This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baker, A.
Right arrow Articles by Ketner, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baker, A.
Right arrow Articles by Ketner, G.

 Previous Article  |  Next Article 

Journal of Virology, July 2007, p. 7034-7040, Vol. 81, No. 13
0022-538X/07/$08.00+0     doi:10.1128/JVI.00029-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Adenovirus E4 34k and E1b 55k Oncoproteins Target Host DNA Ligase IV for Proteasomal Degradation{triangledown}

Amy Baker,1 Kent J. Rohleder,1,{dagger} Les A. Hanakahi,2 and Gary Ketner1*

W. Harry Feinstone Department of Molecular Microbiology and Immunology,1 Department of Biochemistry and Molecular Biology, Johns Hopkins Bloomberg School of Public Health, 615 N. Wolfe Street, Baltimore, Maryland 212052

Received 5 January 2007/ Accepted 18 April 2007


arrow
ABSTRACT
 
Cells infected by adenovirus E4 mutants accumulate end-to-end concatemers of the viral genome that are assembled from unit-length viral DNAs by nonhomologous end joining (NHEJ). Genome concatenation can be prevented by expression either of E4 11k (product of E4orf3) or of the complex of E4 34k (product of E4orf6) and E1b 55k. Both E4 11k and the E4 34k/E1b 55k complex prevent concatenation at least in part by inactivation of the host protein Mre11: E4 11k sequesters Mre11 in aggresomes, while the E4 34k/E1b 55k complex participates in a virus-specific E3 ubiquitin ligase that mediates ubiquitination and proteasomal degradation. The E4 34k/E1b 55k complex, but not E4 11k, also inhibits NHEJ activity on internal breaks in the viral genome and on V(D)J recombination substrate plasmids, suggesting that it may interfere with NHEJ independently of its effect on Mre11. We show here that DNA ligase IV, which performs the joining step of NHEJ, is degraded as a consequence of adenovirus infection. Degradation is dependent upon E4 34k and E1b 55k, functional proteasomes, and the activity of cellular cullin 5, a component of the adenoviral ubiquitin ligase. DNA ligase IV also interacts physically with E1b 55k. The data demonstrate that DNA ligase IV, like Mre11, is a substrate for the adenovirus-specific E3 ubiquitin ligase; identify an additional viral approach to prevention of genome concatenation; and provide a mechanism for the general inhibition of NHEJ by adenoviruses.


arrow
INTRODUCTION
 
The linear, double-stranded adenovirus genome remains predominantly monomeric throughout a wild-type adenovirus infection. In contrast, most of the viral DNA present in cells infected by mutants that lack early region 4 (E4) is in the form of end-to-end concatemers containing two to five or more unit-length genomes (6, 36, 37). The viral genomes present in concatemers are joined in all orientations (head to tail, head to head, and tail to tail), and the joints between genomes typically lack a few to hundreds of nucleotides from each of the component molecules (37). Concatemer formation does not occur in mutant human cells that lack either DNA-dependent protein kinase (DNA-PK) (6) or DNA ligase IV (36), each of which is a central component of the nonhomologous end-joining (NHEJ) DNA repair system, and concatemers presumably are assembled from monomeric genomes by NHEJ. Concatemer formation is also blocked in cells that lack the host Mre11 or NBS1 protein, each of which is a member with the Rad50 protein of the MRN complex, which is central in DNA damage signal transduction in eukaryotes.

Genome concatenation is redundantly antagonized by two virus-encoded systems in wild-type adenovirus infections: the presence of either the E4 11k (E4orf3) protein or the complex formed by the E4 34k (E4orf6) and E1b 55k proteins prevents concatemer formation (36, 37). These systems act by different mechanisms, but inhibition of concatenation by both is at least partly explained by inactivation of the Mre11 protein. E4 11k induces sequestration of Mre11 in aggresomes, inhibiting its activity and stimulating its degradation (2, 24), while the E4 34k/E1b 55k complex constitutes the substrate-binding component of a viral E3 ubiquitin ligase also containing cellular cullin 5, elongins B and C, and Rbx1 that mediates proteasomal degradation of Mre11 and other cellular proteins including p53 (20, 33). The role of Mre11 or the MRN complex in viral genome concatenation is likely to include removal of the terminal protein covalently attached to the 5' end of each strand of viral DNA (34). Removal of the terminal protein, which otherwise would block joining of viral DNAs by NHEJ, should render the viral DNA an appropriate substrate for concatenation. This hypothesis is supported by the requirement for the nuclease activity of Mre11 for concatenation in E4 mutant infections (36) and by the ability of yeast Mre11 to remove a Spo11p molecule covalently linked to the 5' strand at double-strand DNA breaks that initiate recombination during meiosis in Saccharomyces cerevisiae (29). While the MRN complex may also be involved in the concatenation event itself, its direct involvement in general NHEJ in higher eukaryotes is controversial. MRN homologues clearly are important for NHEJ-mediated DNA repair in S. cerevisiae and for V(D)J recombination, which depends upon NHEJ, when it is reconstituted in S. cerevisiae (13, 28). However, Schizosaccharomyces pombe mutants null for the MRN homologues are proficient for NHEJ (15, 25, 39), and a variety of mutant mammalian cells hypomorphic for MRN components exhibit normal levels of NHEJ and/or V(D)J recombination (4, 21, 35, 42). Additionally, while Mre11 is essential for cell viability, chicken or mouse cell lines conditionally expressing Mre11 exhibit normal or elevated NHEJ in the absence of the protein (41). It cannot be ruled out that residual MRN activity in hypomorphic mutants or inducible cell lines is sufficient for normal NHEJ. However, these observations are consistent with the supposition that the MRN complex is dispensable for NHEJ in at least some settings in higher eukaryotes including mammals.

The E4 34k/E1b 55k complex inhibits NHEJ on a variety of substrates other than intact viral genomes. These include double-strand breaks introduced into the cellular genome by ionizing radiation (27), internal breaks in the viral genome (31), and Rag1-Rag2-induced double-strand breaks in V(D)J recombination substrate plasmids (6). In contrast, E4 11k, while effectively preventing genome concatenation, fails to inhibit repair of internal breaks in the viral genome (31) and does not inhibit V(D)J recombination (6). (Effects on repair of radiation-induced damage in cellular DNA have not been investigated.) If Mre11 is an essential component of mammalian NHEJ, its inactivation by E4 11k must leave sufficient residual activity to mediate general NHEJ despite completely inhibiting concatenation. Alternatively, failure of E4 11k to inhibit viral genome repair and V(D)J recombination might indicate that the essential role of Mre11 in genome concatenation is in removing the terminal protein and not in the concatenation reaction itself. In that case, general inhibition of NHEJ by the E4 34k/E1b 55k complex would reflect inactivation of a component(s) of the NHEJ machinery that is spared by E4 11k. To distinguish these alternatives, we have examined the steady-state levels of the components of the core NHEJ proteins in adenovirus-infected cells. Our studies show that DNA ligase IV, the protein responsible for the rejoining step in NHEJ, is targeted for proteasomal destruction by the E4 34k/E1b 55k ubiquitin ligase, confirming that adenoviruses employ multiple independent strategies to inhibit genome concatenation.


arrow
MATERIALS AND METHODS
 
Cell lines and viruses. 293 cells (19) and the human lung carcinoma cell line A549 (17) were propagated in Eagle's minimal essential medium (Cambrex) supplemented with 10% fetal bovine serum, penicillin, and streptomycin. Human lung carcinoma cell line H1299 was propagated in RPMI 1640 (Invitrogen) supplemented with 10% fetal bovine serum, 10 mM HEPES, 1 mM sodium pyruvate, 4.5 g/liter glucose, penicillin, and streptomycin.

The E4 mutants used in these experiments (H5dl1007, H5dl1013, H5dl1014, H5dl1015, H5dl1016, H5dl1019, and H5dl1020; see Table 1 for genotypes) and the E1b 55k deletion mutant H5dl110 have been described previously (3, 8, 9, 26).


View this table:
[in this window]
[in a new window]

 
TABLE 1. Genotypes of E4 and E1b mutantsa

Adenovirus vectors expressing full-length cullin 5 and a dominant-negative truncated cullin 5 were a generous gift from Arnold Berk and have been described previously (40).

Plasmids. A c-myc-tagged human DNA ligase IV gene was made by adding tandem c-myc epitopes (EQKLISEEDL) to the C-terminal end of the cloned human DNA ligase IV gene (clone identification 5259632 from Open Biosystems). The following primers were used to amplify a C-terminal fragment of the human DNA ligase IV cDNA (nucleotides 3109 to 3629): forward primer, 5'-GGCAGCCTCGCTTTATGATTCATATGTGCC-3', and reverse primer, 5'-TGTATCTCTAGATTACAGATCCTCTTCTGAGATGAGTTTTTGTTCCAGATCCTCTTCTGAGATGAGTTTTTGTTCAATCAAATACTGGTTTTCTTCTTGTAATTCACAC-3'. The reverse primer adds the c-myc epitope repeats (underlined), a stop codon, and an XbaI site to the C terminus of the DNA ligase IV reading frame. This PCR fragment was subcloned into the original DNA ligase IV clone using the native NdeI site and the added C-terminal XbaI site. The full-length DNA ligase IV-c-myc fusion gene was then subcloned into the mammalian expression vector pCDNA3 (Invitrogen) with NotI and XbaI. Green fluorescent protein (GFP) was expressed from pEGFP-N3 (Clontech). E4 34k and the E4 34k mutant C124S were expressed from derivatives of pCDNA3 (7). E1b 55k was expressed from pCMV55k, kindly provided by David Ornelles (18).

Antisera. Antibodies were used for immunoblotting experiments at the following dilutions: E4orf6-C (custom rabbit polyclonal antiserum raised to the carboxy-terminal octapeptide [7]), 1:1,000; E1b 55k (mouse monoclonal antibody 2A6 provided by Philip Branton), 1:1,000; DNA ligase IV (AHP554; Serotec), 1:6,000; myc tag (ab9106; Abcam), 1:2,000; Mre11 (NB100-142; Novus Biologicals), 1:5,000; DNA-PKcs (MS-371), Ku70 (MS-329), and Ku80 (MS-285), all from NeoMarkers, 1:4,00, 1:1,000, and 1:1,000, respectively; XRCC4 (X96820; Transduction Lab), 1:250; Artemis (52-6267; Zymed), 1:100; actin (691001; MP Biomedicals), 1:5,000; GFP (A6455, Molecular Probes), 1:1,500; FLAG-M2 (F1804; Sigma), 1:1,000; XLF (provided by Stephen Jackson), 1:100. Secondary antibodies were obtained from GE Healthcare.

DNA transfections. Transfections were carried out with Lipofectamine 2000 reagent (Invitrogen) according to the protocol provided. Cells transfected in the 24-well format were seeded at 2.5 x 105 cells per well in medium lacking antibiotics 24 h prior to transfection and were transfected with a total of 800 ng of plasmid DNA. DNA complexes were not removed unless cells were infected 24 h posttransfection. Cells transfected in the six-well format were seeded at 2 x 106 cells per well in medium lacking antibiotics 24 h prior to transfection and were transfected with a total of 4.0 µg of DNA. Complexes were not removed, and cells were harvested 48 h posttransfection.

Coimmunoprecipitations and Western blotting. For coimmunoprecipitation experiments, cell pellets were lysed in 200 µl NET2 lysis buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 0.1% NP-40) by sonication. One hundred microliters of lysate was incubated with 20 µl E1b 55k antibody or 20 µl of an isotype-matched irrelevant antibody (anti-Ku80) overnight at 4°C. The lysate-antibody mixture was incubated with 50 µl of a 50% slurry of protein A-Sepharose beads in NET2 buffer for 1 hour, and then beads were washed three times for 15 min with NET2 buffer at room temperature. Beads were boiled in protein loading solution (0.05 M Tris-HCl, pH 6.8, 2% sodium dodecyl sulfate [SDS], 10% glycerol, 5% 2-mercaptoethanol, and bromophenol blue), and the supernatant was fractionated on a 9% SDS-polyacrylamide protein gel. For Western blotting of infected and transfected lysates, whole-cell extracts were prepared in protein loading solution and boiled, and 1/10 total volume was separated on 7.5% or 9% SDS-polyacrylamide gels. When samples were blotted for E4 34k, samples were not boiled but incubated at 37°C for 15 min before loading. Proteins were electrophoretically transferred to a nitrocellulose membrane. Blots were blocked with 5% nonfat dry milk (NFDM) in phosphate-buffered saline (PBS) with 0.1% Tween 20 (NFDM-PBS-T). Primary antibodies were diluted in 5% NFDM-PBS-T. Secondary antibodies were diluted in 3% NFDM-PBS-T.

Figure production. Autoradiograms were scanned, and composite figures were assembled with Adobe Photoshop. Unless noted, all samples in a row are derived from the same gel. White spaces have been left where lanes have been deleted or lane order rearranged. To make the finished figures more closely resemble the original films, some scans were adjusted for brightness and contrast; in those cases an entire row or the entire figure was adjusted in one operation. Images were not otherwise manipulated.


arrow
RESULTS
 
E4 34k and E1b 55k cooperate to reduce levels of DNA ligase IV. Viral genome concatenation in adenovirus-infected cells is efficiently prevented both by the E4 11k product and by the E4 34k/E1b 55k complex. In both cases, inactivation of Mre11, by aggresomal sequestration (E4 11k) or by proteasome-mediated degradation (the E4 34k/E1b 55k complex), is critical in preventing concatenation. E4 34k and E1b 55k, but not E4 11k, also interfere with other NHEJ-dependent processes including the NHEJ-dependent V(D)J recombination and repair of internal breaks in the viral genome (6, 31), suggesting that the E4 34k/E1b 55k complex may induce degradation of NHEJ proteins that are not affected by E4 11k. To test that hypothesis, we examined the steady-state levels of the core members of the NHEJ pathway (DNA-PKcs, DNA ligase IV, Ku70, Ku80, XRCC4, and XLF; reviewed in references 1, 10, and 16) and of Artemis, a protein essential for V(D)J recombination (30), in 293 cells infected with wild-type and E4 mutant viruses. Under conditions that result in E4 34k-dependent degradation of Mre11, levels of DNA-PKcs, Ku70, Ku80, XRCC4, XLF, and Artemis are all unaffected by wild-type or mutant adenovirus infection (Fig. 1). In contrast, the level of DNA ligase IV, the remaining core member of the NHEJ pathway, is strikingly reduced in cells infected by viruses that express E4 34k (adenovirus type 5 [Ad5] and H5dl1013, Fig. 2A). As is the case for Mre11, ablation of DNA ligase IV is most dramatic in cells that overproduce E4 34k (H5dl1013; Fig. 1 and 2A), while deletion mutants that do not express E4 34k (H5dl1007, H5dl1014, and H5dl1015) do not alter DNA ligase IV levels. Reductions in DNA ligase levels are independent of expression of E4 11k (Fig. 2; Table 1). These data suggest that DNA ligase IV, like Mre11, is targeted for degradation by the E4 34k/E1b 55k complex. Since DNA ligase IV is essential for all NHEJ, this suggestion provides a provisional explanation for global inhibition of NHEJ by the E4 34k/E1b 55k complex.


Figure 1
View larger version (87K):
[in this window]
[in a new window]

 
FIG. 1. NHEJ proteins in adenovirus-infected cells. 293 cells were infected with wild-type Ad5 or E4 deletion mutant viruses at a multiplicity of infection of 3.3. Cell lysates were collected 48 h postinfection and fractionated on an SDS-polyacrylamide gel. The gels were analyzed by immunoblotting for E4 34k and proteins of the NHEJ pathway as indicated. The status of open reading frame 6 (ORF 6) (E4 34k) in each mutant is noted on the figure; the complete genotypes of the mutants are listed in Table 1.


Figure 2
View larger version (43K):
[in this window]
[in a new window]

 
FIG. 2. DNA ligase IV in adenovirus-infected cells. (A) 293 cells (left six lanes) or A549 cells (right three lanes) were infected with Ad5 or with E4 or E1b deletion mutant viruses at a multiplicity of infection of 3.3 and harvested 48 h postinfection. (B) 293 cells were transfected with myc-tagged DNA ligase IV and eGFP for 24 h before being infected with Ad5 or E4 deletion mutant viruses and were harvested 48 h postinfection. DNA ligase IV was visualized by immunoblotting with DNA ligase IV antiserum (A) or anti-myc antibody (B). E4 34k was immunoblotted to confirm its expression where expected. Immunoblots of actin (A) or eGFP (B) served as a loading control. The mobility shift of DNA ligase IV in the H5dl1015 lysate is probably a gel artifact due to abundant expression of the viral late protein hexon: alone among viruses which do not degrade DNA ligase IV, H5dl1015 produces high levels of hexon, which migrates immediately above DNA ligase IV on this SDS-polyacrylamide gel. Panel A was assembled from two separate gels.

If DNA ligase IV is a target for E4 34k/E1b 55k complex-mediated degradation, reductions in levels should depend upon E1b 55k expression. To address the possible requirement for E1b 55k expression, A549 cells, which do not express E1, were infected with either Ad5 or the E1b 55k mutant H5dl110 (3), and DNA ligase IV levels were assessed by immunoblotting (Fig. 2A, right lanes). DNA ligase IV is absent from extracts of cells infected with wild-type virus but present in extracts of H5dl110-infected cells, confirming that DNA ligase IV ablation is dependent on E1b 55k and consistent with the suggestion that it is the E4 34k/E1b 55k complex that is responsible for the disappearance of DNA ligase IV from infected cells.

To confirm that the protein detected by the DNA ligase IV antibody was in fact DNA ligase IV and not cross-reacting species (other DNA ligases, for example), we analyzed the accumulation of c-myc epitope-tagged DNA ligase IV in transfected cells. 293 cells were transfected with a myc-tagged DNA ligase IV expression plasmid and, as a transfection control, an enhanced GFP (eGFP) plasmid. Twenty-four hours posttransfection the cells were infected with E4 deletion mutant viruses and epitope-tagged DNA ligase levels were determined by immunoblotting with a c-myc monoclonal antibody. As observed with the polyclonal DNA ligase IV antibody and endogenous DNA ligase IV, myc-tagged DNA ligase IV is eliminated from adenovirus-infected cells where E4 34k is expressed (Fig. 2B), confirming that DNA ligase IV itself is the target of the E4 34k/E1b 55k complex. Immunoblots of DNA ligase I and DNA ligase III (not shown) demonstrate that levels of those proteins are not affected by adenovirus infection.

These experiments demonstrate that E4 34k and E1b 55k are necessary for removal of DNA ligase IV but do not rule out the possibility that other components provided by the viral genome also are required. To determine whether E4 34k and E1b 55k are the only viral proteins necessary for reduction of DNA ligase IV, plasmids encoding E4 34k, E1b 55k, myc-tagged DNA ligase IV, and eGFP (as a transfection control) were introduced into H1299 cells by transfection and myc-tagged DNA ligase IV was measured 48 h posttransfection by immunoblotting. Cells expressing both E4 34k and E1b 55k accumulate much lower levels of tagged DNA ligase IV than do cells that express either E4 34k or E1b 55k alone or cells expressing neither viral protein (Fig. 3). Therefore, among viral proteins, E4 34k and E1b 55k are both necessary and sufficient to mediate removal of DNA ligase IV. 2V6.11 cells are 293 derivatives that inducibly express the E4 34k protein (27). Both Mre11 (27) and DNA ligase IV (not shown) are degraded in induced, but not uninduced, 2V6.11 cells, consistent with the conclusion that proteins outside of E1 and E4 are not required for DNA ligase IV destruction.


Figure 3
View larger version (49K):
[in this window]
[in a new window]

 
FIG. 3. DNA ligase IV in E1b 55k-, E4 34k-transfected cells. H1299 cells were transfected with plasmids that express myc-tagged DNA ligase IV (600 ng), E1b 55k and wild-type or mutant (C124S) E4 34k (100 ng each), and eGFP (40 ng). Lysates were harvested 48 h posttransfection and immunoblotted for myc (to detect DNA ligase IV), E4 34k, E1b 55k, cellular actin (loading control; not shown), and eGFP (transfection control). Transfected plasmids are indicated at the top of each lane. The left and right panels are derived from separate experiments. Only lysates of cells transfected with an E4 34k plasmid were probed for E4 34k expression.

Mutations in conserved cysteine and histidine residues in E4 34k prevent complex formation by E4 34k and E1b 55k and abolish most of the functions of the E4 34k/E1b 55k complex (7). To test the requirement for complex formation in the reduction of DNA ligase IV, H1299 cells were transfected with a nonfunctional substitution mutant of E4 34k (C124S [7]) in place of the wild-type E4 34k gene along with E1b 55k and myc-tagged DNA ligase IV. Compared to cells transfected with the wild-type E4 gene, myc-ligase levels are restored in C124S mutant-transfected cells (Fig. 3), indicating that the physical association between E4 34k and E1b 55k is required for the effects of the viral proteins on DNA ligase IV.

E4 34k and E1b 55k ablate DNA ligase IV by proteasome-mediated degradation. The E4 34k and E1b 55k proteins form the substrate-binding component of a virus-specific ubiquitin E3 ligase which is responsible for degradation of p53 and Mre11 and which ubiquitinates p53 in vitro (20, 33). It is likely that the mechanism by which the E4 34k and E1b 55k proteins remove DNA ligase IV from infected cells also is via ubiquitination and subsequent proteasome-mediated degradation. If that supposition is correct, an inhibitor of proteasome activity should restore levels of DNA ligase IV in Ad5-infected cells. To test that prediction, extracts of mock-infected or Ad5-infected 293 cells incubated in the presence or absence of the proteasome inhibitor MG132 were prepared 12, 24, and 36 h postinfection and assayed for DNA ligase IV by immunoblotting (Fig. 4). In the absence of the proteasome inhibitor, levels of DNA ligase IV steadily decline over the course of the infection. However, when cells are treated with 10 µM MG132 beginning 2 hours after infection, DNA ligase IV levels in infected cells remain comparable to those of mock-infected cells. This requirement for proteasome activity in DNA ligase IV reduction, along with the involvement of known components of the viral ubiquitin E3 ligase, strongly supports the contention that the E4 34k/E1b 55k complex targets DNA ligase IV for ubiquitination and subsequent proteasome-mediated degradation.


Figure 4
View larger version (25K):
[in this window]
[in a new window]

 
FIG. 4. Effect of proteasome inhibition on DNA ligase IV level. 293 cells were mock infected or infected with Ad5 at a multiplicity of infection of 3.3. Infections were carried out in the absence or presence of 10 µM MG132, added 2 h postinfection. Samples were harvested at 12, 24, and 36 h postinfection, and DNA ligase IV was visualized by immunoblotting with DNA ligase IV antiserum. Actin served as a loading control.

Cullin 5 is required for degradation of DNA ligase IV. The E3 ubiquitin ligase responsible for p53 ubiquitination and degradation in adenovirus infection contains the cellular proteins cullin 5, elongin B and C, and Rbx1 in addition to E4 34k and E1b 55k (20, 33). It seems likely that the same enzyme is responsible for the degradation of DNA ligase IV in an adenovirus infection. To address that possibility, we examined DNA ligase IV destabilization in cells where cullin 5 activity was inhibited by expression of a dominant-negative cullin 5 mutant (40). E1-deleted, replication-defective adenovirus vectors expressing either full-length FLAG-tagged cullin 5 or a FLAG-tagged dominant-negative C-terminal cullin 5 truncation mutant or an empty-vector control (40) were used to preinfect A549 cells. Sixteen hours later, the cells were superinfected with wild-type Ad5. Fifty-six hours after superinfection, cell lysates were examined for expression of the epitope-tagged cullin 5 and for endogenous DNA ligase IV by immunoblotting (Fig. 5). In cells not preinfected, cells preinfected with the empty adenovirus vector, or cells preinfected with the vector expressing the full-length cullin 5, DNA ligase IV is nearly eliminated by Ad5 superinfection. In contrast, preinfection with the dominant-negative cullin 5 vector effectively prevents degradation of DNA ligase IV by Ad5, restoring its level to that found in uninfected A549 cells. Immunoblotting for the FLAG tag confirmed that the cullin 5 constructs expressed equivalent amounts of protein. These data indicate that degradation of DNA ligase IV is dependent on a cullin 5-containing E3 ubiquitin ligase.


Figure 5
View larger version (60K):
[in this window]
[in a new window]

 
FIG. 5. Requirement for cullin 5 in degradation of DNA ligase IV. A549 cells were preinfected with E1-deficient, replication-defective adenovirus vectors expressing FLAG-tagged wild-type (WT) cullin 5 or a dominant-negative carboxy-terminal truncation cullin 5 mutant (NTD) or an empty-vector control. Sixteen hours postinfection, cells were superinfected with Ad5. Fifty-six hours after superinfection, lysates were prepared and analyzed by immunoblotting for expression of cullin 5 (via the FLAG tag), endogenous DNA ligase IV, E4 34k, and cellular actin (loading control). The positions of the full-length and NTD cullin 5 proteins are marked at the left of the bottom panel. The Mock/Mock lysate was not analyzed for either E4 34k or the FLAG tag.

DNA ligase IV physically associates with E1b 55k. The E4 34k and E1b 55k proteins are thought to form the substrate-binding subunit of the viral E3 ubiquitin ligase, and at least one substrate of the viral ubiquitin ligase, p53, binds to the E1b 55k protein (20, 33). Therefore, we attempted to demonstrate a physical association between E1b 55k and DNA ligase IV. Lysates were prepared from 293 cells which had been transfected with E1b 55k and DNA ligase IV expression plasmids and immunoprecipitates were prepared either with an E1b 55k monoclonal antibody or with an irrelevant isotype-matched control (anti-Ku80). Immunoprecipitated material was examined for E1b 55k (to confirm successful immunoprecipitation) and DNA ligase IV by immunoblotting (Fig. 6). DNA ligase IV was present in precipitates prepared with E1b 55k antibody but not those prepared with the irrelevant control antibody. Therefore, E1b 55k and DNA ligase IV interact physically, as expected if DNA ligase IV is a direct substrate of the viral E3 ubiquitin ligase. A reciprocal experiment, in which DNA ligase IV immunoprecipitates were probed for E1b 55k, was also attempted. However, E1b 55k exhibits a general affinity for immunoglobulin-coated protein A beads and was precipitated by each of several antibodies, irrelevant or specific (not shown).


Figure 6
View larger version (26K):
[in this window]
[in a new window]

 
FIG. 6. Physical association of E1b 55k and DNA ligase IV. Lysates were prepared from 293 cells 24 h after cotransfection with plasmids encoding E1b 55k and DNA ligase IV and were incubated with E1b 55k monoclonal antibody 2A6 or an isotype-matched irrelevant control antibody (anti-Ku80). Immune complexes were recovered, fractionated on an SDS-polyacrylamide gel, and analyzed by immunoblotting for DNA ligase IV (top). DNA ligase IV is present in immunoprecipitates made with E1b 55k antiserum (IP 55k) but absent from those made using the irrelevant control (IP Ku), indicating a specific physical interaction between E1b 55k and DNA ligase IV. Immunoprecipitates were also analyzed by immunoblotting with anti-55k serum to confirm successful and specific recovery of E1b 55K (bottom). An amount of anti-55k antibody equal to that used for immunoprecipitation was run in the lane marked "55k Ab" to demonstrate that the band detected by immunoblotting with E1b 55k antiserum is not the result of reactivity of the secondary antibody with immunoglobulin G heavy chain, which is present in the immunoprecipitates and migrates close to E1b 55k in this gel. Lysate equivalent to 15% of the input for an immunoprecipitation was loaded in the first lane.

DNA ligase IV forms a stable physical complex with XRCC4 (16). To determine whether XRCC4 is associated with DNA ligase IV bound to E1b 55k, we probed immunoprecipitates made with anti-E1b 55k serum for XRCC4 in addition to DNA ligase IV. In two experiments in which DNA ligase IV was successfully precipitated, XRCC4 was absent from the precipitate (not shown). While we cannot rule out the possibility that quantities of XRCC4 below the detection limit were present in immunoprecipitates, we conclude that the DNA ligase IV population bound to E1b 55k is not associated with XRCC4 with the stoichiometry observed in normal cells (2 XRCC4:1 DNA ligase IV). These data suggest the intriguing possibility that E1b 55k of the E1b 55k/E4 34k complex actively dissociates DNA ligase IV from XRCC4 prior to its ubiquitination and proteasomal destruction.


arrow
DISCUSSION
 
Expression of the adenovirus E4 34k and E1b 55k oncoproteins or, redundantly, the E4 11k protein inhibits NHEJ-dependent accumulation of concatemers of the viral genome in infected cells (6, 31, 37). The E4 34k and E1b 55k proteins, but not E4 11k, also inhibit NHEJ on internal breaks in the viral genome (31) and V(D)J recombination substrate plasmids (6), and expression of E4 34k in 293 cells, which constitutively express E1b 55k, inhibits repair of radiation-induced double-strand breaks in the cellular chromosome (27). We show here that DNA ligase IV, which mediates the joining step in double-strand DNA break repair by NHEJ, disappears from cells infected with wild-type Ad5. Expression of the E4 34k and E1b 55k proteins is necessary and sufficient to ablate DNA ligase IV both in the context of a viral infection and in transfection experiments. Disappearance of DNA ligase IV is dependent on proteasome function and on cellular cullin 5. Finally, DNA ligase IV associates physically with E1b 55k. Together, these data demonstrate that DNA ligase IV is a target of the adenoviral E4 34k/E1b 55k ubiquitin ligase that also is responsible for degradation of at least p53 (20, 33) and Mre11 (36) in adenovirus-infected cells. Degradation of DNA ligase IV provides a mechanism for the global inhibition of NHEJ in cells expressing E4 34k and E1b 55k.

Inactivation of either DNA ligase IV or Mre11 by mutations in the corresponding host cell gene is sufficient to prevent viral genome concatenation in cells infected with E4 mutants (36). That adenoviruses induce degradation of both proteins suggests that inhibition of concatenation is of profound importance to viral growth. Genome concatenation might plausibly inhibit viral growth through at least three mechanisms. First, concatenation contributes to the defect in viral late mRNA accumulation and late gene expression seen in cells infected by E4 mutants that lack both E4 34k and E4 11k or by mutants that lack both E1b 55k and E4 11k (8, 22). Treatment of E4 mutant-infected cells with wortmannin or caffeine, either of which interferes with the double-strand break repair kinases DNA-PK, ATM, and ATR, prevents concatenation and substantially restores viral late gene expression. The late gene expression defect of E4 mutants is also significantly relieved in DNA-PKcs-defective host cells (MO59J) which are deficient in NHEJ and do not concatenate E4 mutant viral genomes (23). Second, because monomeric viral genomes are the normal packaging substrate (32), concatemeric viral DNA is not likely to be efficiently incorporated into virus particles, and concatemers presumably represent dead ends for progeny virion production. Additionally, the terminal deletions present at the novel joints in concatemers (37) remove the packaging signals from at least some participating molecules, rendering them unsuitable for packaging even if concatemers were somehow resolved to single genomes. Finally, the adenoviral origins of replication lie at the ends of the viral genome, with essential binding sites for the adenovirus DNA polymerase and viral preterminal protein occupying the terminal 18 bp of the viral DNA (38). Therefore, the terminal deletions found in concatenated viral DNAs also ensure that genomes internal to concatemers lack functional origins of viral DNA replication. Adenovirus origins also do not function efficiently when located internally in DNA molecules (38). Thus, genome concatemers are presumably poor substrates for viral DNA replication. Together, effects of concatenation on the essential processes of packaging, DNA replication, and late gene expression may have exerted sufficient selective pressure to maintain apparently redundant viral systems for elimination of concatemer formation.

Adenovirus infection induces a DNA damage response dependent upon Mre11 (11). Degradation of Mre11 therefore attenuates cellular responses to infection that otherwise would be induced via DNA damage-sensing mechanisms and might interfere with viral growth independently of genome concatenation. NHEJ might similarly have inhibitory effects on viral replication apart from participation in concatenation, suggesting an alternative rationale for ablation of DNA ligase IV. Consistent with the possibility that NHEJ might have a concatenation-independent inhibitory effect on viral growth, the herpes simplex virus (HSV) E3 ubiquitin ligase ICP0 targets DNA-PKcs for proteasomal degradation, presumably disrupting NHEJ in HSV-infected cells. In the case of HSV, genome circularization early in herpesvirus infection, potentially dependent upon NHEJ, provides the template for viral DNA replication (5) and herpesvirus genomes are packaged from concatemeric intermediates (12). These observations weaken an argument that NHEJ-mediated concatenation of HSV genomic DNA interferes with viral growth, raising instead the possibility that DNA-PKcs is degraded in HSV infections to avoid inhibitory activities of NHEJ that are unrelated to end-to-end joining of HSV genomes. Both adenoviruses and HSV, therefore, may prevent general NHEJ in part to avoid inhibitory effects of NHEJ that are concatenation independent.

Whatever the precise selective forces that drive adenovirus and HSV to inhibit NHEJ, the process of NHEJ clearly acts as an element of the cell's innate defenses against viral infection. NHEJ is also central to the adaptive immune response to infection through its role in V(D)J recombination. Inhibition of V(D)J recombination in individual adenovirus-infected cells is surely of no importance in modulating the immune response to viral infection. However, we find it intriguing that NHEJ plays critical roles in both the adaptive and innate defenses against viral pathogens.

In our experiments, degradation of DNA ligase IV and Mre11 becomes pronounced only fairly late in infection (16 to 24 h; Fig. 4 and data not shown). This suggests that the principal benefits of inhibition of concatenation are derived late in the lytic cycle, at a time when late gene expression, viral DNA replication, and DNA packaging are occurring. This is consistent with the observation that concatenation interferes with viral late gene expression (23) and with the presumed unsuitability of genome concatemers for replication and packaging. Corbin-Lickfett and Bridge (14) have shown that proteasome activity is required for E4 34k-dependent stimulation of late gene expression between 2 h and 8 to 10 h postinfection but that it is unnecessary after that time. This discrepancy between the critical period for action of the viral ubiquitin ligase and the time at which appreciable degradation of DNA ligase IV and Mre11 occurs may indicate that late gene expression is dependent upon early degradation of a critical population of target proteins (for example, at nascent viral replication centers) that is not detected by examination of bulk protein levels. Alternatively, a ubiquitination target yet to be identified but critical in stimulation of viral late gene expression by the E4 34k/E1b 55k complex may be an early target for degradation. This possibility suggests that studies designed to search systematically for new viral ubiquitin ligase substrates would reveal additional roles for the E4 34k/E1b 55k complex in late gene expression. It seems unlikely to us that the known targets of the adenoviral ubiquitin ligase are its only targets in infected cells or that its only functions in viral infection have been described. A comprehensive catalog of proteins degraded by the viral ubiquitin ligase therefore might also reveal entirely new roles for the E4 34k and E1b 55k proteins in the viral life cycle and viral interactions with processes in host cells that currently are unsuspected.


arrow
ACKNOWLEDGMENTS
 
This work was supported by Public Health Service grants 1RO1 CA/GM82127 (G.K.) and 1RO1 GM070639-1 (L.A.H.) and by the Johns Hopkins University Bloomberg School of Public Health Faculty Research Initiatives Fund (L.A.H. and G.K.). A.B. was supported by PHS training grant 5T32 AI07417 and K.J.R. by PHS training grant 5T32GM07814.

We thank Michael Berg for useful advice throughout the course of the work and Michael Berg and Christopher Palma for helpful comments on the manuscript. We also thank Arnold Berk, Philip Branton, and Stephen Jackson for generous gifts of materials.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: W. Harry Feinstone Department of Molecular Microbiology and Immunology, Johns Hopkins Bloomberg School of Public Health, 615 N. Wolfe Street, Baltimore, MD 21205. Phone: (410) 955-3776. Fax: (410) 955-0105. E-mail: gketner{at}jhsph.edu Back

{triangledown} Published ahead of print on 25 April 2007. Back

{dagger} Present address: Department of Biology, Fort Hays State University, 600 Park St., Hays, KS 67601. Back


arrow
REFERENCES
 
    1
  1. Ahnesorg, P., P. Smith, and S. P. Jackson. 2006. XLF interacts with the XRCC4-DNA ligase IV complex to promote DNA nonhomologous end-joining. Cell 124:301-313.[CrossRef][Medline]
  2. 2
  3. Araujo, F. D., T. H. Stracker, C. T. Carson, D. V. Lee, and M. D. Weitzman. 2005. Adenovirus type 5 E4orf3 protein targets the Mre11 complex to cytoplasmic aggresomes. J. Virol. 79:11382-11391.[Abstract/Free Full Text]
  4. 3
  5. Babiss, L. E., and H. S. Ginsberg. 1984. Adenovirus type 5 early region 1b gene product is required for efficient shutoff of host protein synthesis. J. Virol. 50:202-212.[Abstract/Free Full Text]
  6. 4
  7. Bender, C. F., M. L. Sikes, R. Sullivan, L. E. Huye, M. M. Le Beau, D. B. Roth, O. K. Mirzoeva, E. M. Oltz, and J. H. Petrini. 2002. Cancer predisposition and hematopoietic failure in Rad50(S/S) mice. Genes Dev. 16:2237-2251.[Abstract/Free Full Text]
  8. 5
  9. Boehmer, P. E., and I. R. Lehman. 1997. Herpes simplex virus DNA replication. Annu. Rev. Biochem. 66:347-384.[CrossRef][Medline]
  10. 6
  11. Boyer, J., K. Rohleder, and G. Ketner. 1999. Adenovirus E4 34k and E4 11k inhibit double strand break repair and are physically associated with the cellular DNA-dependent protein kinase. Virology 263:307-312.[CrossRef][Medline]
  12. 7
  13. Boyer, J. L., and G. Ketner. 2000. Genetic analysis of a potential zinc-binding domain of the adenovirus E4 34k protein. J. Biol. Chem. 275:14969-14978.[Abstract/Free Full Text]
  14. 8
  15. Bridge, E., and G. Ketner. 1989. Redundant control of adenovirus late gene expression by early region 4. J. Virol. 63:631-638.[Abstract/Free Full Text]
  16. 9
  17. Bridge, E., S. Medghalchi, S. Ubol, M. Leesong, and G. Ketner. 1993. Adenovirus early region 4 and viral DNA synthesis. Virology 193:794-801.[CrossRef][Medline]
  18. 10
  19. Buck, D., L. Malivert, R. de Chasseval, A. Barraud, M. C. Fondaneche, O. Sanal, A. Plebani, J. L. Stephan, M. Hufnagel, F. le Deist, A. Fischer, A. Durandy, J. P. de Villartay, and P. Revy. 2006. Cernunnos, a novel nonhomologous end-joining factor, is mutated in human immunodeficiency with microcephaly. Cell 124:287-299.[CrossRef][Medline]
  20. 11
  21. Carson, C. T., R. A. Schwartz, T. H. Stracker, C. E. Lilley, D. V. Lee, and M. D. Weitzman. 2003. The Mre11 complex is required for ATM activation and the G2/M checkpoint. EMBO J. 22:6610-6620.[CrossRef][Medline]
  22. 12
  23. Catalano, C. E. 2005. Viral genome packaging machines: genetics, structure, and mechanism. Landes Bioscience, Georgetown, TX.
  24. 13
  25. Clatworthy, A. E., M. A. Valencia-Burton, J. E. Haber, and M. A. Oettinger. 2005. The MRE11-RAD50-XRS2 complex, in addition to other non-homologous end-joining factors, is required for V(D)J joining in yeast. J. Biol. Chem. 280:20247-20252.[Abstract/Free Full Text]
  26. 14
  27. Corbin-Lickfett, K. A., and E. Bridge. 2003. Adenovirus E4-34kDa requires active proteasomes to promote late gene expression. Virology 315:234-244.[CrossRef][Medline]
  28. 15
  29. Di Virgilio, M., and J. Gautier. 2005. Repair of double-strand breaks by nonhomologous end joining in the absence of Mre11. J. Cell Biol. 171:765-771.[Abstract/Free Full Text]
  30. 16
  31. Featherstone, C., and S. P. Jackson. 1999. DNA double-strand break repair. Curr. Biol. 9:R759-R761.[CrossRef][Medline]
  32. 17
  33. Giard, D. J., S. A. Aaronson, G. J. Todaro, P. Arnstein, J. H. Kersey, H. Dosik, and W. P. Parks. 1973. In vitro cultivation of human tumors: establishment of cell lines derived from a series of solid tumors. J. Natl. Cancer Inst. 51:1417-1423.[Medline]
  34. 18
  35. Goodrum, F. D., T. Shenk, and D. A. Ornelles. 1996. Adenovirus early region 4 34-kilodalton protein directs the nuclear localization of the early region 1B 55-kilodalton protein in primate cells. J. Virol. 70:6323-6335.[Abstract]
  36. 19
  37. Graham, F. L., J. Smiley, W. C. Russell, and R. Nairn. 1977. Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J. Gen. Virol. 36:59-74.[Abstract/Free Full Text]
  38. 20
  39. Harada, J. N., A. Shevchenko, D. C. Pallas, and A. J. Berk. 2002. Analysis of the adenovirus E1B-55K-anchored proteome reveals its link to ubiquitination machinery. J. Virol. 76:9194-9206.[Abstract/Free Full Text]
  40. 21
  41. Harfst, E., S. Cooper, S. Neubauer, L. Distel, and U. Grawunder. 2000. Normal V(D)J recombination in cells from patients with Nijmegen breakage syndrome. Mol. Immunol. 37:915-929.[CrossRef][Medline]
  42. 22
  43. Huang, M. M., and P. Hearing. 1989. Adenovirus early region 4 encodes two gene products with redundant effects in lytic infection. J. Virol. 63:2605-2615.[Abstract/Free Full Text]
  44. 23
  45. Jayaram, S., and E. Bridge. 2005. Genome concatenation contributes to the late gene expression defect of an adenovirus E4 mutant. Virology 342:286-296.[CrossRef][Medline]
  46. 24
  47. Liu, Y., A. Shevchenko, and A. J. Berk. 2005. Adenovirus exploits the cellular aggresome response to accelerate inactivation of the MRN complex. J. Virol. 79:14004-14016.[Abstract/Free Full Text]
  48. 25
  49. Manolis, K. G., E. R. Nimmo, E. Hartsuiker, A. M. Carr, P. A. Jeggo, and R. C. Allshire. 2001. Novel functional requirements for non-homologous DNA end joining in Schizosaccharomyces pombe. EMBO J. 20:210-221.[CrossRef][Medline]
  50. 26
  51. Medghalchi, S., R. Padmanabhan, and G. Ketner. 1997. Early region 4 modulates adenovirus DNA replication by two genetically separable mechanisms. Virology 236:8-17.[CrossRef][Medline]
  52. 27
  53. Mohammadi, E. S., E. A. Ketner, D. C. Johns, and G. Ketner. 2004. Expression of the adenovirus E4 34k oncoprotein inhibits repair of double strand breaks in the cellular genome of a 293-based inducible cell line. Nucleic Acids Res. 32:2652-2659.[Abstract/Free Full Text]
  54. 28
  55. Moore, J. K., and J. E. Haber. 1996. Cell cycle and genetic requirements of two pathways of nonhomologous end-joining repair of double-strand breaks in Saccharomyces cerevisiae. Mol. Cell. Biol. 16:2164-2173.[Abstract]
  56. 29
  57. Moreau, S., J. R. Ferguson, and L. S. Symington. 1999. The nuclease activity of Mre11 is required for meiosis but not for mating type switching, end joining, or telomere maintenance. Mol. Cell. Biol. 19:556-566.[Abstract/Free Full Text]
  58. 30
  59. Moshous, D., I. Callebaut, R. de Chasseval, B. Corneo, M. Cavazzana-Calvo, F. Le Deist, I. Tezcan, O. Sanal, Y. Bertrand, N. Philippe, A. Fischer, and J. P. de Villartay. 2001. Artemis, a novel DNA double-strand break repair/V(D)J recombination protein, is mutated in human severe combined immune deficiency. Cell 105:177-186.[CrossRef][Medline]
  60. 31
  61. Nicolas, A. L., P. L. Munz, E. Falck-Pedersen, and C. S. Young. 2000. Creation and repair of specific DNA double-strand breaks in vivo following infection with adenovirus vectors expressing Saccharomyces cerevisiae HO endonuclease. Virology 266:211-224.[CrossRef][Medline]
  62. 32
  63. Ostapchuk, P., and P. Hearing. 2005. Control of adenovirus packaging. J. Cell. Biochem. 96:25-35.[CrossRef][Medline]
  64. 33
  65. Querido, E., P. Blanchette, Q. Yan, T. Kamura, M. Morrison, D. Boivin, W. G. Kaelin, R. C. Conaway, J. W. Conaway, and P. E. Branton. 2001. Degradation of p53 by adenovirus E4orf6 and E1B55K proteins occurs via a novel mechanism involving a Cullin-containing complex. Genes Dev. 15:3104-3117.[Abstract/Free Full Text]
  66. 34
  67. Rekosh, D. M., W. C. Russell, A. J. Bellet, and A. J. Robinson. 1977. Identification of a protein linked to the ends of adenovirus DNA. Cell 11:283-295.[CrossRef][Medline]
  68. 35
  69. Stewart, G. S., R. S. Maser, T. Stankovic, D. A. Bressan, M. I. Kaplan, N. G. Jaspers, A. Raams, P. J. Byrd, J. H. Petrini, and A. M. Taylor. 1999. The DNA double-strand break repair gene hMRE11 is mutated in individuals with an ataxia-telangiectasia-like disorder. Cell 99:577-587.[CrossRef][Medline]
  70. 36
  71. Stracker, T. H., C. T. Carson, and M. D. Weitzman. 2002. Adenovirus oncoproteins inactivate the Mre11-Rad50-NBS1 DNA repair complex. Nature 418:348-352.[CrossRef][Medline]
  72. 37
  73. Weiden, M. D., and H. S. Ginsberg. 1994. Deletion of the E4 region of the genome produces adenovirus DNA concatemers. Proc. Natl. Acad. Sci. USA 91:153-157.[Abstract/Free Full Text]
  74. 38
  75. Wides, R. J., M. D. Challberg, D. R. Rawlins, and T. J. Kelly. 1987. Adenovirus origin of DNA replication: sequence requirements for replication in vitro. Mol. Cell. Biol. 7:864-874.[Abstract/Free Full Text]
  76. 39
  77. Wilson, S., N. Warr, D. L. Taylor, and F. Z. Watts. 1999. The role of Schizosaccharomyces pombe Rad32, the Mre11 homologue, and other DNA damage response proteins in non-homologous end joining and telomere length maintenance. Nucleic Acids Res. 27:2655-2661.[Abstract/Free Full Text]
  78. 40
  79. Woo, J. L., and A. J. Berk. 2007. Adenovirus ubiquitin-protein ligase stimulates viral late mRNA nuclear export. J. Virol. 81:575-587.[Abstract/Free Full Text]
  80. 41
  81. Yang, Y. G., A. Saidi, P. O. Frappart, W. Min, C. Barrucand, V. Dumon-Jones, J. Michelon, Z. Herceg, and Z. Q. Wang. 2006. Conditional deletion of Nbs1 in murine cells reveals its role in branching repair pathways of DNA double-strand breaks. EMBO J. 25:5527-5538.[CrossRef][Medline]
  82. 42
  83. Yeo, T. C., D. Xia, S. Hassouneh, X. O. Yang, D. E. Sabath, K. Sperling, R. A. Gatti, P. Concannon, and D. M. Willerford. 2000. V(D)J rearrangement in Nijmegen breakage syndrome. Mol. Immunol. 37:1131-1139.[CrossRef][Medline]


Journal of Virology, July 2007, p. 7034-7040, Vol. 81, No. 13
0022-538X/07/$08.00+0     doi:10.1128/JVI.00029-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Nichols, G. J., Schaack, J., Ornelles, D. A. (2009). Widespread Phosphorylation of Histone H2AX by Species C Adenovirus Infection Requires Viral DNA Replication. J. Virol. 83: 5987-5998 [Abstract] [Full Text]  
  • Dallaire, F., Blanchette, P., Groitl, P., Dobner, T., Branton, P. E. (2009). Identification of Integrin {alpha}3 as a New Substrate of the Adenovirus E4orf6/E1B 55-Kilodalton E3 Ubiquitin Ligase Complex. J. Virol. 83: 5329-5338 [Abstract] [Full Text]  
  • Wu, P.-Y., Frit, P., Meesala, S., Dauvillier, S., Modesti, M., Andres, S. N., Huang, Y., Sekiguchi, J., Calsou, P., Salles, B., Junop, M. S. (2009). Structural and Functional Interaction between the Human DNA Repair Proteins DNA Ligase IV and XRCC4. Mol. Cell. Biol. 29: 3163-3172 [Abstract] [Full Text]  
  • Blackford, A. N., Grand, R. J. A. (2009). Adenovirus E1B 55-Kilodalton Protein: Multiple Roles in Viral Infection and Cell Transformation. J. Virol. 83: 4000-4012 [Full Text]  
  • Karen, K. A., Hoey, P. J., Young, C. S. H., Hearing, P. (2009). Temporal Regulation of the Mre11-Rad50-Nbs1 Complex during Adenovirus Infection. J. Virol. 83: 4565-4573 [Abstract] [Full Text]  
  • Thomas, M. A., Broughton, R. S., Goodrum, F. D., Ornelles, D. A. (2009). E4orf1 Limits the Oncolytic Potential of the E1B-55K Deletion Mutant Adenovirus. J. Virol. 83: 2406-2416 [Abstract] [Full Text]  
  • Jayaram, S., Ketner, G., Adachi, N., Hanakahi, L. A. (2008). Loss of DNA ligase IV prevents recognition of DNA by double-strand break repair proteins XRCC4 and XLF. Nucleic Acids Res 36: 5773-5786 [Abstract] [Full Text]  
  • Schwartz, R. A., Lakdawala, S. S., Eshleman, H. D., Russell, M. R., Carson, C. T., Weitzman, M. D. (2008). Distinct Requirements of Adenovirus E1b55K Protein for Degradation of Cellular Substrates. J. Virol. 82: 9043-9055 [Abstract] [Full Text]  
  • Lakdawala, S. S., Schwartz, R. A., Ferenchak, K., Carson, C. T., McSharry, B. P., Wilkinson, G. W., Weitzman, M. D. (2008). Differential Requirements of the C Terminus of Nbs1 in Suppressing Adenovirus DNA Replication and Promoting Concatemer Formation. J. Virol. 82: 8362-8372 [Abstract] [Full Text]  
  • Blackford, A. N., Bruton, R. K., Dirlik, O., Stewart, G. S., Taylor, A. M. R., Dobner, T., Grand, R. J. A., Turnell, A. S. (2008). A Role for E1B-AP5 in ATR Signaling Pathways during Adenovirus Infection. J. Virol. 82: 7640-7652 [Abstract] [Full Text]  
  • Marshall, L. J., Moore, A. C., Ohki, M., Kitabayashi, I., Patterson, D., Ornelles, D. A. (2008). RUNX1 Permits E4orf6-Directed Nuclear Localization of the Adenovirus E1B-55K Protein and Associates with Centers of Viral DNA and RNA Synthesis. J. Virol. 82: 6395-6408 [Abstract] [Full Text]  
  • Nayak, R., Farris, K. D., Pintel, D. J. (2008). E4Orf6-E1B-55k-Dependent Degradation of De Novo-Generated Adeno-Associated Virus Type 5 Rep52 and Capsid Proteins Employs a Cullin 5-Containing E3 Ligase Complex. J. Virol. 82: 3803-3808 [Abstract] [Full Text]  
  • Blanchette, P., Kindsmuller, K., Groitl, P., Dallaire, F., Speiseder, T., Branton, P. E., Dobner, T. (2008). Control of mRNA Export by Adenovirus E4orf6 and E1B55K Proteins during Productive Infection Requires E4orf6 Ubiquitin Ligase Activity. J. Virol. 82: 2642-2651 [Abstract] [Full Text]  
  • Smeaton, M. B., Miller, P. S., Ketner, G., Hanakahi, L. A. (2007). Small-scale extracts for the study of nucleotide excision repair and non-homologous end joining. Nucleic Acids Res 0: gkm974v1-gkm974 [Abstract] [Full Text]  
  • Schwartz, R. A., Palacios, J. A., Cassell, G. D., Adam, S., Giacca, M., Weitzman, M. D. (2007). The Mre11/Rad50/Nbs1 Complex Limits Adeno-Associated Virus Transduction and Replication. J. Virol. 81: 12936-12945 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baker, A.
Right arrow Articles by Ketner, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baker, A.
Right arrow Articles by Ketner, G.