This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moraes, M. P.
Right arrow Articles by Grubman, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moraes, M. P.
Right arrow Articles by Grubman, M. J.

 Previous Article  |  Next Article 

Journal of Virology, July 2007, p. 7124-7135, Vol. 81, No. 13
0022-538X/07/$08.00+0     doi:10.1128/JVI.02775-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Enhanced Antiviral Activity against Foot-and-Mouth Disease Virus by a Combination of Type I and II Porcine Interferons{triangledown}

Mauro Pires Moraes,1 Teresa de los Santos,1 Marla Koster,1 Traci Turecek,1 He Wang,2 Vladimir G. Andreyev,1,{dagger} and Marvin J. Grubman1*

Plum Island Animal Disease Center, North Atlantic Area, Agricultural Research Service, U.S. Department of Agriculture, Greenport, New York 11944,1 Foreign Animal Disease Diagnostic Laboratory, Plum Island Animal Disease Center, Animal Plant and Health Inspection Service, U.S. Department of Agriculture, Greenport, New York 119442

Received 15 December 2006/ Accepted 13 April 2007


arrow
ABSTRACT
 
Previously, we showed that type I interferon (alpha/beta interferon [IFN-{alpha}/ß]) can inhibit foot-and-mouth disease virus (FMDV) replication in cell culture, and swine inoculated with 109 PFU of human adenovirus type 5 expressing porcine IFN-{alpha} (Ad5-pIFN-{alpha}) were protected when challenged 1 day later. In this study, we found that type II pIFN (pIFN-{gamma}) also has antiviral activity against FMDV in cell culture and that, in combination with pIFN-{alpha}, it has a synergistic antiviral effect. We also observed that while each IFN alone induced a number of IFN-stimulated genes (ISGs), the combination resulted in a synergistic induction of some ISGs. To extend these studies to susceptible animals, we inoculated groups of swine with a control Ad5, 108 PFU of Ad5-pIFN-{alpha}, low- or high-dose Ad5-pIFN-{gamma}, or a combination of Ad5-pIFN-{alpha} and low- or high-dose Ad5-pIFN-{gamma} and challenged all groups with FMDV 1 day later. The control group and the groups inoculated with either Ad5-pIFN-{alpha} or a low dose of Ad5-pIFN-{gamma} developed clinical disease and viremia. However, the group that received the combination of both Ad5-IFNs with the low dose of Ad5-pIFN-{gamma} was completely protected from challenge and had no viremia. Similarly the groups inoculated with the combination of Ad5s with the higher dose of Ad5-pIFN-{gamma} or with only high-dose Ad5-pIFN-{gamma} were protected. The protected animals did not develop antibodies against viral nonstructural (NS) proteins, while all infected animals were NS protein seropositive. No antiviral activity or significant levels of IFNs were detected in the protected groups, but there was an induction of some ISGs. The results indicate that the combination of type I and II IFNs act synergistically to inhibit FMDV replication in vitro and in vivo.


arrow
INTRODUCTION
 
Foot-and-mouth disease virus (FMDV), a member of the Picornaviridae family, is the most contagious pathogen of cloven-hoofed animals, including swine and bovines, and causes a rapidly spreading, acute infection characterized by fever, lameness, and vesicular lesions on the feet, tongue, snout, and teats (34). In areas where FMD is enzootic, disease control is achieved by the slaughter of infected animals, movement control of susceptible animals, and vaccination. The current vaccine, an inactivated whole-virus antigen, is not ideally suited to eliminate FMD outbreaks from previously disease-free countries, since vaccinated animals cannot be unequivocally differentiated from infected animals. As a result, FMD-free countries do not import animals or animal products from countries that use this vaccine, and in the event of an outbreak in disease-free countries, the most rapid method of regaining FMD-free status and resuming international trade is to slaughter infected and susceptible animals that have been in contact with infected animals. After the 2001 FMD outbreaks in the United Kingdom and The Netherlands, it became apparent that this practice is opposed by the public. International organizations such as the Office International des Epizooties (OIE) and the world organization for animal health, as well as meat-exporting countries, now support the development and use of marker vaccines and companion diagnostic tests that will allow the differentiation of vaccinated from infected animals in FMD control programs (3, 68). We have recently developed a novel marker FMD vaccine candidate delivered by a recombinant, replication-defective human adenovirus type 5 vector (Ad5-FMD) that can protect both swine and cattle (50, 54, 59).

More recently, the above-named organizations have also come to realize that to be successful, FMD control programs should include rapid measures to limit and control disease spread. To meet these needs, they now support the development of antivirals and/or immunomodulatory molecules (3).

The innate immune system provides the initial response of the host to pathogen invasion (9). Type I interferons (alpha/beta interferons [IFN-{alpha}/ßs]) are rapidly induced after virus infection and via a series of events; in paracrine and autocrine processes, they lead to the expression of hundreds of gene products, some of which have antiviral activity (24). However, like other viruses, FMDV has evolved multiple mechanisms to overcome the IFN-{alpha}/ß response (7, 21, 23, 26, 31, 42, 76). Nevertheless, we and others have shown that pretreatment of cells with IFN-{alpha} can dramatically inhibit FMDV replication (2, 18, 20), and at least two IFN-{alpha}/ß-stimulated gene products (ISGs), double-stranded-RNA-dependent protein kinase (PKR) and 2',5'oligoadenylate synthetase (OAS)/RNase L, are involved in this process (18, 23). Based on these observations, we previously constructed an Ad5 vector containing the porcine IFN-{alpha} gene (Ad5-pIFN-{alpha}) as a possible method of rapidly inducing protection against FMD. Ad5-pIFN-{alpha} produces high levels of biologically active IFN in infected-cell supernatants (19). Swine inoculated with Ad5-pIFN-{alpha} are protected when challenged with FMDV 1 day later, and protection can last for 3 to 5 days (19, 52). Protection correlates with an increase in the amount of IFN-{alpha} protein in serum and the induction of PKR and OAS mRNA in white blood cells (19, 22, 52). However, since this approach has not been completely effective for cattle (77), we are attempting to identify new strategies to induce rapid protection.

Type II IFN (IFN-{gamma}) is a multifunctional cytokine produced by T-helper 1 (Th1) and natural killer (NK) cells, and its biological functions include immunoregulatory, anti-neoplastic, and antiviral properties (9). The antiviral effect of IFN-{gamma} may be direct (intracellular) or indirect, involving effector cells of the immune system (17). The antiviral activity of IFN-{gamma} against several viruses, including herpes simplex virus, hepatitis C virus, West Nile virus, vaccinia virus, vesicular stomatitis virus (VSV), human immunodeficiency virus, and coxsackievirus, another member of the picornavirus family, has been demonstrated (13, 29, 35-37, 39, 41, 43, 69). Recently, indoleamine 2,3-dioxygenase (INDO) (1, 10, 57) and inducible nitric oxide synthase (iNOS) (67, 78) have been identified as IFN-{gamma}-induced gene products that have intracellular antiviral effects.

Although the signal transduction pathways elicited by each type of IFN differ, the combination of type I and type II IFNs can synergistically induce gene expression (16, 44, 49, 72). The coactivation of the IFN signaling pathways produce an increased effect in blocking the replication of a number of viruses in vitro and/or in vivo, including coronavirus (63), herpes simplex virus (6, 61, 74), varicella-zoster virus (25), cytomegalovirus (CMV) (62), vaccinia virus (46), hepatitis C virus (58), and mouse hepatitis virus (30).

To examine the potential antiviral effect of IFN-{gamma} on FMDV replication and to determine if a combination of IFN-{alpha} and IFN-{gamma} can act synergistically to block virus replication, we constructed an Ad5 vector containing the pIFN-{gamma} gene (Ad5-CI-pIFN-{gamma}). In this paper, we demonstrate the antiviral properties of IFN-{gamma} and the synergistic effect of a combination of pIFN-{alpha} and pIFN-{gamma} on FMDV replication in cell culture. Furthermore, swine inoculated with Ad5-CI-pIFN-{alpha} and Ad5-CI-pIFN-{gamma}, at doses that alone do not protect against FMDV challenge, are completely protected against clinical disease and do not develop viremia or antibodies against viral nonstructural (NS) proteins. Possible mechanisms of protection induced by this combination treatment are discussed.


arrow
MATERIALS AND METHODS
 
Cells and viruses. Human 293 cells were used to generate and grow recombinant Ad5s and to determine virus titer (32, 54). Baby hamster kidney cells (BHK-21, clone 13) were used to measure FMDV titers in plaque assays. IBRS-2 (swine kidney) cells were used to measure antiviral activity in plasma from inoculated animals by a plaque reduction assay (18). The recombinant viruses Ad5-CI-pIFN-{alpha}, Ad5-CI-pIFN-ß, and Ad5-CI-pIFN-{gamma} were constructed as described below, while Ad5-VSV glycoprotein (Ad5-VSVG) was described previously (53). FMDV serotype A24 (strain Cruzeiro, Brazil, 1955, provided by A. Tanuri, University of Rio de Janeiro) was isolated from vesicular lesions of an infected bovine. The 50% pig infectious dose was determined by standard protocols (12).

Ad5 construction. To optimize the expression of recombinant proteins, we genetically engineered new Ad5 vectors. pAd5-Blue, which contains the CMV promoter/enhancer for the control of foreign gene expression and a functional LacZ gene fragment (53), was digested with ClaI and XbaI to remove the Amp and LacZ genes, and the Renilla luciferase gene (pRL-TK; Promega, Madison, WI) was inserted, creating pAd5-RL. A unique BstBI site was added directly upstream of the CMV promoter/enhancer of pAd5-RL by site-directed mutagenesis, and this vector was then digested with BstBI/ClaI to remove the CMV promoter/enhancer region. The CMV promoter/enhancer, intron, and T7 promoter region from the vector pCI (Promega) was PCR amplified with primers containing BstBI and ClaI sites at their 5' and 3' ends, respectively, and inserted into BstBI- and ClaI-digested pAd5-RL to form pAd5-CI-RL. The bovine growth hormone poly(A) signal from pcDNA3 (Invitrogen, Carlsbad, CA) was PCR amplified with a forward primer containing an XbaI site and a reverse primer containing an NheI site and subsequently cloned into the XbaI site of pAd5-CI-RL to form pAd5-CI-RL-BGH. This vector expressed higher levels of luciferase than our original Ad5 vector containing the CMV promoter/enhancer (unpublished data). To construct Ad5-CI vectors containing IFN-{alpha} and -ß genes, pAd5-pIFN-{alpha} and pAd5-pIFN-ß were digested with ClaI and XbaI and the IFN coding regions were cloned into ClaI- and XbaI-digested pAd5-CI-RL-BGH, resulting in pAd5-CI-pIFN-{alpha} and pAd5-CI-pIFN-ß, respectively. PacI-linearized plasmids were transfected into 293 cells to generate Ad5-CI-pIFN-{alpha} and Ad5-CI-pIFN-ß as previously described (53).

The pIFN-{gamma} gene was obtained by PCR amplification of cDNA derived from RNA extracted from concanavalin A-treated porcine lymphocytes by using a forward primer containing a ClaI site (in bold), CTAGCGATCGATGAGTTATACAACTTATTTCTTAGCTTTTC, and a reverse primer containing an XbaI site (in bold), TGCAGTCTAGATTATTTTGATCTCTCTGCCCTTGGAACATA. The amplified PCR product was sequenced and cloned into pAd5-CI-RL-BGH as described above.

Expression of pIFN-{alpha}, -ß and -{gamma} proteins. IBRS-2 cells were infected with Ad5-CI-pIFN-{alpha} or Ad5-CI-pIFN-ß at a multiplicity of infection (MOI) of 20, and 24 h postinfection (p.i.), the supernatants were removed, centrifuged through a Centricon 100 filter at 2,000 rpm for 10 min, and acid treated as previously described (77). A similar procedure was used for pIFN-{gamma}, but the supernatant of infected IBRS-2 cells was not acid treated since IFN-{gamma} is acid sensitive.

IFN biological assays and plaque reduction assay. IBRS-2 cells were incubated with dilutions of supernatants containing pIFN-{alpha}, pIFN-ß, or pIFN-{gamma} or combinations of two IFNs. After 24 h, supernatants were removed, and the cells were infected for 1 h with approximately 100 PFU of FMDV serotype A12 and overlaid with gum tragacanth. Plaques were visualized 24 h later by being stained with crystal violet (18, 19). Antiviral activity was reported as the reciprocal of the highest supernatant dilution that resulted in a 50% reduction in the number of plaques relative to the number of plaques in untreated infected cells.

Serial dilutions of plasma samples, starting at a 1:25, were incubated with IBRS-2 cells for 24 h, and the cells were subsequently infected and treated as described above. To neutralize the antiviral activity, pIFN-{alpha} monoclonal antibody (MAb) F17 (PBL Biomedical Laboratories, Piscataway, NJ) and pIFN-{gamma} MAb P2C11 (Pierce Endogen, Rockford, IL) were used.

Virus yield assay. IBRS-2 cells were incubated overnight with dilutions of IFN-containing supernatants. Supernatants were removed and cells washed with minimal essential medium (MEM; Gibco BRL/Invitrogen). Cells were infected at an MOI of 1 with FMDV A12 for 1 h, and unabsorbed virus was inactivated by washing the cells with 150 mM NaCl, 20 mM morpholineethanesulfonic acid (MES) (pH 6). MEM was added, and incubation continued for 24 h. Virus was released by one freeze-thaw cycle. As a control, infected cells were frozen and thawed at 1 h p.i. Virus yields were determined by plaque assay on BHK-21 cells and expressed by subtracting the titers of virus in cells infected for 1 h from the 24-h titers.

Animal experiments. The animal experiment was performed in the secure disease agent isolation facilities at the Plum Island Animal Disease Center according to a protocol approved by the Institutional Animal Care and Use Committee. In this experiment, 18 Yorkshire gilts (approximately 35 to 40 lb) were divided into six groups containing three animals per group and each group was housed in a separate room. All animals were inoculated intramuscularly with 2 ml of the various Ad5s as indicated in Table 5, and each animal received a total of 1010 PFU of Ad5. The animals were monitored clinically for adverse effects from Ad5-CI-pIFN-{alpha} and Ad5-CI-pIFN-{gamma} administration, including fever and lethargy, and plasma was obtained daily to assay for antiviral activity and the presence of pIFN-{alpha} and pIFN-{gamma} by enzyme-linked immunosorbent assay (ELISA) (see below). All animals in the above-described groups were challenged 1 day p.i. with 105 PFU of FMDV serotype A24, i.e., 13 50% pig infectious doses, at two sites in the heel bulb of the left rear foot (27, 60). This route of challenge in swine is one recommended by the OIE (4) and has been used previously by us and many other investigators (14, 15, 19, 45, 66, 75). The animals were monitored for 3 weeks after challenge. Rectal temperatures, lesion data, and the physical conditions of the animals were determined daily. Blood and nasal swab specimens were collected daily for the first 7 days after challenge, and serum samples were collected weekly. Lesion scores of the animals were determined at 14 days postchallenge (dpc) by determining the number of digits with lesions and adding the snout and tongue combined, if vesicles were present (maximum score, 17).


View this table:
[in this window]
[in a new window]

 
TABLE 5. Clinical outcome of swine inoculated with Ad5s and challenged with FMDV

Serology and virus titration. Serum samples were heated at 56°C for 30 min, and aliquots were stored at –70°C. Sera were tested for the presence of neutralizing antibodies against FMDV in a plaque reduction neutralization assay (48). Neutralizing titers were reported as the serum dilution yielding a 70% reduction in the number of plaques.

Heparinized blood was collected on the day of challenge (0 dpc) and daily for the first 7 dpc, and aliquots were frozen at –70°C. Viremia was determined by a standard plaque assay of BHK-21 cells. Plasma was obtained by centrifugation of heparinized blood at 2,500 rpm for 10 min and examined for antiviral activity and for the level of pIFN-{alpha} and pIFN-{gamma} by ELISA as described below. Nasal swab specimens were obtained on the day of challenge and daily for 7 days after challenge. Virus was isolated from the swab samples by duplicate inoculation of monolayers of IBRS-2 cells in 24-well plates. The monolayers were incubated at 37°C with 5% CO2 and examined at 24, 48, and 72 h for cytopathic effect. Negative samples were frozen and thawed, and a second passage was performed. For positive samples, titration was performed from the original samples by a standard plaque assay of BHK-21 cells.

pIFN-{alpha} ELISA. A slightly modified double-capture ELISA previously developed in our lab was used for the quantitation of IFN-{alpha} (77). Nonfat dry milk (5%) in phosphate-buffered saline (PBS) containing 0.05% Tween 20 (PBST) was used instead of 5% goat serum in PBST as the blocking buffer. The pIFN-{alpha} concentrations were calculated by linear regression analysis of a standard curve generated with recombinant pIFN-{alpha} (PBL Biomedical Laboratories).

pIFN-{gamma} ELISA. A standard antigen capture ELISA was performed as previously described (8). Briefly, anti-pIFN-{gamma} MAb P2G10 was used as the capture antibody (BD Pharmingen, San Diego, CA). Recombinant pIFN-{gamma}, used as a standard, was purchased from BioSource International (Camarillo, CA). Biotinylated mouse anti-pIFN-{gamma} MAb P2C11 (BD Pharmingen) was used as the detecting antibody at a final concentration of 1 µg/ml. The concentration of pIFN-{gamma} in the plasma was determined by extrapolation from a standard curve.

RIP of cell lysates infected with [35S]methionine-labeled FMDV A24. Lysates of radiolabeled-FMDV A24-infected IBRS-2 cells were incubated with serum from a convalescent-phase, FMDV-infected bovine or with individual serum samples from 0- and 21-dpc swine and examined for the presence of antibodies specific to FMDV structural and NS polypeptides by radioimmunoprecipitation (RIP) (50). After 60 min of incubation at room temperature (RT), antibodies were precipitated with Streptococcus aureus protein G and eluted proteins were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis on a 15% gel and visualized by autoradiography.

3ABC ELISA. Detection of anti-3ABC antibody in swine serum samples was carried out with a commercial ELISA kit (Ceditest FMDV-NS; Cedi Diagnostic B.V., Lelystad, The Netherlands) based on the protocol provided by the manufacturer (70). Eighty microliters of ELISA buffer was added first to each well of a dried assay plate. Twenty-microliter samples of each testing serum and of the negative-control solution, weakly positive standard solution, and positive standard solution were added to different wells of the plate. After overnight incubation (16 h) at RT, the plate was washed six times with 1x wash solution using a plate washer. Antibody-horseradish peroxidase (HRP) conjugate was added to the plate (100 µl/well), and the plate was incubated for 1 h at RT and washed as described above. Next, HRP chromogenic substrate solution was added to the plate (100 µl/well) and incubated for 20 min at RT. The reaction was terminated by the addition of stop solution (100 µl/well). The optical density (OD) at 450 nm of the reaction product in each well was determined with an ELISA reader (VersaMax; Molecular Devices, Sunnyvale, CA). The antibody level of each sample was expressed as percent inhibition (PI) as follows: 100 – [100 x (ODsample/ODmax)], where ODmax is the OD value of the negative-control wells (maximum value). A sample was considered positive for anti-3ABC antibody when its PI was greater than 50% (a cutoff determined by the manufacturer).

3D ELISA. The amount of anti-3D antibody in serum samples was determined by using a liquid-phase-blocking ELISA based on a baculovirus-expressed FMDV 3D protein (51) and biotinylated bovine anti-FMD immunoglobulin G as the detector antibody. The assay is described briefly below, and a detailed protocol and characterization of the assay performance will be reported elsewhere. The assay was carried out at RT, and all washes were done three times with PBST. Twenty-five microliters of test serum was mixed with 100 µl PBST containing purified 3D at a predetermined concentration. A 50-µl aliquot of this serum-3D mix was added in duplicate to a 96-well plate (Maxisorp; Nunc, Denmark) that had previously been coated with rabbit anti-3D antibody. The plate was incubated for 60 min and washed. Biotinylated bovine anti-FMD immunoglobulin G, at a predetermined concentration, was added to the plate (50 µl/well) for 60 min, and the plate was washed. Anti-biotin MAb-HRP conjugate was added (1:5,000 dilution in PBST, 50 µl/well; Jackson ImmunoResearch Laboratories, West Grove, PA) for 30 min, and the plate was washed. Finally, a chromogen HRP substrate solution, tetramethyl benzidine (Sigma, St. Louis, MO), was added to the plate (100 µl/well), and the reaction was developed for 10 min and terminated by the addition of an equal volume of 1 M H2SO4. The OD of the chromogenic reaction product at 450 nm was determined with an ELISA reader (VersaMax; Molecular Devices), and the average from duplicate wells with each sample was obtained. The antibody level of each sample was expressed as PI by means of the following formula: 100 – [100 x (ODsample/ODmax)], where ODmax is the value for diluent control wells. A sample was considered 3D antibody positive when its PI was greater than 20%.

Analysis of ISGs. Expression of ISGs was analyzed in cultured IBRS-2 cells or purified peripheral blood mononuclear cells (PBMCs) isolated from experimentally vaccinated animals. IBRS-2 cells were directly infected with Ad5-Blue (MOI = 20), Ad5-CI-pIFN-{alpha} (MOI = 10) and Ad5-Blue (MOI = 10), Ad5-CI-pIFN-{gamma} (MOI = 10) and Ad5-Blue (MOI = 10), or Ad5-CI-pIFN-{alpha} (MOI = 10) and Ad5-CI-pIFN-{gamma} (MOI = 10) for 24 h. Alternatively, monolayers of IBRS-2 cells were incubated for 24 h with pretreated supernatants derived from similar cells infected with the above-mentioned Ad5s and containing 100 units of pIFN-{alpha}, 100 units of pIFN-{gamma}, or 100 units each of pIFN-{alpha} and pIFN-{gamma}. PBMCs were purified from heparinized blood using Lymphoprep (Axis-Shield, Oslo, Norway). RNA was extracted from approximately 107 cells (IBRS-2 cells or PBMCs) by utilizing an RNeasy miniprep kit (QIAGEN, Valencia, CA), and a quantitative real-time reverse transcription-PCR was used to evaluate the mRNA levels of several ISGs. Approximately 1 µg of RNA was treated with DNase I (Sigma, St. Louis, MO) and was used to synthesize cDNA with Moloney murine leukemia virus reverse transcriptase (Invitrogen) and random hexamers according to the manufacturer's directions. An aliquot (1/40) of the cDNA was used as the template for a real-time PCR using TaqMan universal PCR master mix (Applied Biosystems, Foster City, CA). Primers and TaqMan minor-groove binding (MGB) were designed with Primer Express software v.1.5 (Applied Biosystems) or obtained from the PIN database (http://ars.usda.gov/Services/docs.htm?docid=6065). 18S rRNA or porcine glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control to normalize the values for each sample. The sequences of primers and probes that were used are listed in Table 3. Reactions were performed in an ABI Prism 7000 sequence detection system (Applied Biosystems). Relative mRNA levels were determined by comparative cycle threshold analysis (user bulletin 2; Applied Biosystems) utilizing as a reference the samples at 0 dpc for the animal experiment or the mock-treated samples for the cultured IBRS-2 cells. For statistical analysis, Student's t test was performed using Microsoft Excel.


View this table:
[in this window]
[in a new window]

 
TABLE 3. Oligonucleotide primer and probe sequences for amplification of pIFNs and ISGs used in real-time reverse transcription-PCR


arrow
RESULTS
 
Antiviral effect of pIFN-{gamma}. We previously constructed an Ad5 vector containing the pIFN-{alpha} gene under the control of the CMV promoter/enhancer (19). In the current study, we constructed additional Ad5 vectors containing this gene as well as pIFN-{gamma} with both genes under the control of a modified CMV promoter (Ad5-CI) (see Materials and Methods). We examined the expression of each cytokine by infection of IBRS-2 cells (Table 1). Interestingly, we found by real-time reverse transcription-PCR that pIFN-{alpha} mRNA was expressed at 10- to 12-fold-lower levels than pIFN-{gamma} mRNA, yet the level of pIFN-{alpha} protein detected in supernatants was 160- to 440-fold higher than the level of pIFN-{gamma}.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Expression of pIFN-{alpha} and pIFN-{gamma} in IBRS-2 cells infected with recombinant Ad5s

The biological activity of IFN-{gamma} was determined by a plaque reduction assay in IBRS-2 cells (19). As shown in Table 1, IFN-{gamma} as well as IFN-{alpha} has antiviral activity against FMDV. We examined the effects of these IFNs as well as pIFN-ß on the FMDV yield in an overnight infection. Approximately 10 to 100 units of either IFN-{alpha} or IFN-ß can reduce the virus yield between 5,000- and 60,000-fold, while an equivalent amount of IFN-{gamma} reduces the virus yield by 2,000- to 5,000-fold (data not shown). Higher concentrations of IFN-{alpha} or IFN-ß had little or no additional effect.

Synergistic effect of type I and type II IFNs. To determine if a combination of IFN-{alpha} and IFN-{gamma} had an enhanced antiviral effect compared to that of the individual IFNs, approximately 1 unit of IFN-{alpha} or IFN-{gamma} was titrated with various amounts of the other IFNs and analyzed by a plaque reduction assay on IBRS-2 cells. As shown in Table 2, 1 unit of IFN-{alpha} alone reduced the number of plaques by ~50%, and this antiviral effect was significantly enhanced when combined with amounts of IFN-{gamma} as low as 0.062 unit. The effect was not as dramatic when the reciprocal experiment was performed. The level of inhibition was not a result of doubling the total amount of IFN, since the addition of either 2 units of IFN-{alpha} or IFN-{gamma} individually did not achieve a comparable degree of inhibition (Table 2). Similar results were obtained when 1 unit of pIFN-ß was titrated with various amounts of pIFN-{gamma} (data not shown). The specificity of the IFN effect was demonstrated by the addition of neutralizing MAbs against either pIFN-{alpha} or pIFN-{gamma}. Each antibody partially abolished the antiviral activity of the IFN combination, while pretreatment with both MAbs completely inhibited the antiviral activity (Fig. 1).


View this table:
[in this window]
[in a new window]

 
TABLE 2. pIFN-{alpha} and pIFN-{gamma} synergistically inhibit FMDV plaque formation


Figure 1
View larger version (67K):
[in this window]
[in a new window]

 
FIG. 1. Neutralization of IFN activity by MAbs. MAbs K9 against pIFN-{alpha} (a-pIFN-{alpha}) and P2C11 against pIFN-{gamma} (a-pIFN-{gamma}) as well as normal mouse serum (NMS) were diluted 1:500 and incubated individually or together for 1 h at RT with 1 unit of pIFN-{alpha} and 1 unit of pIFN-{gamma}. Treated or untreated pIFNs were incubated with IBRS-2 cells for 24 h and infected with approximately 100 plaques of FMDV. Plaques were detected by crystal violet staining.

We also examined the effect of a combination of 1 or 2 units of IFN-{alpha} and various amounts of IFN-{gamma} on FMDV yield after a 24-h infection (Fig. 2). The combination of 2 units of IFN-{alpha} and 5 units of IFN-{gamma} reduced the virus yield by approximately 171-fold compared to the yield of either pretreatment alone.


Figure 2
View larger version (28K):
[in this window]
[in a new window]

 
FIG. 2. Effect of pIFN-{alpha} and pIFN-{gamma} on the yield of FMDV A12 in IBRS-2 cells. (A) Cells were pretreated for 24 h with various amounts of pIFN-{alpha} or pIFN-{gamma} and 24 h later infected with FMDV. After a 1-h adsorption, the cells were rinsed with 150 mM NaCl-20 mM MES (pH 6) and with MEM. Supernatants were collected at 1 and 24 h p.i. and titrated on BHK-21 cells. The results are expressed as the virus titer (number of PFU per ml) at 24 h p.i. after subtracting the titers at 1 h p.i. (B) Cells were pretreated with 1 or 2 units of pIFN-{alpha} plus increasing amounts of pIFN-{gamma} and 24 h later infected with FMDV as described above. The results are expressed as the virus titer (number of PFU per ml) at 24 h p.i. after subtraction of the titers at 1 h p.i.

Genes induced by pIFN-{alpha}, pIFN-{gamma}, or a combination of pIFN-{alpha} and pIFN-{gamma} in swine cells. Since the swine genome has not yet been completely sequenced, in our initial attempt to understand the basis for the synergistic antiviral effect of the combined IFNs, we examined a set of genes known to be induced by each IFN and whose sequences are available (Table 3). IBRS-2 cells were treated with 100 units of pIFN-{alpha}, pIFN-{gamma}, or a combination of the two, and 24 h later, RNA was extracted and analyzed by real-time reverse transcription-PCR.

As we have previously shown, three genes known to be induced by IFN-{alpha}, the OAS, Mx1, and PKR genes, had enhanced levels of mRNA after the treatment of cells with this cytokine (18, 23) (Table 4). There was also a significant induction of INDO, the 10-kDa IFN-{gamma}-inducible protein (IP-10; also referred to as CXCL10 in GenBank), and RANTES (stands for regulated on activation, normal T-cell expressed and secreted). Similarly, treatment with IFN-{gamma} significantly enhanced the levels of INDO, iNOS, and IP-10, three genes known to be induced by IFN-{gamma}, as well as the levels of IFN-ß, IFN-regulatory factor 1 (IRF1), Mx1, OAS, and RANTES. In the combined treatment, the level of OAS was enhanced by about 40% compared to its levels after the individual treatments, while the level of Mx1 was decreased by about 20%, IRF1 by about 45%, and IFN-ß by threefold.


View this table:
[in this window]
[in a new window]

 
TABLE 4. Induction of ISGs by pIFN-{alpha}, pIFN-{gamma}, and the combination of pIFN-{alpha} and pIFN-{gamma}

In a similar experiment, we infected IBRS-2 cells with Ad5-pIFN-{alpha}, Ad5-pIFN-{gamma}, the combination Ad5-pIFN-{alpha} and Ad5-pIFN-{gamma}, and a control Ad5. The infection was stopped at 24 or 48 h p.i., RNA was extracted, and real-time reverse transcription-PCR was performed. Table 4 shows that after Ad5 infections, there was an induction of the same genes that responded to the treatment with individual IFN proteins. The combined treatment, however, resulted in a synergistic increase in the expression of two IFN-{gamma}-inducible genes, INDO and IP-10 (by two- to fourfold), and a synergistic increase (two- to threefold) in OAS and Mx1 at 48 h p.i. Similar results were obtained when the two experiments described above were repeated.

Effect of Ad5-CI-pIFN-containing viruses on clinical response against FMDV. As a result of these cell culture experiments, we initiated a study of swine to determine if the combined IFNs could induce a synergistic antiviral and rapid protective response. The dose of Ad5-CI-pIFN-{alpha} used was 108 PFU/animal based on previous animal experiments in which we found that swine inoculated with this dose of a similar vector expressed low levels of IFN-{alpha} but were not completely protected from direct FMDV challenge, while swine inoculated with 109 PFU/animal produced significantly higher levels of biologically active IFN-{alpha} and were sterilely protected when challenged 1 to 3 days later (19, 34). Since we found that Ad5-CI-pIFN-{gamma} expressed significantly lower levels of recombinant protein than Ad5-CI-pIFN-{alpha} in infected IBRS-2 cells (Table 1), in the current study, we used 109 and 1010 PFU of Ad5-CI-pIFN-{gamma}/animal.

Utilizing this information, we inoculated groups of swine with presumably nonprotective doses of Ad5-CI-pIFN-{alpha} or Ad5-CI-pIFN-{gamma} alone or combinations of the two (Table 5). Groups of three swine were inoculated intramuscularly with the various Ad5 viruses, and all animals received a combined dose of 1010 PFU by the addition of the control Ad5-VSVG virus when required. A control group (group 1) received Ad5-VSVG, group 2 received 108 PFU of Ad5-pIFN-{alpha}/animal, group 3 received 109 PFU of Ad5-CI-pIFN-{gamma}, group 4 received 1010 PFU of Ad5-CI-pIFN-{gamma}, group 5 received 108 PFU of Ad5-pIFN-{alpha} plus 109 PFU of Ad5-CI-pIFN-{gamma}, and group 6 received 108 PFU of Ad5-pIFN-{alpha} plus 1010 PFU Ad5-CI-pIFN-{gamma}. Animals were challenged 1 day postinoculation.

All animals in the control group developed clinical signs of disease by 2 dpc and had a significant lesion score (Table 5). Two of three animals in the groups that received a low dose of pIFN-{alpha} (group 2) or the lower dose of pIFN-{gamma} (group 3) had delayed clinical signs. In contrast, the groups given the high dose of pIFN-{gamma} alone (group 4) or pIFN-{alpha} combined with high-dose pIFN-{gamma} (group 6) never developed any clinical disease. Most strikingly, the group given the combination of pIFN-{alpha} and the lower dose of pIFN-{gamma} (group 5), which individually only delayed the onset of clinical disease, resulted in the complete inhibition of vesicular lesions.

Serological response to and effect of Ad5-CI-pIFN-containing viruses on protection against FMDV. All animals were assayed for their antiviral response as well as for the presence of pIFN-{alpha} and pIFN-{gamma} in their plasma. None of the animals had detectable levels of antiviral activity or IFNs (data not shown).

The control group (group 1) developed viremia at 1 to 2 dpc (Table 5). Viremia lasted for 5 to 6 days and reached a peak of greater than 106 PFU/ml. All the animals in the groups given only IFN-{alpha} (group 2) or the lower dose of IFN-{gamma} (group 3) developed viremia, but viremia was delayed and lasted for a shorter period of time than in control animals and the titer of virus was generally 10-fold lower than that of the control group. The three groups that were protected from clinical disease (groups 4 to 6) never developed viremia. Virus was also detected in the nasal swab specimens of the control group and the groups given only IFN-{alpha} or the lower dose of IFN-{gamma}, although the latter group had 5- to 10-fold-lower levels of virus than the control animals. No virus was detected in the nasal swab specimens of the protected animals.

All animals in the groups that developed clinical disease had significant levels of FMDV-specific neutralizing antibodies at 21 dpc, while the protected groups had only very low levels of neutralizing antibody (Table 6).


View this table:
[in this window]
[in a new window]

 
TABLE 6. Antibody response against FMDV A24 in swine at 21 dpc

Antibody response against NS proteins and effect of Ad5-CI-pIFN-containing viruses on protection against FMDV. All animals in the groups that developed clinical disease had antibodies at 21 dpc against viral NS proteins as detected by a number of assays, including ELISAs against 3D and 3ABC, a 3D agar gel immunodiffusion assay, and RIP (Table 6 and Fig. 3). In contrast, none of the protected animals showed evidence of induction of antibodies against viral NS proteins by these assays, while by RIP (Fig. 3) and the neutralization assay (Table 6) there was evidence of antibodies against the viral structural proteins.


Figure 3
View larger version (82K):
[in this window]
[in a new window]

 
FIG. 3. RIP of FMDV A24-infected cell lysates with 21-dpc swine sera. [35S]methionine-labeled cell lysates from FMDV A24-infected IBRS-2 cells were immunoprecipitated with 21-dpc swine sera. Lane 1, bovine convalescent-phase serum; lane 2, 0-dpc serum from swine 69; lanes 3 to 20, 21-dpc serum from swine 62 to 79 in the groups indicated in the figure. Immunoprecipitated samples were examined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Ctl, control; Comb., combination.

Genes induced in challenged animals. Because of the large number of samples, we selected only groups 1, 2, 4, and 6 to examine the induction of ISGs. As seen in Table 7, there was no statistically significant enhancement of any of the ISGs in groups 1 and 2, although there was a low level of induction of iNOS in group 2. The induction of IRF1 in group 2 was due to only one animal, no. 67. In group 4, given the high dose of Ad5-CI-pIFN-{gamma}, there was an induction of INDO and IP-10 mRNA on days 1 and 2 postinoculation, but on day 3, these mRNAs were induced only in the animal that had the highest levels of induction on the other days, animal 71 (data not shown). In group 6, which was given the combination of Ad5-CI-pIFN-{alpha} and the high dose of Ad5-CI-pIFN-{gamma}, there were statistically significant levels of induction of INDO and IP-10 mRNA compared to levels of induction in groups 1 and 2 (P < 0.05). There was also a low-level, but consistent, induction of OAS in all three animals in group 6 on days 1 and 3. Furthermore, there was a synergistic increase in the level of induction of INDO and IP-10 mRNAs in this group compared to induction levels in groups 2 and 4. As we have previously observed, the standard deviation for these mRNAs was large because of the variations in the responses in outbred animals (22); nevertheless, each animal in group 6 had a significant induction of INDO and IP-10 mRNAs on all 3 days examined (data not shown).


View this table:
[in this window]
[in a new window]

 
TABLE 7. Induction of ISGs in swine white blood cells


arrow
DISCUSSION
 
We have previously demonstrated that FMDV replication is inhibited by the pretreatment of cells with IFN-{alpha}/ß and that swine inoculated with Ad5-pIFN-{alpha} are protected from clinical disease and virus replication when challenged 1 day later (18, 19). However, we found that this approach is only partially effective for cattle (77). To improve the ability to rapidly limit and/or block FMDV replication in susceptible animals, we examined the potential of a combination of IFN-{alpha} and IFN-{gamma} as a treatment strategy. It has been demonstrated that this combination can synergistically inhibit the replication of a number of viruses in cell culture (6, 25, 58, 62, 63) and can also result in improved responses to virus infection in various animal models (30, 46, 61, 74). Our data demonstrate that in cell culture, the combination approach synergistically blocked FMDV replication and that treated swine were sterilely protected from virus challenge.

To examine the effect of IFN-{gamma} on FMDV replication in cell culture, we constructed an Ad5 vector containing the pIFN-{gamma} gene. We found that supernatants obtained from cells infected with this virus have antiviral activity against FMDV in porcine cells. This antiviral activity is pIFN-{gamma} specific since it is inhibited by a MAb directed against pIFN-{gamma}. These results support previous data from Zhang et al. (79) which showed that pretreatment of primary bovine thyroid cells with bovine IFN-{gamma} profoundly reduced FMDV RNA and protein synthesis. Furthermore, we found that compared with the results of individual treatments, the combination of pIFN-{alpha} and pIFN-{gamma} synergistically reduced both plaque number and virus yield (Table 2 and Fig. 2B).

We have previously shown that two IFN-{alpha}-stimulated gene products, PKR and OAS, are involved in the inhibition of FMDV replication (18, 23). To understand the basis of the IFN-{gamma}-induced inhibition of FMDV replication as well as the mechanism of the synergistic antiviral activities of the combined IFNs, we examined the effect of these treatments in cell culture on known ISGs. Since the swine genome has not yet been completely determined, we selected well-characterized genes that have been shown to be induced by IFN-{alpha}, i.e., Mx1, OAS, PKR, and RANTES, as well as by IFN-{gamma}, i.e., INDO, iNOS, IP-10, and IRF1. In cells treated with IFNs, the mRNAs for the above-named genes were significantly induced, while in cells infected with the combination Ad5s, we also observed a two- to fourfold synergistic induction of expression of INDO and IP-10 as well as an approximately two- to threefold synergistic increase in Mx1 and OAS at 48 h p.i. (Table 4). At present, we do not know if INDO and IP-10 or other IFN-{gamma}-stimulated genes are involved in the inhibition of FMDV replication, but experiments are planned to address this question.

To extend these studies to animals, we needed to determine doses of each Ad5 vector that individually would not protect against FMDV challenge but combined would limit or preferably block clinical disease. Based on previous animal experiments, we selected a dose of 108 PFU of Ad5-CI-pIFN-{alpha}/animal (19), while our selection of a dose of Ad5-CI-pIFN-{gamma} was the result of the cell culture expression studies (Table 1).

It has been shown by Muruve and coworkers (55, 56) that the Ad5 particle can rapidly induce an innate immune response which is transient and dose dependent. We have also previously found that swine inoculated with a control Ad5 vector developed an antiviral response and detectable IFN-{alpha} at 4 h p.i., which peaked at 10 h p.i. and was absent by 24 h (52). Therefore, to compensate for the potential antiviral effect induced by the vector alone, we inoculated all animals with the same dose of Ad5 utilizing a control Ad5 vector, Ad5-VSVG, to adjust the total dose.

Groups administered the control virus (Ad5-VSVG), Ad5-CI-pIFN-{alpha} alone, or the low dose of Ad5-CI-pIFN-{gamma} developed clinical disease and viremia, but in all animals in the last two groups, viremia was approximately 10-fold lower than in the control group and lasted for a shorter time, and the onset of clinical disease was generally delayed (Table 5). Most significantly, the combination of 108 PFU of Ad5-CI-pIFN-{alpha} and 109 PFU of Ad5-CI-pIFN-{gamma}, which individually did not protect, induced complete protection in all animals. Furthermore, the animals in this group did not have detectable viremia or virus in nasal swab specimens and did not develop antibodies against the viral NS proteins, as determined by a number of assays (Table 6). These results indicate that all the animals in this group were sterilely protected. Similarly, the groups given the high dose of Ad5-CI-pIFN-{gamma} or the combination of Ad5-CI-pIFN-{alpha} and the high dose of Ad5-CI-pIFN-{gamma} were also sterilely protected. Surprisingly, we were not able to detect antiviral activity or pIFN-{alpha} or pIFN-{gamma} protein in the plasma of the animals in any of the protected groups. Previously, we had demonstrated a correlation between the level of antiviral activity, pIFN-{alpha} protein, and protection when we administered a 10-fold-higher dose of Ad5-pIFN-{alpha} (19, 33, 52).

What is the mechanism of protection induced by this treatment regimen? As an initial approach to address this question, we examined gene expression in PBMCs. Unfortunately, limited by the large number of samples, we did not include the group inoculated with the combination of Ad5-CI-pIFN-{alpha} and the low dose of Ad5-CI-pIFN-{gamma}. Nevertheless, consistent with the results that we obtained by cell culture, we did detect the induction of mRNAs for two IFN-{gamma}-stimulated genes, the INDO and IP-10 genes, in the two protected groups that we examined, i.e., the group given the high dose of Ad5-CI-pIFN-{gamma} alone and the group given the combination of Ad5-CI-pIFN-{alpha} and the high dose of Ad5-CI-pIFN-{gamma}, but not in the unprotected groups, i.e., the control group and the group given Ad5-CI-pIFN-{alpha} alone. Furthermore, there was a synergistic increase in the expression of these two genes at 1 to 3 days postadministration in the group given the combination of Ad5-CI-pIFN-{alpha} and the high dose of Ad5-CI-pIFN-{gamma}. The induction of these genes was statistically significant (P < 0.05) compared to the levels of expression obtained for the control and Ad5-CI-pIFN-{alpha} groups. There was also somewhat more than an additive increase in OAS mRNA in this group.

While our limited examination of gene expression cannot definitively explain the mechanism of protection afforded by the combination IFN treatment or the high-dose-IFN-{gamma} treatment, it does identify some candidate genes or gene classes that may be involved. For example, IP-10 is a chemokine that is involved in the recruitment of T cells (11, 28) and NK cells to sites of infection (5, 40, 47, 71, 73). NK cells are involved in the rapid, innate response to a variety of pathogens, including viruses. These cells predominate in the peripheral blood and spleen but can be induced to traffic to other compartments during infection (65). Thus, the induction of IP-10 by IFN-{gamma} treatment and its synergistic induction by the combined treatment suggest that the presence of this gene product at the time of infection may allow the very rapid recruitment of cells that have an essential role in viral clearance. Additional chemokines are induced by both type I and II IFNs (38, 64) and are also involved in the trafficking of NK cells as well as macrophages to sites of viral infection (64) and possibly in modulating NK cell-mediated cytolytic responses (71). The possible role that these or other chemokines may play in the IFN-{alpha}/{gamma}-induced protection against FMDV needs to be examined.

The second gene that was synergistically induced by the combination IFN treatment is the INDO gene, which encodes an enzyme involved in the tryptophan degradation pathway. It has been demonstrated that the antiviral activity of IFN-{gamma} against a number of viruses, including human CMV (10), herpes simplex virus type I (1), and measles virus (57), correlates with the induction of INDO.

Other studies have demonstrated that IFN-{gamma} has antiviral activity against another member of the picornavirus family, i.e., coxsackievirus (36, 37, 39), and that there is a correlation with the IFN-{gamma}-induced protection and induction of iNOS (37). Our results indicate that iNOS mRNA is only minimally induced in treated cells compared to the induction of INDO and IP-10 mRNAs and not induced in swine treated with type I or II IFNs.

Clearly, type I and II IFNs induce many genes that either have direct antiviral activity or indirectly induce the activation of a variety of antiviral pathways. The information obtained in this study suggests that genes having both types of activity are upregulated by the combination IFN treatment and may cooperatively control FMDV infection. In subsequent experiments, we will attempt to identify the various leukocyte populations attracted to tissues at the sites of virus infection in animals treated with the Ad5-IFN vectors as well as examine gene expression in these tissues and in PBMCs. Utilizing a comprehensive understanding of the multiple host pathways that can be induced to rapidly control FMDV infection, we hope to develop more-effective disease control strategies, including the administration of antivirals in combination with our Ad5-FMD marker vaccine.


arrow
ACKNOWLEDGMENTS
 
This research was supported in part by the Plum Island Animal Disease Research Participation Program administered by the Oak Ridge Institute for Science and Education through an interagency agreement between the U.S. Department of Energy and the U.S. Department of Agriculture (appointment of M. P. Moraes) and by CRIS project number 1940-32000-034-00D, ARS, USDA (M. J. Grubman).

We thank Harry Dawson, USDA, ARS, Nutrient Requirements and Function Laboratory, Beltsville, MD, for creating the PIN library with recommendations of reverse transcription-PCR conditions for measuring swine gene expression and the Plum Island animal caretakers for their assistance with the animals.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Plum Island Animal Disease Center, USDA, ARS, NAA, P.O. Box 848, Greenport, NY 11944. Phone: (631) 323-3329. Fax: (631) 323-3006. E-mail: marvin.grubman{at}ars.usda.gov Back

{triangledown} Published ahead of print on 25 April 2007. Back

{dagger} Present address: Laboratory of Gene Engineering, All-Russian Research Institute for Animal Health, Vladimir, Russia. Back


arrow
REFERENCES
 
    1
  1. Adams, O., K. Beskin, C. Oberdorfer, C. R. MacKenzie, O. Takikawa, and W. Daubener. 2004. Role of indoleamine 2,3-dioxygenase in alpha/beta and gamma interferon-mediated antiviral effects against herpes simplex virus infections. J. Virol. 78:2632-2636.[Abstract/Free Full Text]
  2. 2
  3. Ahl, R., and A. Rump. 1976. Assay of bovine interferons in cultures of the porcine cell line IB-RS-2. Infect. Immun. 14:603-606.[Abstract/Free Full Text]
  4. 3
  5. Anonymous. 2002. Infectious disease in livestock. The Royal Society, London, United Kingdom.
  6. 4
  7. Anonymous. 2004. Foot and mouth disease, p. 111-128. In Manual of diagnostic tests and vaccines for terrestrial animals, 5th ed., vol. 1. OIE Biological Standard Commission, Paris, France.
  8. 5
  9. Arai, K., Z. X. Liu, T. E. Lane, and G. Dennert. 2002. IP-10 and Mig facilitate accumulation of T cells in the virus-infected liver. Cell. Immunol. 219:48-56.[CrossRef][Medline]
  10. 6
  11. Balish, M. J., M. E. Abrams, A. M. Pumfery, and C. R. Brandt. 1992. Enhanced inhibition of herpes simplex virus type 1 growth in human corneal fibroblasts by combinations of interferon-alpha and -gamma. J. Infect. Dis. 166:1401-1403.[Medline]
  12. 7
  13. Basler, C. F., and A. Garcia-Sastre. 2002. Viruses and the type I interferon antiviral system: induction and evasion. Int. Rev. Immunol. 21:305-337.[CrossRef][Medline]
  14. 8
  15. Bautista, E. M., D. Gregg, and W. T. Golde. 2002. Characterization and functional analysis of skin-derived dendritic cells from swine without a requirement for in vitro propagation. Vet. Immunol. Immunopathol. 88:131-148.[CrossRef][Medline]
  16. 9
  17. Biron, C. A., and G. C. Sen. 2001. Interferons and other cytokines, p. 321-351. In D. M. Knipe, P. H. Howley, D. E. Griffin, M. Martin, B. Roizman, and S. E. Straus (ed.), Fields virology, 4th ed. Lippincott Williams & Wilkins, Philadelphia, PA.
  18. 10
  19. Bodaghi, B., O. Goueau, D. Zipeto, L. Laurent, J.-L. Virelizier, and S. Michelson. 1999. Role of IFN-gamma-induced indolamine 2,3 dioxygenase and inducible nitric oxide synthase in the replication of human cytomegalovirus in retinal pigment epithelial cells. J. Immunol. 162:957-964.[Abstract/Free Full Text]
  20. 11
  21. Bonecchi, R., G. Bianchi, P. P. Bordignon, D. D'Ambrosio, R. Lang, A. Borsatti, S. Sozzani, P. Allavena, P. A. Gray, A. Mantovani, and F. Sinigaglia. 1998. Differential expression of chemokine receptors and chemotactic responsiveness of type 1 T helper cells (Th1s) and Th2s. J. Exp. Med. 187:129-134.[Abstract/Free Full Text]
  22. 12
  23. Burrows, R. 1966. The foot-and-mouth disease virus in pigs. J. Hyg. (Cambridge) 64:419-429.[Medline]
  24. 13
  25. Cantin, E., B. Tanamachi, and H. Openshaw. 1999. Role for gamma interferon in control of herpes simplex virus type I reactivation. J. Virol. 73:3418-3423.[Abstract/Free Full Text]
  26. 14
  27. Caron, L., M. C. S. Brum, M. P. Moraes, W. T. Golde, C. W. Arns, and M. J. Grubman. 2005. The effect of granulocyte-macrophage colony-stimulating factor on the potency and efficacy of a foot-and-mouth disease virus subunit vaccine. Pesqui. Vet. Bras. 25:150-158.
  28. 15
  29. Cedillo-Barron, L., M. Foster-Cuevas, G. J. Belsham, F. Lefevre, and R. M. Parkhouse. 2001. Induction of a protective response in swine vaccinated with DNA encoding foot-and-mouth disease virus empty capsid proteins and the 3D RNA polymerase. J. Gen. Virol. 82:1713-1724.[Abstract/Free Full Text]
  30. 16
  31. Cheney, I. W., V. C. H. Lai, W. Zhong, T. Brodhag, S. Dempsey, C. Lim, Z. Hong, J. Y. N. Lau, and R. C. Tam. 2002. Comparative analysis of anti-hepatitis C virus activity and gene expression mediated by alpha, beta, and gamma interferons. J. Virol. 76:11148-11154.[Abstract/Free Full Text]
  32. 17
  33. Chesler, D. A., and C. S. Reiss. 2002. The role of IFN-gamma in immune response to viral infections of the central nervous system. Cytokine Growth Factor Rev. 13:441-454.[CrossRef][Medline]
  34. 18
  35. Chinsangaram, J., M. Koster, and M. J. Grubman. 2001. Inhibition of L-deleted foot-and-mouth disease virus replication by alpha/beta interferon involves double-stranded RNA-dependent protein kinase. J. Virol. 75:5498-5503.[Abstract/Free Full Text]
  36. 19
  37. Chinsangaram, J., M. P. Moraes, M. Koster, and M. J. Grubman. 2003. Novel viral disease control strategy: adenovirus expressing alpha interferon rapidly protects swine from foot-and-mouth disease. J. Virol. 77:1621-1625.[CrossRef][Medline]
  38. 20
  39. Chinsangaram, J., M. E. Piccone, and M. J. Grubman. 1999. Ability of foot-and-mouth disease virus to form plaques in cell culture is associated with suppression of alpha/beta interferon. J. Virol. 73:9891-9898.[Abstract/Free Full Text]
  40. 21
  41. Conzelmann, K.-K. 2005. Transcriptional activation of alpha/beta interferon genes: interference by nonsegmented negative-strand RNA viruses. J. Virol. 79:5241-5248.[Free Full Text]
  42. 22
  43. de Avila Botton, S., M. C. S. Brum, E. Bautista, M. Koster, R. Weiblen, W. T. Golde, and M. J. Grubman. 2006. Immunopotentiation of a foot-and-mouth disease virus subunit vaccine by interferon alpha. Vaccine 24:3446-3456.[CrossRef][Medline]
  44. 23
  45. de los Santos, T., S. de Avila Botton, R. Weiblen, and M. J. Grubman. 2006. The leader proteinase of foot-and-mouth disease virus inhibits the induction of beta interferon mRNA and blocks the host innate immune response. J. Virol. 80:1906-1914.[Abstract/Free Full Text]
  46. 24
  47. Der, S. D., A. Zhou, B. R. G. Williams, and R. H. Silverman. 1998. Identification of genes differentially regulated by interferon {alpha}, ß, or {gamma} using oligonucleotide arrays. Proc. Natl. Acad. Sci. USA 95:15623-15628.[Abstract/Free Full Text]
  48. 25
  49. Desloges, N., M. Rahaus, and M. H. Wolff. 2005. Role of the protein kinase PKR in the inhibition of varicella-zoster virus replication by beta interferon and gamma interferon. J. Gen. Virol. 86:1-6.[Abstract/Free Full Text]
  50. 26
  51. Devaney, M. A., V. N. Vakharia, R. E. Lloyd, E. Ehrenfeld, and M. J. Grubman. 1988. Leader protein of foot-and-mouth disease virus is required for cleavage of the p220 component of the cap binding protein complex. J. Virol. 62:4407-4409.[Abstract/Free Full Text]
  52. 27
  53. Doel, T. R., M. Lombard, D. Fawthrop, C. Schermbrucker, and P. Dubourget. 1998. Testing of FMD vaccines. Report of the Session of the Research Group of the Standing Technical Committee of the European Commission for the Control of Foot-and-Mouth Disease, Aldershot, United Kingdom, 14 to 18 September 1998. Food and Agriculture Organization, Rome, Italy.
  54. 28
  55. Dufour, J. H., M. Dziejman, M. T. Liu, J. H. Leung, T. E. Lane, and A. D. Luster. 2002. IFN-{gamma}-inducible protein 10 (IP-10: CXCL10)-deficient mice reveal a role for immnoprecipitation-10 in effector T-cell generation and trafficking. J. Immunol. 168:3195-3204.[Abstract/Free Full Text]
  56. 29
  57. Frese, M., V. Schwarze, K. Barth, N. Kriegr, V. Lohmann, S. Mihm, O. Haller, and R. Bartenschlager. 2002. Interferon-gamma inhibits replication of subgenomic and genomic hepatitis C virus RNAs. Hepatology 35:694-703.[CrossRef][Medline]
  58. 30
  59. Fuchizaki, U., S. Kaneko, Y. Nakamoto, Y. Sugiyama, K. Imagawa, M. Kikuchi, and K. Kobayashi. 2003. Synergistic antiviral effect of a combination of mouse interferon-{alpha} and interferon-{gamma} on mouse hepatitis virus. J. Med. Virol. 69:188-194.[CrossRef][Medline]
  60. 31
  61. Goodbourn, S., L. Didcock, and R. E. Randall. 2000. Interferons: cell signalling, immune modulation, antiviral responses and virus countermeasures. J. Gen. Virol. 81:2341-2364.[Free Full Text]
  62. 32
  63. Graham, F. L., J. Smiley, W. C. Russell, and R. Nairn. 1977. Characteristics of a human cell line transformed by DNA from human adenovirus 5. J. Gen. Virol. 36:59-72.[Abstract/Free Full Text]
  64. 33
  65. Grubman, M. J. 2005. Development of novel strategies to control foot-and-mouth disease: marker vaccines and antivirals. Biologicals 33:227-234.[CrossRef][Medline]
  66. 34
  67. Grubman, M. J., and B. Baxt. 2004. Foot-and-mouth disease. Clin. Microbiol. Rev. 17:465-493.[Abstract/Free Full Text]
  68. 35
  69. Hartshorn, K. L., D. Neumeyer, M. W. Vogt, R. T. Schooley, and M. S. Hirsch. 1987. Activities of interferons alpha, beta, and gamma against human immunodeficiency virus replication in vitro. AIDS Res. Hum. Retrovir. 3:125-133.[Medline]
  70. 36
  71. Henke, A., R. Zell, G. Ehrlich, and A. Stelzner. 2001. Expression of immunoregulatory cytokines by recombinant coxsackievirus B3 variants confers protection against virus-caused myocarditis. J. Virol. 75:8187-8194.[Abstract/Free Full Text]
  72. 37
  73. Henke, A., R. Zell, U. Martin, and A. Stelzner. 2003. Direct interferon-{gamma}-mediated protection caused by a recombinant coxsackievirus B3. Virology 315:335-344.[CrossRef][Medline]
  74. 38
  75. Hokeness, K. L., W. A. Kuziel, C. A. Biron, and T. P. Salazar-Mather. 2005. Monocyte chemoattractant protein-1 and CCR2 interactions are required for IFN-{alpha}/ß-induced inflammatory responses and antiviral defense in liver. J. Immunol. 174:1549-1556.[Abstract/Free Full Text]
  76. 39
  77. Horwitz, M. S., T. Krahl, C. Fine, J. Lee, and N. Sarvetnick. 1999. Protection from lethal coxsackievirus-induced pancreatitis by expression of gamma interferon. J. Virol. 73:1756-1766.[Abstract/Free Full Text]
  78. 40
  79. Kakimi, K., T. E. Lane, S. Wieland, V. C. Asensio, I. L. Campbell, F. V. Chisari, and L. G. Guidotti. 2001. Blocking chemokine responsive to gamma-2/interferon (IFN)-gamma inducible protein and monokine induced by IFN-gamma activity in vivo reduces the pathogenetic but not the antiviral potential of hepatitis B virus-specific cytotoxic T lymphocytes. J. Exp. Med. 194:163-172.
  80. 41
  81. Karupiah, G., R. V. Blanden, and I. A. Ramshaw. 1990. Interferon gamma is involved in the recovery of athymic nude mice from recombinant vaccinia virus/interleukin 2 infection. J. Exp. Med. 172:1495-1503.[Abstract/Free Full Text]
  82. 42
  83. Katze, M. G., Y. He, and M. Gale, Jr. 2002. Viruses and interferon: a fight for supremacy. Nat. Rev. Immunol. 2:675-687.[CrossRef][Medline]
  84. 43
  85. Komatsu, T., Z. Bi, and C. S. Reiss. 1996. Interferon-gamma induced type I nitric oxide synthase activity inhibits viral replication in neurons. J. Neuroimmunol. 68:101-108.[CrossRef][Medline]
  86. 44
  87. Levy, D. E., D. J. Lew, T. Decker, D. S. Kessler, and J. E. Darnell, Jr. 1990. Synergistic interaction between interferon-alpha and interferon-gamma through induced synthesis of one subunit of the transcription factor ISGF3. EMBO J. 9:1105-1111.[Medline]
  88. 45
  89. Liao, P. C., Y. L. Lin, M. H. Jong, and W. B. Chung. 2003. Efficacy of foot-and-mouth disease vaccine in pigs with single dose immunization. Vaccine 21:1807-1810.[CrossRef][Medline]
  90. 46
  91. Liu, G. Q., Shai, D. J. Schaffner, A. Wu, A. Yohannes, T. M. Robinson, M. Maland, J. Wells, T. G. Voss, C. Bailey, and K. Alibek. 2004. Prevention of lethal respiratory vaccinia infections in mice with interferon-{alpha} and interferon-{gamma}. FEMS Immunol. Med. Microbiol. 40:201-206.[CrossRef][Medline]
  92. 47
  93. Loetscher, M., B. Gerber, P. Loetscher, S. A. Jones, L. Piali, I. C. Lewis, M. Baggiolini, and B. Moser. 1996. Chemokine receptor specific for IP-10 and Mig: structure, function, and expression in activated T-lymphocytes. J. Exp. Med. 184:963-969.[Abstract/Free Full Text]
  94. 48
  95. Mason, P. W., M. E. Piccone, T. S. McKenna, J. Chinsangaram, and M. J. Grubman. 1997. Evaluation of a live-attenuated foot-and-mouth disease virus as a vaccine candidate. Virology 227:96-102.[CrossRef][Medline]
  96. 49
  97. Matsumoto, M., N. Tanaka, H. Harada, T. Kimura, T. Yokochi, M. Kitagawa, C. Schindler, and T. Taniguchi. 1999. Activation of the transcription factor ISGF3 by interferon-gamma. Biol. Chem. 380:699-703.[CrossRef][Medline]
  98. 50
  99. Mayr, G. A., J. Chinsangaram, and M. J. Grubman. 1999. Development of replication-defective adenovirus serotype 5 containing the capsid and 3C protease coding regions of foot-and-mouth disease virus as a vaccine candidate. Virology 263:496-506.[CrossRef][Medline]
  100. 51
  101. Meyer, R. F., G. D. Babcock, J. F. Newman, T. G. Burrage, K. Toohey, J. Lubroth, and F. Brown. 1997. Baculovirus expressed 2C of foot-and-mouth disease virus has the potential for differentiating convalescent from vaccinated animals. J. Virol. Methods 65:33-43.[CrossRef][Medline]
  102. 52
  103. Moraes, M. P., J. Chinsangaram, M. C. S. Brum, and M. J. Grubman. 2003. Immediate protection of swine from foot-and-mouth disease: a combination of adenoviruses expressing interferon alpha and a foot-and-mouth disease virus subunit vaccine. Vaccine 22:268-279.[CrossRef][Medline]
  104. 53
  105. Moraes, M. P., G. A. Mayr, and M. J. Grubman. 2001. pAd5-Blue: an easy to use, efficient, direct ligation system for engineering recombinant adenovirus constructs. BioTechniques 31:1050-1056.[Medline]
  106. 54
  107. Moraes, M. P., G. A. Mayr, P. W. Mason, and M. J. Grubman. 2002. Early protection against homologous challenge after a single dose of replication-defective human adenovirus type 5 expressing capsid proteins of foot-and-mouth disease virus (FMDV) strain A24. Vaccine 20:1631-1639.[CrossRef][Medline]
  108. 55
  109. Muruve, D. A. 2004. The innate immune response to adenovirus vectors. Hum. Gene Ther. 15:1157-1166.[CrossRef][Medline]
  110. 56
  111. Muruve, D. A., M. J. Barnes, I. E. Stillman, and T. A. Libermann. 1999. Adenoviral gene therapy leads to rapid induction of multiple chemokines and acute neutrophil-dependent hepatic injury in vivo. Hum. Gene Ther. 10:965-976.[CrossRef][Medline]
  112. 57
  113. Obojes, K., O. Andres, K. S. Kim, W. Daubener, and J. Schneider-Schaulies. 2005. Indoleamine 2,3-dioxygenase mediates cell type-specific anti-measles virus activity of gamma interferon. J. Virol. 79:7768-7776.[Abstract/Free Full Text]
  114. 58
  115. Okuse, C., J. A. Rinaudo, K. Farrar, F. Wells, and B. E. Korba. 2005. Enhancement of antiviral activity against hepatitis C virus in vitro by interferon combination therapy. Antivir. Res. 65:23-34.[CrossRef][Medline]
  116. 59
  117. Pacheco, J. M., M. C. S. Brum, M. P. Moraes, W. T. Golde, and M. J. Grubman. 2005. Rapid protection of cattle from direct challenge with foot-and-mouth disease virus (FMDV) by a single inoculation with an adenovirus vectored FMDV subunit vaccine. Virology 337:205-209.[CrossRef][Medline]
  118. 60
  119. Sa-Carvalho, D., E. Rieder, B. Baxt, R. Rodarte, A. Tanuri, and P. W. Mason. 1997. Tissue culture adaptation of foot-and-mouth disease virus selects viruses that bind to heparin and are attenuated in cattle. J. Virol. 71:5115-5123.[Abstract]
  120. 61
  121. Sainz, B., Jr., and W. P. Halford. 2002. Alpha/beta interferon and gamma interferon synergize to inhibit the replication of herpes simplex virus type I. J. Virol. 76:11541-11550.[Abstract/Free Full Text]
  122. 62
  123. Sainz, B., Jr., H. L. LaMarca, R. F. Garry, and C. A. Morris. 2005. Synergistic inhibition of human cytomegalovirus replication by interferon-alpha/beta and interferon-gamma. Virol. J. 2:14.[CrossRef][Medline]
  124. 63
  125. Sainz, B., Jr., E. C. Mossel, C. J. Peters, and R. F. Garry. 2004. Interferon-beta and interferon-gamma synergistically inhibit the replication of severe acute respiratory syndrome-associated coronavirus (SARS-CoV). Virology 329:11-17.[CrossRef][Medline]
  126. 64
  127. Salazar-Mather, T. P., and K. L. Hokeness. 2003. Calling in the troops: regulation of inflammatory cell trafficking through innate cytokine/chemokine networks. Viral Immunol. 16:291-306.[CrossRef][Medline]
  128. 65
  129. Salazar-Mather, T. P., and K. L. Hokeness. 2006. Cytokine and chemokine networks: pathways to antiviral defense. Curr. Topics Microbiol. Immunol. 303:29-46.[Medline]
  130. 66
  131. Sanz-Parra, A., M. A. Jimenez-Clavero, M. M. Garcia-Briones, E. Blanco, F. Sobrino, and V. Ley. 1999. Recombinant viruses expressing the foot-and-mouth disease virus capsid precursor polypeptide (P1) induce cellular but not humoral antiviral immunity and partial protection in pigs. Virology 259:129-134.[CrossRef][Medline]
  132. 67
  133. Saura, M., C. Zaragoza, A. McMillan, R. A. Quick, C. Hohenadl, J. M. Lowenstein, and C. J. Lowenstein. 1999. An antiviral mechanism of nitric oxide: inhibition of a viral protease. Immunity 10:21-28.[CrossRef][Medline]
  134. 68
  135. Scudamore, J. M., and D. M. Harris. 2002. Control of foot and mouth disease: lessons from the experience of the outbreak in Great Britain in 2001. Rev. Sci. Tech. Off. Int. Epizoot. 21:699-710.
  136. 69
  137. Shrestha, B., T. Wang, M. A. Samuel, K. Whitby, J. Craft, E. Fikrig, and M. S. Diamond. 2006. Gamma interferon plays a crucial early antiviral role in protection against West Nile virus infection. J. Virol. 80:5338-5348.[Abstract/Free Full Text]
  138. 70
  139. Sorensen, K. J., K. de Stricker, K. C. Dyrting, S. Grazioli, and B. Haas. 2005. Differentiation of foot-and-mouth disease virus infected animals from vaccinated animals using a blocking ELISA based on baculovirus expressed FMDV 3ABC antigen and a 3ABC monoclonal antibody. Arch. Virol. 150:805-814.[CrossRef][Medline]
  140. 71
  141. Taub, D. D., T. J. Sayers, C. R. D. Carter, and J. R. Ortaldo. 1995. {alpha} and ß chemokines induce NK cell migration and enhance NK-mediated cytolysis. J. Immunol. 155:3877-3888.[Abstract]
  142. 72
  143. Thomas, D. C., and C. E. Samuel. 1992. Mechanism of interferon action: alpha and gamma interferons differentially affect mRNA levels of the catalytic subunit of protein kinase A and protein Mx in human cells. J. Virol. 66:2519-2522.[Abstract/Free Full Text]
  144. 73
  145. Trifilo, M. J., C. Montalto-Morrison, L. N. Stiles, K. R. Hurst, J. L. Hardison, J. E. Manning, P. S. Masters, and T. E. Lane. 2004. CXC chemokine ligand 10 controls viral infection in the central nervous system: evidence for a role in innate immune response through recruitment and activation of natural killer cells. J. Virol. 78:585-594.[Abstract/Free Full Text]
  146. 74
  147. Vollstedt, S., S. Arnold, C. Schwerdel, M. Franchini, G. Alber, J. P. Di Santo, M. Ackermann, and M. Sutter. 2004. Interplay between alpha/beta and gamma interferons with B, T, and natural killer cells in the defense against herpes simplex virus type I. J. Virol. 78:3846-3850.[Abstract/Free Full Text]
  148. 75
  149. Wang, C. Y., T. Y. Chang, A. M. Walfield, J. Ye, M. Shen, S. P. Chen, M. C. Li, Y. L. Lin, M. H. Jong, P. C. Yang, N. Chyr, E. Kramer, and F. Brown. 2002. Effective synthetic peptide vaccine for foot-and-mouth disease in swine. Vaccine 20:2603-2610.[CrossRef][Medline]
  150. 76
  151. Weber, F., G. Kochs, and O. Haller. 2004. Inverse interference: how viruses fight the interferon system. Viral Immunol. 17:498-515.[CrossRef][Medline]
  152. 77
  153. Wu, Q., M. C. S. Brum, L. Caron, M. Koster, and M. J. Grubman. 2003. Adenovirus-mediated type I interferon expression partially protects cattle from foot-and-mouth disease. J. Interferon Cytokine Res. 23:371-380.
  154. 78
  155. Zaragoza, C., C. J. Ocampo, M. Saura, A. McMillan, and C. J. Lowenstein. 1997. Nitric oxide inhibition of coxsackievirus replication in vitro. J. Clin. Investig. 100:1760-1767.[Medline]
  156. 79
  157. Zhang, Z. D., G. Hutching, P. Kitching, and S. Alexandersen. 2002. The effects of gamma interferon on replication of foot-and-mouth disease virus in persistently infected bovine cells. Arch. Virol. 147:2157-2167.[CrossRef][Medline]


Journal of Virology, July 2007, p. 7124-7135, Vol. 81, No. 13
0022-538X/07/$08.00+0     doi:10.1128/JVI.02775-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Toka, F. N., Nfon, C. K., Dawson, H., Golde, W. T. (2009). Accessory-Cell-Mediated Activation of Porcine NK Cells by Toll-Like Receptor 7 (TLR7) and TLR8 Agonists. CVI 16: 866-878 [Abstract] [Full Text]  
  • de los Santos, T., Diaz-San Segundo, F., Zhu, J., Koster, M., Dias, C. C. A., Grubman, M. J. (2009). A Conserved Domain in the Leader Proteinase of Foot-and-Mouth Disease Virus Is Required for Proper Subcellular Localization and Function. J. Virol. 83: 1800-1810 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moraes, M. P.
Right arrow Articles by Grubman, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moraes, M. P.
Right arrow Articles by Grubman, M. J.