% CO2 for 2 hours and subsequently treated with dimethyl sulfoxide (DMSO; Sigma) as a solvent control, 50 µM of the PI(3)K inhibitor LY294002 (LY; Promega, Madison, WI), 5 µM of the NF-
B inhibitor Bay11-7082 (Bay11; EMD Biosciences, Inc., La Jolla, CA), or 4 µM of cytochalasin D (Promega) for 45 min. The concentrations of these inhibitors have previously been shown to be optimal in our system (14, 46). Adherent cells were then mock infected, HCMV infected (MOI of 15), UV-HCMV treated (equivalent MOI of 15), or phorbol 12-myristate 13-acetate (PMA) treated (10 ng/ml; Sigma). For all other assays (nonadherent conditions), the monocytes were treated with DMSO, LY (50 µM), or Bay11 (5 µM) and rocked on an orbital shaker for 45 min at 37°C in RPMI supplemented with 10% human serum. Pretreated cells were then mock infected, HCMV infected, or PMA treated as described above and cultured nonadherently. University Institutional Review Board and Health Insurance Portability and Accountability Act guidelines were followed for all experimental protocols involving human subjects.
Western blot analysis. Monocytes were isolated, treated, and incubated under nonadherent conditions as described above. To examine the expression of CD18, CD29, CD11a, CD11b, and CD11c in monomeric forms, cytoplasmic extracts were harvested at 6 hours postinfection (hpi) with an Active Motif cytoplasmic/nuclear extract kit according to the manufacturer's protocol with one exception: 0.5% deoxycholate was added to the lysis buffer to solubilize the integrin heterodimers. After the extracts were harvested, cytoplasmic extracts were mixed 1:1 with a 2x Tris-glycerol sample buffer consisting of 0.25 ml of 0.5 M Tris-Cl (pH 6.8), 0.2 ml glycerol, 0.1 mg bromophenol blue, and 1 ml H2O. To disrupt CD18, CD11a, CD11b, and CD11c heterodimeric complexes, Triton X-100, which was suspended in STE buffer consisting of 25 mM Tris-HCl (pH 7.4), 1 mM Na2EDTA, and 100 mM NaCl, was added to each sample to achieve a final concentration of 0.1%. To disrupt CD29 heterodimeric complexes, CHAPS {3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate} suspended in STE buffer was added to each sample to yield a final concentration of 0.6% CHAPS. Bovine serum albumin (BSA; nondenatured protein molecular weight marker kit; Sigma) was included as a reference after blot analysis. Equal protein amounts of the cytoplasmic extracts were separated by continuous native polyacrylamide gel electrophoresis (PAGE) and transferred to ImmunoBlot polyvinylidene difluoride membranes (Bio-Rad). For the analysis of ICAM-1 and ICAM-3 expression, total protein was harvested at 6 hpi in Laemmli sample buffer (Bio-Rad) and boiled for 10 min. Samples were separated by sodium dodecyl sulfate-PAGE and transferred to polyvinylidene difluoride membranes.
All blots were blocked in a solution of 5% skim milk, 0.1% Tween 20, and phosphate-buffered saline (PBS) and then incubated with anti-CD29 antibody (Ab; Chemicon, Temecula, CA), anti-CD18 Ab (Chemicon), anti-ICAM-1 Ab (MAB2146Z; Chemicon), anti-ICAM-3 Ab (Chemicon), anti-CD11a Ab (Chemicon), anti-CD11b Ab (BD Pharmingen, San Diego, CA), anti-CD11c Ab (Chemicon), or anti-GAPDH (anti-glyceraldehyde-3-phosphate dehydrogenase) Ab (Santa Cruz Biotechnology) in blocking solution overnight. The blots were washed and incubated with the appropriate horseradish peroxidase-conjugated secondary Ab (Santa Cruz Biotechnology), and the proteins were detected with an enhanced chemiluminescence plus kit (Pharmacia).
Monocyte diapedesis. Monocyte diapedesis assays were performed with human dermal microvascular endothelial cells (HMECs) cultured on cell culture inserts (BD Falcon, Bedford, MA) with an 8-µm pore size in 24-well plates and grown to confluence (4, 45, 46). HMECs were incubated and grown to confluence in endothelial cell growth medium-1 (Clonetics, Walkersville, MD) supplemented with 5% heat-inactivated FBS (Clonetics), hydrocortisone (1 µg/ml; Clonetics), human epidermal growth factor (10 ng/ml; Clonetics), bovine brain extract (12 µg/ml; Clonetics), and gentamicin sulfate amphotericin-B (Clonetics) at 37°C with 5% CO2. Monocytes were isolated and labeled with CellTracker green CMFDA (5-chloromethylfluorescein diacetate; Molecular Probes, Eugene, OR) according to the manufacturer's protocol. Monocytes were then treated and incubated under nonadherent conditions for 3 h as described above. Monocytes were washed three times and resuspended in RPMI supplemented with 10% human serum. Prior to addition of monocytes to the transwells, the HMECs in the upper compartment were washed, and the media in the transwells were replaced with RPMI supplemented with 10% human serum. Labeled monocytes (2.5 x 104) from each experimental arm were then added to each transwell and incubated at 37°C with 5% CO2. Twenty-four hours after the addition of monocytes, the ratios of cells undergoing diapedesis to those cells that were stationary on the surface of the endothelial monolayer were determined by inverted fluorescence microscopy as previously described (46). Results are plotted as means ± standard deviations (SD) for 10 random fields of view. Statistical significance between experimental means (P value) was determined with Student's t test.
Phagokinetic track motility assay. Colloidal gold-coated coverslips were prepared as previously described (1, 45). Glass coverslips were immersed in a 300 Bloom gelatin solution (0.5 g in 300 ml; Sigma), heated at 90°C for 10 min, and dried at 70°C for 45 min. A colloidal gold suspension was prepared by adding 11 ml of tissue culture water (Sigma) and 6 ml Na2CO3 (36.5 mM) to 1.8 ml AuHCl4 (14.5 mM; Fisher Scientific), bringing the solution to a boil, and rapidly adding 1.8 ml of 0.1% formaldehyde (Fisher Scientific). While hot, 2 ml of the colloidal gold suspension was added to each coverslip and incubated at 37°C for 1 h. The coverslips were washed and transferred to 24-well plates. Monocytes were isolated, treated, and incubated under adherent conditions as described above. Monocytes were incubated on colloidal gold coverslips for 6 h at 37°C with 5% CO2. Cells were then fixed with 1.5% paraformaldehyde for 15 min and mounted on slides with glycerol. Track images of cells were video captured, and the average area cleared per cell out of 20 cells per sample was determined in square arbitrary units with Scion Image software. Results are plotted as means ± standard errors of the mean (SEM) for 50 cells. Statistical significance between experimental means (P value) was determined with Student's t test.
Firm adhesion of monocytes to endothelial cells. HMECs were incubated and grown to confluence in 24-well plates as described above. Monocytes were isolated and labeled with CellTracker green CMFDA according to the manufacturer's protocol. Monocytes were then treated and incubated under nonadherent conditions for 6 hours as described above. After 6 h of nonadherent incubation, 2.5 x 105 labeled monocytes were added to each well and incubated for 30 min at 37°C with 5% CO2. The wells were then washed four times with PBS, and RPMI supplemented with 10% human serum was added to each well. Fluorescence intensity was determined for each well with a fluorescence plate reader. Total input fluorescence intensities for each experimental arm were determined by omitting the washing steps. The baseline autofluorescence of endothelial cells was determined by reading wells containing HMECs alone, and this average value was subtracted from the fluorescence intensities of each well to yield an adjusted intensity. The percentage of adherent cells represents the adjusted fluorescence intensities of an experimental arm divided by the adjusted total input cell fluorescence. The experiment was performed in triplicate. The results are plotted as means ± SEM. Statistical significance between experimental means (P value) was determined by Student's t test.
To determine the roles of CD29, CD18, ICAM-1, and ICAM-3 in HCMV-induced firm adhesion, adhesion assays were performed as described above, with one exception. Prior to the addition of monocytes to endothelial cells, HCMV-infected monocytes were incubated with 10 µg/ml of neutralizing Abs against CD29 (MAB1987Z; Chemicon), CD18 (CBL158; Chemicon), ICAM-1 (MAB2146Z; Chemicon), and ICAM-3 (MAB2149; Chemicon) or with an IgG1 isotype control Ab (R&D Systems, Minneapolis, MN) for 1 hour at room temperature. A fluorescence plate reader was used to determine the adjusted fluorescence intensities of each experimental arm as described above. To determine the changes in intensity over mock-infected monocytes (arbitrary units), the adjusted fluorescence intensities of mock-infected monocytes were subtracted from the adjusted fluorescence intensities of each experimental arm and multiplied by 1,000. The experiment was performed in triplicate. The changes in intensity over mock-infected monocytes for each experimental arm are plotted as means ± SEM. The results are representative of three independent experiments with separate human blood donors.
RNA isolation and reverse transcription-PCR (RT-PCR). Monocytes were isolated, treated, and incubated under nonadherent conditions for 6 h as described above. At 6 hpi, total cellular RNA from infected monocytes was harvested with an RNA STAT-60 isolation reagent (Tel-Test Inc., Friendswood, TX). RNA samples were reverse transcribed with 400 U of Moloney murine leukemia virus reverse transcriptase (Invitrogen Corp., Carlsbad, CA) in 1x reverse transcriptase buffer supplemented with 80 U of RNasin (Promega), random hexamers (0.1 µg/µl; Invitrogen Corp.), and 1 mM deoxynucleoside triphosphates (Amersham). After incubation at 37°C for 1 h, 2 U of RNase H (Stratagene, La Jolla, CA) was added. RT products were amplified by PCR performed in 1x iTaq buffer (Bio-Rad) containing 1.25 U of iTaq DNA polymerase (Bio-Rad) and a 50 µM concentration of each deoxynucleoside triphosphate. Primers specific for ICAM-1 (sense, AAGCCAAGAGGAAGGAGCAAGACT; antisense, TGAACCATGATTGCACCACTGCAC), ICAM-3 (sense, AGTGTACTGCAATGGCTCCCAGAT; antisense, TGGTTCATGACTGTCGCATTCAGC), CD29 (sense, TGCGAGTGTGGTGTCTGTAAGTGT; antisense, CCCGTGTCCCATTTGGCATTCATT), and CD18 (sense, ACTCCAGCAATGTGGTCCATCTCA; antisense, TAGCGCTCACAGTTGATGGTGTCA) were used to amplify regions of these genes. For all primers, an initial denaturing step at 95°C for 5 min and a final elongation step at 72°C for 7 min were utilized for each reaction. cDNAs were amplified in 32 cycles (for ICAM-1, ICAM-3, and GAPDH) or in 28 cycles (for CD29 and CD18) consisting of 95°C for 1 min, 58°C for 1 min, and 72°C for 1 min. PCR products were analyzed by electrophoresis on a 1% agarose gel. Equal RNA loading was confirmed by repeating the PCR with GAPDH-specific primers (sense, GAAGGTGAAGGTCGGAGTC; antisense, GAAGATGGTGATGGGATTTC). Band intensities were determined by densitometry with Quantity One image analysis software (Bio-Rad) and normalized to GAPDH band intensities.
Immunofluorescence staining. Monocytes were isolated, treated, and incubated under adherent conditions as described above. Monocytes were fixed at 24 hpi. Monocytes were then either permeabilized with a solution consisting of 0.25 M sucrose and 0.5% Triton X-100 in PBS for 5 min at 4°C or were left unpermeabilized. Coverslips were blocked with a solution containing 10% human serum, 10% FBS, 10% normal goat serum, and 0.5% BSA in PBS for 30 min at room temperature. The coverslips were incubated with monoclonal Abs (MAbs) against CD29 (MAB1987Z; Chemicon), CD18 (CBL158; Chemicon), ICAM-1 (MAB2146Z; Chemicon), or ICAM-3 (MAB2149; Chemicon) in PBS (1:100 dilution) for 90 min at room temperature and washed three times. Cells were then incubated with the appropriate fluorescein isothiocyanate (FITC)-conjugated secondary Ab (Sigma) at a concentration of 1:200 for 1 hour and washed three times. Cells that were not permeabilized previously were now permeabilized as described above to allow for staining of F-actin. Actin and nuclear staining utilizing Alexa Fluor 546 phalloidin (Molecular Probes) and TO-PRO-3 (Molecular Probes), respectively, was performed according to the manufacturer's protocol. The coverslips were washed three times and mounted in Slow Fade Gold (Molecular Probes). Cells were examined and photographed with a confocal microscope at x3,000 magnification (1,000x optical; 3x digital zoom).
Flow cytometry. Monocytes were isolated, treated, and incubated under nonadherent conditions as described above and cultured nonadherently for 24 h. Cells (1.0 x 106 per experimental arm) were fixed with 2% paraformaldehyde, blocked with 10% human serum, 10% normal mouse serum, 10% normal goat serum, and 5.0% BSA in fluorescence-activated cell sorting (FACS) buffer, and stained with CD14-allophycocyanin (APC)-Cy7 MAb (1:30 dilution; BD Biosciences, San Jose, CA), CD29-APC MAb (1:30 dilution; BD Biosciences), CD18-phycoerythrin (PE)-Cy5 MAb (1:30 dilution; BD Biosciences), CD50/ICAM-1-FITC (1:30 dilution; BD Biosciences), and CD54/ICAM-3-PE (1:30 dilution; BD Biosciences) for 60 min. Following Ab staining, the cells were washed two times in FACS buffer and analyzed by flow cytometry using a FACSCalibur system (BD Biosciences). CD14+ cells alone are represented in the histograms.
|
|
|---|
B and PI(3)K are required for HCMV-induced monocyte diapedesis and motility.
We previously reported that HCMV induces PI(3)K activation in monocytes over a 36-h time course of infection (46). Blocking PI(3)K activity with the PI(3)K-specific inhibitor LY prior to infection of monocytes abrogated the ability of the virus to promote monocyte motility, diapedesis, and migration through endothelial monolayers (46). In this study, our primary hypothesis was that HCMV required the cellular PI(3)K and NF-
B signaling pathways due to their critical role in regulating the molecular changes needed for monocyte motility and diapedesis through the endothelium. To test this hypothesis, we wanted to determine, first, the overall contribution of HCMV-induced NF-
B activation in mediating monocyte diapedesis and motility and then, second, the specific cellular changes mediated by these pathways that could promote viral dissemination.
To block NF-
B activity, we utilized the drug inhibitor Bay11, which blocks the phosphorylation and degradation of the NF-
B inhibitors I
B
and I
Bß (14). By this mechanism, Bay11 prevents the nuclear translocation of NF-
B and the transactivation of NF-
B-responsive promoters (14). For the following studies, we chose a concentration of 5 µM of Bay11 for two reasons. First, this dose has been reported to be effective in blocking NF-
B nuclear translocation (8). Second, 5 µM of Bay11 did not result in decreased monocyte viability at any of the time points examined in our study (data not shown). Western blot analyses of NF-
B activation and I
B degradation with and without Bay11 were utilized to validate our system (data not shown). HCMV infection induced nuclear NF-
B-p65 translocation and I
B
and I
Bß phosphorylation and degradation; pretreatment with Bay11 prior to HCMV infection abrogated these HCMV-induced changes in the NF-
B pathway. Pretreatment with LY partially blocked p65 nuclear translocation, indicating that PI(3)K signaling plays a partial role in HCMV-induced NF-
B activation in monocytes. This finding of a partial link between PI(3)K signaling and NF-
B signaling is likely due to the fact that HCMV signals through cellular receptors that are capable of activating NF-
B via PI(3)K-dependent and PI(3)K-independent mechanisms (10, 17, 56, 57). The use of LY in our system was also validated as previously documented (46).
To determine the role of NF-
B and PI(3)K in HCMV-induced transendothelial migration, monocytes were pretreated with LY, Bay11, or DMSO and then HCMV infected, mock infected, or PMA treated for 2 h. CellTracker green-labeled monocytes were added to cell culture inserts containing confluent monolayers of HMECs. The ratios of cells undergoing diapedesis to those cells that were stationary at the monolayer surface were determined by fluorescence microscopy after 24 h in culture (Fig. 1A). As previously reported, HCMV infection promoted monocyte diapedesis to a degree comparable to levels seen with the PMA positive control, and both HCMV-induced and PMA-induced diapedesis were dependent on PI(3)K activation (45, 46). Inhibition of NF-
B with Bay11 pretreatment likewise returned HCMV-induced and PMA-induced monocyte diapedesis to those levels seen with mock-infected monocytes treated with DMSO alone. These data demonstrate that HCMV-induced monocyte diapedesis through the endothelium depends on both the PI(3)K- and the NF-
B-associated signaling pathways. In addition, the results provide a general understanding of how specific signal transduction pathways modulate monocyte function, a process largely unknown.
![]() View larger version (31K): [in a new window] |
FIG. 1. HCMV promotes transendothelial migration and motility of monocytes in a PI(3)K-dependent and NF- B-dependent manner. (A) CellTracker green CMFDA-labeled monocytes were pretreated with LY (50 µM), Bay11 (5 µM), or DMSO for 45 min and then HCMV infected (MOI of 15), mock infected, or PMA treated (10 ng/ml) for 3 h. Labeled monocytes (2.5 x 104) were added to cell culture inserts containing confluent monolayers of HMECs. HCMV-induced monocyte diapedesis is dependent on both PI(3)K and NF- B activity. The ratios of cells undergoing diapedesis to those cells that were stationary at the monolayer surface were determined by fluorescence microscopy after 24 h in culture. The results are plotted as means ± SD for 15 random fields of view. The results are representative of three independent experiments with separate blood donors. (B) Monocytes were plated on colloidal gold-coated coverslips for 1 hour. Cells were subsequently pretreated with LY (50 µM), Bay11 (5 µM), or DMSO for 45 min and then HCMV infected (MOI of 15), UV-HCMV treated (equivalent MOI of 15), mock infected, or PMA treated (10 ng/ml). Cells were incubated on coverslips for 6 h and fixed with 3% paraformaldehyde. Individual cell track images were captured. The average area (square arbitrary units) of colloidal gold cleared by 20 monocytes was determined for each experimental arm. Results are plotted as means ± SEM for 20 cells per experimental arm. The results are representative of three independent experiments with separate human blood donors. In both panels, lanes marked with an asterisk denote significance (P < 0.01); depending on the experiment, the HCMV-infected, UV-HCMV-treated, and PMA-treated samples are significantly different from the mock-treated samples and those samples treated with LY, Bay11, or cytochalasin D (Cyt D).
|
B and PI(3)K activity on HCMV-induced monocyte motility (Fig. 1B). Monocytes were plated on colloidal gold-coated coverslips prior to drug treatment to eliminate changes in firm adhesion due to potential changes in adhesion molecule expression in the context of NF-
B and PI(3)K inhibition. After being allowed to adhere, the cells were pretreated with LY, Bay11, or DMSO and then HCMV infected, UV-HCMV treated, mock infected, or PMA treated. As a negative control, mock-infected, HCMV-infected, UV-HCMV-treated, and PMA-treated experimental arms were also treated during this incubation with cytochalasin D, an inhibitor of actin polymerization. Consistent with our previous findings (46), HCMV infection, UV-HCMV treatment, and PMA treatment significantly (P < 0.01) induced monocyte motility in a PI(3)K-dependent manner. Our work now demonstrates an essential role for NF-
B-dependent gene transactivation in the viral induction of monocyte motility, as Bay11 significantly reduced monocyte motility (P < 0.01). The induction of monocyte motility following UV-HCMV treatment confirms our previous findings that HCMV induces cellular changes in monocytes independent of viral gene expression, which does not occur in monocytes until 3 to 4 weeks postinfection (45).
HCMV induces firm adhesion of monocytes to endothelial cells: roles of NF-
B and PI(3)K.
To determine if HCMV infection promoted firm adhesion of monocytes to endothelial cells, CellTracker green CMFDA-labeled monocytes were added to confluent monolayers of HMECs and fluorescence intensities determined with a fluorescence plate reader (Fig. 2A). HCMV infection and UV-HCMV treatment of monocytes induced firm adhesion of approximately 87% of input cells compared to the firm adhesion of approximately 21% of mock-infected input monocytes. These data indicate that HCMV infection of monocytes induced firm adhesion to endothelial cells independent of viral gene expression. Inhibition of NF-
B activity prior to infection resulted in a significant (P < 0.01) decrease in firm adhesion (approximately 15% of input monocytes). PI(3)K inhibition had a more subtle, although significant (P < 0.01), effect on HCMV-induced firm adhesion, with approximately 56% of input monocytes firmly adhering. The PMA-treated experimental arms had profiles similar to those seen with HCMV infection in the context of PI(3)K and NF-
B inhibition, although the induction of firm adhesion by PMA alone (47%) was not as robust as that by HCMV infection. These data suggest that HCMV is a potent inducer of adhesion molecule activation and that the upregulation of adhesion molecule expression occurs primarily through the activation of NF-
B in a PI(3)K-independent signaling pathway.
![]() View larger version (23K): [in a new window] |
FIG. 2. HCMV promotes firm adhesion of monocytes to endothelial cells. (A) HCMV infection of monocytes promotes firm adhesion to endothelial cells in a PI(3)K-dependent and NF- B-dependent manner. CellTracker green CMFDA-labeled monocytes were pretreated with LY (50 µM), Bay11 (5 µM), or DMSO for 45 min and then HCMV infected (MOI of 15), mock infected, or PMA treated (10 ng/ml). Monocytes were cultured nonadherently for 6 h. Labeled monocytes (2.5 x 105 per well) were then added to cell culture inserts containing confluent monolayers of HMECs in 24-well plates and incubated for 30 min. Cells were then washed four times, and fluorescence intensities were determined with a fluorescence plate reader. The percentage of adherent cells represents the ratio of the adjusted fluorescence intensities of an experimental arm to the total input cell-adjusted fluorescence intensities. The experiment was performed in triplicate. The results are plotted as means ± SEM. The results are representative of three independent experiments with separate human blood donors. Lanes marked with an asterisk denote significance (P < 0.01); the HCMV-infected, UV-HCMV-treated, and PMA-treated samples are significantly different from the mock-treated samples and those samples treated with LY or Bay11. (B) CD29, CD18, ICAM-1, and ICAM-3 are required for HCMV-induced firm adhesion of monocytes to endothelial cells. CellTracker green CMFDA-labeled monocytes were treated and cultured as described above. Prior to addition of monocytes to endothelial cells, monocytes were incubated with neutralizing Abs against CD29, CD18, ICAM-1, or ICAM-3 or with an IgG1 isotype control Ab for 1 h at room temperature. Labeled monocytes (2.5 x 105 per well) were then added to cell culture inserts containing confluent monolayers of HMECs in 24-well plates and incubated for 30 min. Cells were then washed four times and fluorescence intensities determined with a fluorescence plate reader in triplicate. To determine the changes in intensity over mock-infected monocytes (arbitrary units), the adjusted fluorescence intensities of mock-infected monocytes were subtracted from the adjusted fluorescence intensities of each experimental arm. The results are plotted as means ± SEM. The results are representative of three independent experiments with separate human blood donors. The HCMV-infected group and the isotype control-treated HCMV-infected group are significantly different from the CD29, CD18, ICAM-1, and ICAM-3 neutralizing MAb-treated groups (P < 0.01). This significance is denoted in the appropriate lanes via an asterisk.
|
4ß1), CD11a/CD18 (
Lß2), CD11b/CD18 (
Mß2), CD11c/CD18 (
xß2), ICAM-1, and ICAM-3 are expressed by peripheral blood monocytes and are known to promote firm adhesion to the endothelium (13). To address the functional contribution of the ß1 integrins, the ß2 integrins, ICAM-1, and ICAM-3 in HCMV-induced firm adhesion of monocytes, we utilized neutralizing Abs against CD29 (ß1 integrin subunit), CD18 (ß2 integrin subunit), ICAM-1, and ICAM-3 in our adhesion assays. Monocytes were labeled with CellTracker green and mock infected or HCMV infected. Prior to adhesion, the monocytes were treated with neutralizing Abs or an IgG1 isotype control and the change in intensity over mock-infected monocytes (arbitrary units) was determined for each experimental arm (Fig. 2B). The treatment of HCMV-infected monocytes with neutralizing Abs against the ß integrin subunits (CD29, CD18), ICAM-1, and ICAM-3 completely blocked HCMV-induced firm adhesion of monocytes, while the treatment of HCMV-infected monocytes with the isotype control Ab alone had no effect on firm adhesion. These data demonstrate that these cellular adhesion receptors are critical for HCMV-induced firm adhesion of monocytes and, in a broader context, that the viral-induced molecular and/or cellular changes in monocyte function have bona fide biological benefits for the virus.
Regulation of CD29, CD18, ICAM-1, and ICAM-3 mRNA and protein levels by HCMV infection.
We next wanted to correlate the roles of CD29, CD18, ICAM-1, and ICAM-3 in HCMV-induced firm adhesion of monocytes to endothelial cells with the viral upregulation of these molecules at the mRNA level. Monocytes were pretreated as described above and were cultured nonadherently for 6 h. Total RNA was isolated, and RT-PCR was performed on all experimental samples with primers specific for the mRNA coding regions of CD29, CD18, ICAM-1, and ICAM-3 (Fig. 3). Band intensities were determined by densitometry (Table 1). CD29 message levels were upregulated following HCMV infection and PMA treatment, although PI(3)K and NF-
B played little or no role in regulating CD29 message expression under these conditions. The inhibition of PI(3)K activity in mock-infected monocytes resulted in increased CD29 message levels, suggesting that PI(3)K negatively regulated CD29 expression at the level of transcription or message stability in resting monocytes. HCMV-infected and PMA-treated monocytes showed similar modest increases in CD18 mRNA levels compared to mock-treated monocytes. Blocking NF-
B activity had a slight negative effect on CD18 expression in HCMV-infected and PMA-treated monocytes. In contrast, the inhibition of NF-
B activity in mock-infected monocytes resulted in increased CD18 message levels, suggesting that NF-
B negatively regulated CD18 expression. PI(3)K inhibition, however, reduced CD18 message levels in mock-infected, PMA-treated, and HCMV-infected monocytes. ICAM-1 was upregulated at the message level by HCMV and PMA treatment, and this increased message expression was largely dependent on NF-
B activity. ICAM-3 mRNA levels were also elevated following HCMV infection and PMA treatment; however, unlike those for the other adhesion receptors examined, the increase in ICAM-3 message expression was independent of both NF-
B and PI(3)K activities. The inhibition of NF-
B resulted in increased ICAM-3 message levels in mock-infected monocytes, suggesting a negative regulatory role for NF-
B in the expression of ICAM-3 by resting monocytes.
![]() View larger version (59K): [in a new window] |
FIG. 3. Regulation of CD29, CD18, ICAM-1, and ICAM-3 mRNA expression in HCMV-infected monocytes. Monocytes were pretreated with LY (50 µM), Bay11 (5 µM), or DMSO for 45 min and then HCMV infected (MOI of 15), mock infected, or PMA treated (10 ng/ml). Cells were then cultured nonadherently for 6 h, and total RNA was harvested from each sample. RT-PCR was performed for CD29, CD18, ICAM-1, and ICAM-3. The results are representative of three independent experiments with separate human blood donors.
|
|
View this table: [in a new window] |
TABLE 1. Quantitation of adhesion receptor message expression
|
B activity had no effect on the levels of CD29 protein expressed by mock-infected or infected monocytes (Fig. 4). In regard to CD18, total protein levels showed only minor increases following HCMV infection. No change was seen when PI(3)K or NF-
B activity was inhibited (Fig. 4). These data are comparable to those for the RT-PCR analysis of CD18 mRNA expression (Fig. 3 and Table 1), with the exception that CD18 mRNA levels dropped following PI(3)K inhibition.
![]() View larger version (57K): [in a new window] |
FIG. 4. Regulation of CD29, CD18, CD11a, CD11b, CD11c, ICAM-1, and ICAM-3 protein expression in HCMV-infected monocytes. Monocytes were pretreated with LY (50 µM), Bay11 (5 µM), or DMSO for 45 min and then HCMV infected (MOI of 15), mock infected, or PMA treated (10 ng/ml). Cells were then cultured nonadherently for 6 h, and protein was harvested and solubilized. Samples for the analysis of CD29, CD18, CD11a, CD11b, and CD11c were separated by continuous native PAGE with equal protein loading. Samples for the analysis of ICAM-1 and ICAM-3 were separated by sodium dodecyl sulfate-PAGE with equal protein loading based on actin band intensity. Blots were probed with the different Abs stated in the figure.
|
subunits (15, 37, 39, 53), the expression of these monomeric
subunits was examined next to determine if their expression levels were a limiting factor in functional heterodimeric integrin expression. Similar to those of the ß integrin subunits, the expression levels of these
integrin subunits did not substantially change following HCMV infection or when NF-
B or PI(3)K activity was inhibited (Fig. 4).
ICAM-1 and ICAM-3 expression levels were examined by Western blot analysis under denaturing conditions. In HCMV-infected monocytes, ICAM-1 protein levels were increased compared to those in mock-infected monocytes (Fig. 4) and were dependent on NF-
B activity but not PI(3)K activity. ICAM-3 protein expression increased only marginally in infected monocytes and was not altered considerably by LY or Bay11 pretreatments (Fig. 4). The protein expression profiles for ICAM-1 and ICAM-3 are consistent with the RT-PCR analysis of ICAM-1 and ICAM-3 mRNA levels (Fig. 3).
HCMV infection of monocytes upregulates CD29, CD18, ICAM-1, and ICAM-3 surface expression. It can be concluded from the experiments described above that the total protein levels of the ß1 and ß2 integrins and ICAM-3 showed only small increases in total protein expression following HCMV infection. However, integrin and ICAM-3 molecules in circulating leukocytes localize primarily to specific secretory vesicles rather than the cell surface, and the translocation of these adhesion molecules from secretory vessels to the cell membrane can be induced by mitogens such as PMA, chemokines, or cytokines (41). We hypothesized that HCMV, through the manipulation of cellular signaling pathways, would induce cell surface expression of the integrins and ICAM-3 and that ICAM-1 expression, due to its robust induction at the mRNA and protein levels following HCMV infection, would be localized primarily at the cell surface in both mock-infected and HCMV-infected monocytes. Monocytes were HCMV infected, mock infected, or PMA treated. At 24 hpi, cells were fixed and stained with Abs against CD29, CD18, ICAM-1, or ICAM-3 and the appropriate secondary Abs. Monocytes were then permeabilized, stained with TO-PRO-3 and phalloidin, and photographed by confocal microscopy. CD29, CD18, ICAM-1, and ICAM-3 cell surface expression levels in HCMV-infected and PMA-treated monocytes were all dramatically upregulated compared to those in mock-infected monocytes (Fig. 5). The cellular localization of the various adhesion receptors is appropriate and consistent with their use in adhesion and motility. The upregulation of the cell surface expression of these molecules in the absence of robust changes in total protein levels (ICAM-1 being an exception) hints at the complexities of the regulation of these adhesion receptors on monocytes and the processes that the virus has evolved to manipulate. These images of individual cells document two additional points. (i) HCMV induces morphological changes in infected monocytes that verify a conversion to a motile phenotype, exemplified in the pictures by cytoskeletal rearrangements, membrane ruffling, and the existence of multiple extensions. (ii) HCMV induces a distinctly different morphology than PMA. Infected monocytes show the motile phenotype discussed above, while on average, PMA-treated monocytes show a much more rounded cellular structure. This difference between HCMV-infected and PMA-treated monocytes is likely tied to the fact that only HCMV mediates the functional changes in monocytes that ultimately promote the monocyte-to-macrophage differentiation that we previously described (45).
![]() View larger version (27K): [in a new window] |
FIG. 5. HCMV infection induces cell surface expression of CD29, CD18, ICAM-1, and ICAM-3. Monocytes were plated on fibronectin-coated coverslips for 2 h and subsequently HCMV infected (MOI of 15), mock infected, or PMA treated (10 ng/ml) and cultured for 24 h. Monocytes were fixed at 24 hpi and incubated with MAbs against CD29, CD18, ICAM-1, or ICAM-3. Cells were then incubated with the appropriate FITC-conjugated secondary Ab to label the adhesion receptors, permeabilized, and stained with Alexa Fluor 546 phalloidin (depicted in blue) to stain actin and TO-PRO-3 (depicted in red) to stain the nucleus, according to the manufacturer's protocol. Cells were examined and photographed with a confocal microscope (x3,000 magnification; 1,000x optical, 3x digital zoom). Results are representative of three independent experiments with different human blood donors.
|
B pathways played in the increased surface expression of CD29, CD18, ICAM-1, and ICAM-3 following infection using flow cytometry (Fig. 6A -D). Monocytes were cultured for 24 hpi nonadherently following pretreatment with Bay11, LY, or DMSO. The flow cytometric analyses showed that CD29 (Fig. 6A), CD18 (Fig. 6B), ICAM-1 (Fig. 6C), and ICAM-3 (Fig. 6D) surface expression levels on HCMV-infected monocytes were increased compared to those on the mock-infected monocytes, consistent with our microscopy results. PI(3)K activity was required for maximal surface expression of CD29, CD18, and ICAM-3 in the HCMV-infected monocytes, while NF-
B activity was required for the maximal expression of ICAM-1 observed in the HCMV-infected monocytes. NF-
B activity appears to negatively control CD29 surface expression. These results suggest that another layer of control for these adhesion receptors is at the level of trafficking to the surface.
![]() View larger version (33K): [in a new window] |
FIG. 6. Confirmation of HCMV-induced cell surface translocation of CD29, CD18, ICAM-1, and ICAM-3. Monocytes were pretreated with LY (50 µM), Bay11 (5 µM), or DMSO for 45 min and then HCMV infected (MOI of 15) or mock infected. Cells were then cultured nonadherently for 24 h. Cells were fixed and incubated with MAbs against CD29, CD18, ICAM-1, or ICAM-3 and examined by flow cytometry for CD29 expression (A), CD18 expression (B), ICAM-1 expression (C), or ICAM-3 expression (D). Results are representative of three independent experiments with separate blood donors.
|
B-dependent role, respectively, in the translocation of the ß1 integrins from secretory vessels to the cell surface. When monocytes were infected nonadherently, PI(3)K activity was the dominant pathway required for the surface expression of CD29 (shown in Fig. 6); no role was observed for NF-
B activity under these nonadherent conditions. However, when cells were adhered and infected, NF-
B activity appeared to be dominant (Fig. 7, middle [no surface expression is seen in the absence of NF-
B activity]). This point was confirmed when monocytes were examined by confocal microscopy for CD29 surface expression (in the absence of permeabilization) with or without Bay11 treatment (data not shown). The identification of a shift in the pathways regulating adhesion occurred only with the ß1 integrins. The mechanism responsible for this dual regulation is unknown, although our previous work hinted at differences in the regulation of the ß1 integrins in nonadherent versus adherent monocytes (data not shown and reference 60). Regardless, the data suggest that PI(3)K and NF-
B activations either promote CD29 translocation to the cell membrane or inhibit the endocytosis of cell surface-expressed CD29.
![]() View larger version (24K): [in a new window] |
FIG. 7. HCMV infection of monocytes promotes the translocation of CD29, CD18, and ICAM-3 from the cytosol to the cell membrane. Monocytes were treated as stated in the legend for Fig. 5, with the following exceptions: (i) cells were pretreated with LY (50 µM), Bay11 (5 µM), or DMSO for 45 min prior to infection (MOI of 15) or mock treatment; (ii) prior to incubation of monocytes with Abs against the adhesion receptors, monocytes were permeabilized with Triton X-100; and (iii) TO-PRO-3 was the only other stain utilized. Cells were examined and photographed with a confocal microscope (x3,000 magnification; 1,000x optical, 3x digital zoom). Results are representative of three independent experiments with separate blood donors.
|
B-dependent transcription. ICAM-3 cell surface expression was upregulated in HCMV-infected monocytes and was dependent on PI(3)K activity (Fig. 6). Cytosolic staining of ICAM-3 revealed that mock-infected, HCMV-infected, and LY-pretreated HCMV-infected cells had significant levels of cytosolic ICAM-3 (Fig. 7), which was not affected by the inhibition of PI(3)K activity. Together, these data demonstrate that HCMV induces the translocation of ICAM-3 to the cell surface in a PI(3)K-dependent manner. In conclusion, these results identify that a complex regulatory network exists for the regulation of monocyte adhesion receptors and that a pathogen, such as HCMV, must navigate these complex systems in order to utilize these cells as "Trojan horses" for hematogenous spread. |
|
|---|
B activity. But how does HCMV infection of monocytes promote firm adhesion to endothelial cells through the activation of PI(3)K and/or NF-
B?
To begin to address this question, we examined whether HCMV infection of monocytes induced firm adhesion to endothelial cells. Significantly more infected monocytes than mock-infected monocytes adhered to endothelial cells. Although the inhibition of both PI(3)K and NF-
B significantly inhibited firm adhesion of infected monocytes, inhibition of NF-
B prior to HCMV infection had a greater effect than inhibition of PI(3)K prior to infection. These data demonstrate that HCMV induces firm adhesion of monocytes to endothelial cells primarily through the viral manipulation of host cell pathways and provides the initial report for the biological rationale for the viral manipulation of these pathways in monocytes. These results also identify molecular aspects of the regulation of general monocyte function.
Due to their known role in mediating firm adhesion of activated monocytes to endothelial cells (15), the individual contributions of cell adhesion molecules (CD29, CD18, ICAM-1, and ICAM-3) in HCMV-induced firm adhesion were addressed. The individual neutralization of each of these adhesion molecules on HCMV-infected monocytes decreased firm adhesion to levels at or slightly below those for mock-infected monocytes. The experiment identified that these receptors do not compensate for each other during firm attachment of monocytes to the endothelium. We speculate that the results are due to the fact that although a multitude of cell adhesion molecules exist on monocytes, they do not serve redundant functions but rather serve individual required functions in the multistep process of firm adhesion to the endothelium and the subsequent events needed for migration through the endothelial cell junctions. This experiment also documents that changes induced in infected monocytes have a defined purpose for the virus: the promotion of the requisite changes in the cell type required for persistence within the infected host.
To address whether or not HCMV-induced PI(3)K and/or NF-
B activation differentially regulates the expression of CD29, CD18, ICAM-1, and ICAM-3, these adhesion molecules were examined at the levels of mRNA expression, total cellular protein expression, cell surface expression, and cytoplasmic expression in mock-infected and HCMV-infected monocytes pretreated with the PI(3)K inhibitor, LY, or the NF-
B inhibitor Bay11.
CD29, CD18, ICAM-1, and ICAM-3 levels were all upregulated following infection, although CD29, ICAM-1, and ICAM-3 showed the most dramatic changes in message expression following infection. PI(3)K activity appeared to be the major contributor to the induction of CD18 expression levels following infection, and NF-
B activity appeared to be the sole contributor to ICAM-1 expression levels following infection. Total protein levels of ICAM-3, despite its induction at the mRNA level, and CD18 did not appreciably change with HCMV infection and were not affected by the inhibition of PI(3)K or NF-
B during the time frame of our study. Total protein levels of CD29 increased slightly following HCMV infection, although this increase occurred independent of PI(3)K and NF-
B activity. Despite the lack of a significant induction in total protein levels of CD29, CD18, and ICAM-3, these molecules on the cell surfaces of infected monocytes were highly upregulated compared to those on mock-infected monocytes. When mock-infected and HCMV-infected monocytes were permeabilized prior to staining, high levels of CD29, CD18, and ICAM-3 could be detected in the cytosol. These data indicate that although CD29, CD18, and ICAM-3 total cellular protein levels were not largely altered following infection, their localization within the cell was dramatically altered in infected monocytes, suggesting that HCMV infection dysregulated the translocation of these receptors from cytosolic vesicles to the cellular surface. Flow cytometric analysis of monocytes confirmed these findings. These data are consistent with a study showing that the neutrophil CD11b/CD18 is regulated by cellular localization (41) and now expand these findings to peripheral blood monocytes as well as to multiple adhesion receptor families. This level of adhesion molecule regulation likely allows circulating monocytes to respond quickly to mitogenic/cytokine/chemokine (or, in our case, pathogen) signals and to rapidly adhere to endothelial cells, thus initiating the migration process. PI(3)K activity was required for HCMV-induced CD18 and ICAM-3 cytoplasmic translocation, while PI(3)K and NF-
B activity showed dual distinct roles in regulation of HCMV-induced CD29 translocation. Although the specific biochemical mechanisms are unknown, these results suggest that NF-
B and PI(3)K signal transduction and/or gene transactivation results in the activation or expression of additional cellular factors that either promote trafficking of adhesion molecule-associated vesicles to the cell membrane or inhibit the endocytosis of adhesion molecules as a negative regulatory mechanism. It should be pointed out that there is specificity to the regulation of cell surface receptors and not just a global upregulation of everything on the infected monocyte cell surface. For example, it has been shown that the 55-kDa tumor necrosis factor alpha receptor is downregulated from the cell surface following infection of monocytic cell lines (2).
HCMV-induced ICAM-1 cell surface expression was the exception to the cytoplasmic translocation paradigm. ICAM-1 mRNA and total cellular protein levels were both upregulated following HCMV infection in an NF-
B-dependent manner. Increased ICAM-1 total protein levels correlated with increased cell surface expression in HCMV-infected monocytes, and little ICAM-1 was detected in the cytosol of HCMV-infected monocytes. These data are consistent with the fact that the ICAM-1 promoter has an NF-
B binding site 200 bp upstream of the transcription start site, which has been shown to be critical in ICAM-1 message expression in a number of cell types (38). Signals such as tumor necrosis factor alpha, interleukin-1ß, gamma interferon, interleukin-6, and reactive oxygen species are reported to induce ICAM-1 message expression in a number of cell types (25, 38).
We recently conducted a gene array study to determine the roles that PI(3)K and NF-
B played in regulating HCMV-induced gene expression in monocytes (G. Chan, E. R. Bivins-Smith, M. S. Smith, and A. D. Yurochko, submitted for publication). This gene array study revealed that a number of adhesion molecules associated with enhanced monocyte motility and migration as well as other genes associated with inflammation were rapidly upregulated in an NF-
B- and/or PI(3)K-dependent manner, consistent with our present findings. In parallel, the gene array study and the present study tell us that while global analysis of HCMV-induced gene expression reveals a number of cellular targets utilized by HCMV to promote viral spread, HCMV also relies on the manipulation of posttranscriptional mechanisms through cellular signal transduction pathways to regulate key cellular changes involved in transendothelial migration, such as firm adhesion to endothelial cells.
In summary, we document that complex biological regulatory pathways exist in monocytes in regard to their basal regulation of adhesion receptors and how these receptors are regulated in response to stimuli. We further identify that pathogens have evolved mechanisms for navigating and manipulating these pathways for their own benefit. In the case of HCMV, the benefit for the virus of manipulating these pathways is the targeted change in monocyte function that promotes the hematogenous dissemination required for the establishment of persistence within the infected host and, ultimately, for persistence and survival within the host target population. Regarding monocyte-mediated hematogenous spread of HCMV, this study adds to our growing understanding of the rapid cellular changes associated with viral infection. By deciphering how HCMV infection alters monocyte function through cellular signal transduction pathways, we hope to provide a better understanding of the steps required for HCMV pathogenesis and, thus, to identify distinct target sites for therapeutic intervention.
This work was supported by a Malcolm Feist Cardiovascular Research Fellowship and grants from the American Heart Association (0365207B and 0160239B), the Louisiana Board of Regents [LEQSF (2000-2003)-RD-A-19], the March of Dimes (1-FY01-332), and the National Institutes of Health (AI56077 and 1-P20-RR018724).
Published ahead of print on 16 May 2007. ![]()
|
|
|---|
) signaling by targeting the 55-kilodalton TNF-
receptor. J. Virol. 77:7007-7016.
B in cell survival and transcription of latent membrane protein 1-expressing or Epstein-Barr virus latency III-infected cells. J. Virol. 78:4108-4119.
B by human cytomegalovirus promotes efficient viral replication and late gene expression. Virology 346:15-31.[CrossRef][Medline]
mß2) in human neutrophils. J. Clin. Investig. 92:1467-1476.[Medline]
dß2, binds preferentially to ICAM-3. Immunity 3:683-690.[CrossRef][Medline]
vß3 is a coreceptor for human cytomegalovirus. Nat. Med. 11:515-521.[CrossRef][Medline]
B during infection. J. Virol. 71:5051-5059.[Abstract]This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»