This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jaworska, J.
Right arrow Articles by Flamand, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jaworska, J.
Right arrow Articles by Flamand, L.

 Previous Article  |  Next Article 

Journal of Virology, June 2007, p. 5737-5748, Vol. 81, No. 11
0022-538X/07/$08.00+0     doi:10.1128/JVI.02443-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Inhibition of Transcription of the Beta Interferon Gene by the Human Herpesvirus 6 Immediate-Early 1 Protein{triangledown}

Joanna Jaworska,1 Annie Gravel,1 Karin Fink,2 Nathalie Grandvaux,2 and Louis Flamand1*

Laboratory of Virology, Rheumatology and Immunology Research Center, CHUQ Research Center, and Faculty of Medicine, Laval University, Quebec, Quebec, Canada,1 Department of Biochemistry, Faculty of Medicine, University of Montreal, and CHUM Research Center-Hôpital St.-Luc, Montreal, Quebec, Canada2

Received 6 November 2006/ Accepted 9 March 2007


arrow
ABSTRACT
 
Human herpesviruses (HHV) are stealth pathogens possessing several decoy or immune system evasion mechanisms favoring their persistence within the infected host. Of these viruses, HHV-6 is among the most successful human parasites, establishing lifelong infections in nearly 100% of individuals around the world. To better understand this host-pathogen relationship, we determined whether HHV-6 could interfere with the development of the innate antiviral response by affecting interferon (IFN) biosynthesis. Using inducible cell lines and transient transfection assays, we have identified the immediate-early 1 (IE1) protein as a potent inhibitor of IFN-ß gene expression. IE1 proteins from both HHV-6 variants were capable of suppressing IFN-ß gene induction. IE1 prevents IFN-ß gene expression triggered by Sendai virus infection, double-stranded RNA (dsRNA) and dsDNA transfection, or the ectopic expression of IFN-ß gene activators such as retinoic inducible gene I protein, mitochondrial antiviral signaling protein, TBK-1, I{kappa}B kinase {varepsilon} (IKK{varepsilon}), and IFN regulatory factor 3 (IRF3). While the stability of IFN-ß mRNA is not affected, IE1-expressing cells have reduced levels of dimerized IRF3 and nucleus-translocated IRF3 in response to activation by TBK-1 or IKK{varepsilon}. Using nuclear extracts and gel shift experiments, we could demonstrate that in the presence of IE1, IRF3 does not bind efficiently to the IFN-ß promoter sequence. Overall, these results indicate that the IE1 protein of HHV-6, one of the first viral proteins synthesized upon viral entry, is a potent suppressor of IFN-ß gene induction and likely contributes to favor the establishment of and successful infection of cells with this virus.


arrow
INTRODUCTION
 
The interferon (IFN) system represents one of the most potent antiviral immune defense mechanisms available to the host to defend against viral invaders. Although discovered in the late 1950s (36), the IFN system is presently the subject of intense research efforts, with the identification over the last few years of key players regulating the induction of type I IFN (IFN-{alpha} and IFN-ß) genes. Cellular sensors capable of recognizing various viral determinants initiate the signaling cascade leading to IFN production. The known viral determinants and cellular sensors are as follows: (i) the recognition of 5' phosphate-bearing single-stranded RNA genomes such as those of orthomyxoviruses, paramyxoviruses, rhabdoviruses, and flaviviruses by the cytoplasmic retinoic inducible gene I protein (RIG-I) (33, 39, 60, 77); (ii) the recognition of Picornaviridae RNA genomes and double-stranded RNA (dsRNA) by melanoma differentiation antigen 5 (39); (iii) the recognition of dsRNA, single-stranded RNA, or unmethylated CpG DNA by Toll-like receptor 3, 7/8, or 9, respectively (reviewed in reference 2); and (iv) a newly identified pathway involved in the recognition of cytosolic dsDNA (37, 72). All these pathways converge to induce the phosphorylation and subsequent activation of the IFN regulatory factor 3 (IRF3) by TBK-1/I{kappa}B kinase {varepsilon} (IKK{varepsilon}) (20, 68). Once phosphorylated, IRF3 homodimerizes and translocates to the nucleus, where it joins NF-{kappa}B, ATF-2/c-Jun, and the architectural protein HMG I(Y) to form a complex known as the enhanceosome that binds to the IFN-ß promoter, leading to efficient IFN-ß gene transcription (49). IFN-ß is then secreted and binds to the ubiquitously expressed IFN-{alpha}/ß receptor, leading to the activation of Tyk2 and JAK1 kinases (for a recent review, consult reference 32). Next, these kinases phosphorylate and activate the signal transducer and activator of transcription proteins 1 and 2, which associate with IRF9 to form the IFN-stimulated gene factor 3 (ISGF3) complex. ISGF3 initiates the transcription of several IFN-stimulated genes (ISGs) by binding to the IFN-stimulated response elements (ISREs) in their promoter regions. Among such genes are those for major histocompatibility complex class I, IRF7, Toll-like receptor 3, Toll-like receptor 7, and RIG-I. The ISGs inhibit different stages of virus replication and elicit an antiviral state in the host.

Herpesviruses are among the most successful infectious organisms colonizing the human host. To efficiently do so, these large dsDNA viruses manipulate the host immune system in many different ways, allowing them to partially evade immune surveillance and ensure their existence within infected individuals. Considering that one of the first and most potent antiviral defense mechanisms triggered following viral infections involves the synthesis and release of alpha and/or beta interferon by infected cells, it is not surprising that many viruses, including herpesviruses, have countermeasures that negatively influence IFN production. For a recent review, consult Mossman and Ashkar (55). For example, herpes simplex virus (HSV), human cytomegalovirus (HCMV), and human herpesvirus 8 (HHV-8) impair IFN-ß production by interfering with the activities of IRF3 and/or IRF7 (1, 43, 44, 47, 51, 56, 80, 83). IFN signaling is also impaired in HSV-, HCMV-, and HHV-8-infected cells, ensuring that if the production of IFNs does occur, these antiviral cytokines can no longer transmit their activation signals (15, 25, 53, 54, 75, 76, 83). Lastly, the functional inhibition of ISG products such as the dsRNA-dependent protein kinase R, a kinase regulating protein translation, has been reported to occur in HSV- and HCMV-infected cells (12, 13, 16).

HHV-6 was first isolated 20 years ago from patients with AIDS and various lymphoproliferative disorders (64). HHV-6 is a member of the betaherpesvirus subfamily, together with HCMV and HHV-7. HHV-6 has a worldwide distribution, and by the age of three, most individuals have contracted an HHV-6 infection (57, 79). Transmission likely occurs through saliva, where cell-free HHV-6 is present in nearly all individuals (42, 82). Upon partial genomic sequencing of HHV-6 isolates, it became apparent that two distinct HHV-6 subtypes exist. These variants, referred to as HHV-6 types A and B (HHV-6A and HHV-6B), have distinct biological properties, such as their ability to be propagated in different cell lines and their association with specific pathological conditions.

The most common clinically defined disease associated with HHV-6 is the common childhood illness roseola, also referred to as exanthem subitum (74). Nearly all (99%) episodes of roseola are linked to HHV-6B infection. Other complications of primary HHV-6B infection include hepatitis, meningitis, fatal hemophagocytic syndrome, and fatal disseminated infection (4, 34, 35, 61). Severe complications in bone marrow transplant patients have been associated with HHV-6 (9, 19, 78). In fact, HHV-6B reactivation after allogeneic hematologic stem cell transplantation is common and is associated with subsequent delayed monocyte and platelet engraftment, increased platelet transfusion requirements, all-cause mortality, graft-versus-host disease, and central nervous system dysfunction (81).

Our work and that of others have reported the broad immunomodulating properties of HHV-6 (21-23, 26, 38, 69, 70). However, for reasons that are not clear, the ability of HHV-6 to modulate IFN-ß gene induction has not been studied. In the present work, we provide evidence that HHV-6 curtails IFN-ß gene induction through the impaired nuclear translocation of activated IRF3 and reduced IRF3 binding to the IFN-ß promoter, causing inefficient IFN-ß gene activation. Furthermore, we have identified the HHV-6 product encoded by the immediate-early 1 (IE1) gene as the agent responsible for this effect. Taken together, these results highlight for the first time how HHV-6 is able to thwart the potent antiviral activities of IFNs and add to the long list of mechanisms by which herpesviruses counteract innate immune defenses.


arrow
MATERIALS AND METHODS
 
Cell culture and virus preparation. The Molt-3, Jurkat, and Supt1 cell lines, obtained from the American Type Culture Collection, were passaged twice a week and cultured in MegaCell RPMI 1640 medium (Sigma-Aldrich Canada, Oakville, Ontario) supplemented with 3% fetal bovine serum (Sigma-Aldrich) and M-Plasmocin (InvivoGen, San Diego, California; complete medium) to prevent mycoplasma contamination. The 293T cell line was cultured in complete MegaCell Dulbecco's modified Eagle's medium (Sigma-Aldrich) and passaged twice a week. The Z29 strain of HHV-6 was propagated in Molt-3 cells as previously described (29). HHV-6 was concentrated by ultracentrifugation at 38,800 x g for 160 min. Virions were resuspended in a minimal volume of complete RPMI 1640 medium, aliquoted, and stored at –150°C. The HHV-6 infectivity titer in Molt-3 cells was determined 24 h after infection with various dilutions of HHV-6. Infected cells were fixed in cold acetone for 10 min, air dried, and allowed to react with Alexa 488-labeled anti-IE1 antibodies for 1 h at room temperature. After three 5-min washes in phosphate-buffered saline, slides were mounted with glycerol and observed under a fluorescence microscope. After the calculation of the percentage of IE1-positive cells, the HHV-6 titer was determined to be 6 x 106 infectious particles/ml. The HHV-6 GS strain was propagated and concentrated as previously described (21). Sendai virus (SeV; Cantell strain) was purchased from the Charles River Laboratory (Saint-Constant, Quebec, Canada).

PBMC isolation and infection. Peripheral blood mononuclear cells (PBMC) were obtained from healthy donors after the centrifugation of venous blood over Ficoll-Paque PLUS gradient (GE Healthcare, Piscataway, NJ) followed by three washes with phosphate-buffered saline. In some experiments, PBMC (5 x 106) were preincubated for 30 min with 50 µg of cycloheximide (CHX)/ml. PBMC were treated with infectious or UV radiation-inactivated HHV-6 (multiplicity of infection, 0.1) for various periods of time, after which total RNA was extracted by using the TRIzol reagent (Invitrogen) and processed for mRNA analysis by reverse transcriptase quantitative PCR (RT-QPCR). In brief, 1 µg of total RNA was reverse transcribed in a total volume of 20 µl by using Moloney murine leukemia virus reverse transcriptase. One-tenth of the cDNA was used for the amplification of GAPDH, IFN-ß, and IE1 genes with the following primer pairs and probes: GAPDH gene forward primer, 5'-CGAGATCCCTCCAAAATCAA-3'; GAPDH gene reverse primer, 5'-TTCACACCCATGACGAACAT-3'; GAPDH gene probe, 5'-hexachloro-6-carboxyfluorescein-TGGAGAAGGCTGGGGCTCAT-black-hole quencher 1 (BHQ1)-3'; IFN-ß gene forward primer, 5'-AAACTCATGAGCAGTCTGCA-3'; IFN-ß gene reverse primer, 5'-AGGAGATCTTCAGTTTCGGAGG-3'; IFN-ß gene probe, 5'-6-carboxyfluorescein-ATGGTCCAGGCACAGTGACTGTCCTC-BHQ1-3'; HHV-6A and HHV-6B IE gene forward primer, 5'-GGCGGTGTCT(G/C)AATTTGCATC-3'; HHV-6A and HHV-6B IE gene reverse primer, 5'-CA(C/T)TGGATCGGGA(C/T)GGTAGT(C/T)TT-3'; and HHV-6A and HHV-6B IE gene probe, 5'-6-carboxyfluorescein-ACCCTCTGGAAACAACATGG(A/G)ATCCAA-BHQ1-3'. Reference standard curves were used to determine the total copy number for each gene, and all samples were normalized by using GAPDH gene expression.

Generation of IE1-expressing inducible cell lines. The T-REx system (Invitrogen, Carlsbad, CA) was used to generate inducible cell lines for the expression of IE1 proteins from HHV-6A and HHV-6B (IE1A and IE1B). The gene encoding IE1A was subcloned from the pR56 vector (50) into pcDNA4TO by using EcoRI. The IE1B gene (29) was subcloned from pBK-IE1B into pcDNA4TO by using BamHI and XhoI. A 293T cell line stably expressing the tetracycline (Tet) repressor from the pcDNA6 TR plasmid (293T-6TR) was used for transfection with empty pcDNA4TO, pcDNA4TO-IE1A, and pcDNA4TO-IE1B plasmids. Clones were selected using 50 µg of a phleomycin D1 solution (Zeocin)/ml. IE1A and IE1B expression was induced by adding 1 µg of Tet to the culture medium, and the expression was analyzed by immunofluorescence assays and immunoblotting (IB) using rabbit anti-IE1 sera as described previously (29).

Plasmids and reagents. IFN-ß-Luc and expression vectors for RIG-I, TBK-1, IKK{varepsilon}, IRF3, and IRF3-green fluorescent protein (GFP) were obtained from J. Hiscott, and IRF3(5D) (46) was obtained from R. Lin (Lady Davis Institute, McGill University, Montreal, Canada). The mitochondrial antiviral signaling protein (MAVS) expression vector (66) was obtained from Zhijian "James" Chen (University of Texas Southwestern Medical Center, Dallas, TX). ISRE-Luc and NF-{kappa}B-Luc reporter plasmids were purchased from Clontech (Mountain View, CA).

Transfection. Ten million Jurkat and Supt1 cells were transfected by electroporation (250 V, 960 µF) with 2 µg of the IFN-ß-Luc or ISRE-Luc reporter together with 18 µg of the pcDNA, pcDNA4TO-IE1A, or pcDNA4TO-IE1B expression vector. Twenty-four hours after transfection, cells were infected with 40 hemagglutinin units (HAU) of SeV for an additional 24 h, after which the cells were lysed and luciferase activity was measured on an MLX microtiter plate luminometer (Dynex Technologies, Chantilly, VA) as previously described (30).

Transfections of HEK293T cells were performed by using the calcium phosphate precipitation procedures. Cells were plated at 200,000 cells/well (6-well plate) the day prior to transfection. Cells were transfected with 0.2 µg of a reporter plasmid and up to 4 µg of an expression vector per well, and the amount of DNA was brought to a total of 5 µg per well for each condition with the pcDNA4TO control plasmid. Cells were lysed 48 h after transfection, and luciferase activity was evaluated as described above.

IFN-ß gene induction and protein secretion. 293T control cells and 293T cells transfected with the IE1A or IE1B expression vector were plated at 200,000 cells/well in a 6-well plate and treated with 1 µg of Tet/ml for 24 h or left untreated. Cells were then either infected with 40 HAU of SeV/ml or transfected with 1 µg of poly(I-C)/ml or 10 µg poly(dA-dT) (Amersham) by using Lipofectamine (Invitrogen) as the transfection reagent. After 24 h, total RNA was extracted and processed for GAPDH and IFN-ß mRNA quantitation as described above.

For some experiments, 293T cells were transfected with IFN-ß inducers, such as RIG-I, MAVS, TBK-1, IKK{varepsilon}, and IRF3(5D) plasmids, together with increasing quantities of IE1A and IE1B expression vectors. The level of DNA was kept constant at 5 µg by the addition of the empty pcDNA vector. Twenty-four hours posttransfection, total RNA was extracted and processed for the quantitation of IFN-ß, GAPDH, RANTES, ISG15, and 2',5'-oligoadenylate synthetase (2',5'-OAS) mRNA by RT-QPCR as described above. Levels of RANTES, ISG15, and 2',5'-OAS mRNA were determined by using SYBR green dye and the following primer pairs: RANTES gene forward primer, 5'-GAGGCTTCCCCTCACTATCC-3'; RANTES gene reverse primer, 5'-CTCAAGTGATCCACCCACCT-3'; ISG15 gene forward primer, 5'-CATGGGCTGGGACCTGACG-3'; ISG15 gene reverse primer, 5'-CGCCAATCTTCTGGGTGATCTG-3'; 2',5'-OAS gene forward primer, 5'-CAAGCTCAAGAGCCTCATCC-3'; and 2',5'-OAS gene reverse primer, 5'-TGGGCTGTGTTGAAATGTGT-3'.

For the detection of secreted IFN-ß protein, cell-free supernatants were collected at various time points after SeV infection and analyzed by using a commercial enzyme-linked immunosorbent assay (ELISA) kit according to the recommendations of the supplier (PBL Biomedical Laboratories, Piscataway, NJ).

IFN-ß mRNA stability analysis. 293T cells were transfected with 0.5 µg of TBK-1 or IKK{varepsilon}, together with 4 µg of the IE1B expression vector. Twenty-four hours posttransfection, a 3-µg/ml concentration of actinomycin D, a transcription-blocking agent, was added to the cultures. Total RNA was extracted at various time points after transcriptional blockage and analyzed for IFN-ß and GAPDH mRNA by TaqMan RT-QPCR as described above.

IRF3 translocation, subcellular localization, and dimerization assays. For translocation studies, 293T cells were transfected with 0.05 µg of IRF3-GFP and 0.5 µg of the TBK-1 or IKK{varepsilon} vector, together with 4 µg of pcDNA4 (control) or 4 µg of the IE1B expression vector. Twenty-four hours later, cells were examined under an inverted fluorescence microscope.

The cytoplasmic and nuclear distribution of IKK{varepsilon}-activated IRF3 in IE1-expressing cells was determined 24 h posttransfection. Cytoplasm and nuclear fractions were obtained as described by Patra et al. (58). Extracts were analyzed by IB using anti-myc (IRF3), anti-Flag (IKK{varepsilon}), anti-IE1, anti-poly(ADP-ribose) polymerase-1 protein (anti-PARP; nuclear), and anti-actin (cytoplasmic) antibodies.

For IRF3 dimerization studies, 293T cells were cotransfected with TBK-1 (0.2 µg) and increasing quantities (0.8 and 4 µg) of the IE1A or IE1B expression vector. Twenty-four hours later, cells were detached from the culture dish, lysed in nondenaturing buffer (50 mM Tris, pH 7.4; 150 mM NaCl; 30 mM NaF; 5 mM EDTA; 10% glycerol; 1.0 mM Na3VO4; 40 mM 2-glycerophosphate; 0.1 mM phenylmethylsulfonyl fluoride; 5 µg each of leupeptin, pepstatin, and aprotinin/ml; and 1% Nonidet P-40), and processed as described in reference 48, except that immunodetection was performed by using a polyclonal rabbit anti-IRF3 antibody (kindly provided by M. David).

DNA affinity binding assay. 293T cells were transfected with myc-IRF3 with or without the IE1A or IE1B expression vector. Twenty-four hours after transfection, cells were infected with 40 HAU/well in a 6-well plate, and 18 h later, nuclear extracts were made as described by Severa et al. (67). Briefly, a biotinylated oligonucleotide containing the IFN-ß promoter sequence (5'CCCCCCAAATGACATAGGAAAACTGAAAGGGAGAAGTGAAAGTGGGAAAATTCC-3') was annealed with the corresponding antisense oligonucleotide in 1x SSC buffer (0.15 M NaCl, 15 mM sodium citrate). Biotinylated DNA oligonucleotides were mixed with 150 µg of nuclear extracts in 500 µl of binding buffer containing 20 mM Tris-HCl (pH 7.5), 75 mM KCl, 1 mM dithiothreitol, and 5 mg of bovine serum albumin/ml in the presence of 13% glycerol and 20 µg of poly(dI-dC), and the mixture was incubated for 25 min at room temperature. Then streptavidin magnetic beads (Roche), washed three times with 400 µl of 1x binding buffer, were added to the reaction mixture, and the mixture was incubated for 30 min at 4°C and for 10 min at room temperature, with mixing by rotation. The beads were collected with a magnet and washed three times with 500 µl of binding buffer. The bound proteins were eluted from the beads by boiling in Laemmli sample buffer and were resolved on sodium dodecyl sulfate-7.5% polyacrylamide gel, followed by IB using anti-myc (IRF3) and anti-IE1. The use of equal amounts of nuclear extracts in the assay was confirmed by IB using the anti-PARP1 antibody.


arrow
RESULTS
 
IFN-ß gene expression in response to HHV-6 infection. Our first series of experiments was designed to study IFN-ß gene expression in response to HHV-6 infection. PBMC were treated with HHV-6A in the absence or in the presence of the protein translation inhibitor CHX for 24 h, after which IFN-ß gene expression was assessed by RT-QPCR. As shown in Fig. 1A, the infection of cells with HHV-6A led to the induction of IFN-ß mRNA production. However, in the presence of CHX, cells responded to HHV-6A infection by making significantly more IFN-ß mRNA than cells exposed to HHV-6A only. As a control, PBMC treated with CHX exhibited only marginal effects on IFN-ß gene expression (data not shown). These results suggested that a virally encoded protein might impair IFN-ß gene induction in the context of HHV-6 infection. To confirm and extend these results to the other HHV-6 variant, PBMC were exposed to infectious or UV-irradiated HHV-6B. UV irradiation of the viral preparation causes nucleic acid damage, preventing viral gene transcription. As shown in Fig. 1B, UV radiation-inactivated HHV-6B led to a greater increase in IFN-ß gene transcription than infectious HHV-6B. The efficiency of UV radiation inactivation was determined by assessing the expression of the IE1 and IE2 genes of HHV-6. Compared to infectious virus, which expressed significant levels of IE mRNA, UV-irradiated virus was deficient in the expression of the IE genes (data not shown). Once again, these results indicate that the expression of one or several viral IE proteins may interfere with IFN-ß gene induction.


Figure 1
View larger version (10K):
[in this window]
[in a new window]

  		FIG. 1. IFN-ß gene induction in response to HHV-6 infection. (A) PBMC were infected with HHV-6A in the absence or presence of CHX. After 24 h, total RNA was isolated and analyzed for IFN-ß mRNA by RT-QPCR. All samples were normalized using GAPDH housekeeping gene expression. (B) PBMC were infected with live or UV radiation-inactivated HHV-6B for 12 and 24 h, after which total RNA was isolated and analyzed for IFN-ß mRNA by RT-QPCR. All samples were normalized using GAPDH housekeeping gene expression. Results are expressed as the increases (n-fold) in mRNA levels and are representative of results from two separate experiments.

Identification of IE1 as an inhibitor of IFN-ß gene induction. Investigators in our laboratory have been actively studying HHV-6 IE proteins for the past several years. Considering that IE proteins are among the first ones synthesized during the infectious process, we hypothesized that an IE protein from HHV-6 may interfere with IFN-ß gene induction. The HHV-6 IE1 protein is rapidly synthesized (within 2 h) after infection (29) and constituted a potential candidate. The Jurkat T-lymphocytic cell line was transfected with expression vectors coding for IE1A or IE1B, together with luciferase reporters whose expression was driven by the IFN-ß promoter (IFN-ß-Luc) or ISREs (ISRE-Luc). The IFN gene induction pathway was triggered by infecting cells with the paramyxovirus SeV, a powerful IFN inducer. As shown in Fig. 2, compared to a lack of infection, SeV infection activated both IFN-ß-Luc and ISRE-Luc reporters very efficiently. In contrast, in IE1A- and IE1B-expressing cells, the IFN-ß-Luc and ISRE-Luc reporters were very poorly activated in response to SeV infection. Similar results were obtained when the experiment was repeated using the Supt1 T-cell line (data not shown). These results indicate that IE1A and IE1B of HHV-6 can efficiently block IFN-ß gene induction when the IFN pathway is triggered with an inducer such as SeV.


Figure 2
View larger version (8K):
[in this window]
[in a new window]

  		FIG. 2. Inhibition of Sendai virus-induced IFN-ß-Luc and ISRE-Luc reporter activation by HHV-6 IE1 in the human Jurkat T-cell line. Jurkat T cells were cotransfected with the IFN-ß-Luc or ISRE-Luc reporter and a pcDNA (control) or IE1A or IE1B expression vector. Twenty-four hours later, cells were infected with SeV for 24 h, after which luciferase activity was assessed. Results are expressed as the level of activation (n-fold) relative to the activity in control transfected cells and are representative of results from three independent experiments.

Generation and characterization of 293T IE1-expressing inducible cell lines. To better study the ability of HHV-6 IE1 to block IFN-ß gene induction, stable clones of 293T cells carrying inducible expression vectors coding for HHV-6 IE1A and IE1B were generated. In the absence of Tet, the expression of IE1 is prevented through the action of the Tet repressor encoded by the pcDNA6TR vector. Upon the addition of Tet (1 µg/ml) to the culture medium, the Tet repressor is rendered inactive, allowing the transcription of IE1 to occur. As presented in Fig. 3A, the expression of IE1A and IE1B in the absence of Tet was virtually undetectable while, after 24 h, the addition of Tet resulted in the expression of IE1 proteins (150 kDa) that reacted specifically with an anti-IE1 hyperimmune rabbit serum (29).


Figure 3
View larger version (47K):
[in this window]
[in a new window]

  		FIG. 3. Characterization of HHV-6 IE1-expressing inducible cell lines. (A) Clones of 293T cells carrying Tet-inducible HHV-6 IE1A or IE1B expression vectors were incubated in the absence or in the presence of 1 µg of Tet/ml for 24 h, after which IE1 expression was determined by IB using a rabbit anti-IE1 antiserum ({alpha}-IE1). WB, Western blot; MWM, molecular mass marker; +, present; –, absent. (B) Control and IE1-expressing inducible 293T cell lines were treated with Tet for 24 h and analyzed for IE1 expression by immunofluorescence assays using rabbit anti-IE1 antiserum. (C) Kinetics of IE1 expression following Tet addition. A 293T cell line carrying an IE1B expression vector was treated with Tet for various periods of time, after which the level of IE1 expression was determined by IB analysis.

Control 293T cells and 293T cells carrying IE1A- or IE1B-inducible expression vectors were also examined by immunofluorescence assays using anti-IE1 hyperimmune rabbit serum following the incubation of cells with Tet for 24 h. As shown in Fig. 3B, the anti-IE1 serum was not reactive against 293T control cells while nuclear proteins were detected in 293T cells carrying the IE1A or IE1B expression vector. The nuclear punctate pattern of IE1A and IE1B proteins was very similar to that observed during the initial phase of infection (29).

The kinetics of IE1 expression following Tet addition was studied next. As shown in Fig. 3C, IE1B expression could be detected as soon as 6 h post-Tet addition. When films were overexposed, IE1 could be detected at 4 h (data not shown). IE1 expression continued to increase up to 48 h post-Tet addition. Similar results were obtained for IE1A (data not shown).

Inhibition of IFN-ß gene transcription and protein secretion by HHV-6 IE1 protein. IE1A- and IE1B-inducible cell lines were tested for IFN-ß gene expression in response to SeV infection. Cells induced by overnight incubation with Tet and cells left uninduced were infected with SeV for 18 h and analyzed for IFN-ß mRNA levels by RT-QPCR. As shown in Fig. 4A, control cells expressed the same levels of IFN-ß mRNA in the absence and in the presence of Tet. In contrast, the levels of IFN-ß mRNA in Tet-treated 293T cells carrying the IE1A or IE1B expression vector were drastically reduced (>90%) relative to those in IE1A- and IE1B-expressing 293T cells that were not treated with Tet. We performed a similar experiment using nucleic acids instead of SeV as the IFN inducer. Cells were treated with Tet for 24 h and then transfected with poly(I-C) in the form of dsRNA or poly(dA-dT) in the form of dsDNA. As shown in Fig. 4B, the levels of IFN-ß mRNA in IE1A- and IE1B-expressing cells were up to 1 log10 lower than those in 293T cells carrying the pcDNA control vector. These results indicate that when IE1 is expressed, IFN-ß gene induction by SeV, dsRNA, and dsDNA is severely impaired.


Figure 4
View larger version (18K):
[in this window]
[in a new window]

  		FIG. 4. Inhibition of IFN-ß mRNA and protein synthesis by HHV-6 IE1. (A) 293T control and IE1A- or IE1B-expressing inducible cell lines were left untreated (–) or treated with Tet (+) for 24 h, after which cells were infected with SeV. Twenty-four hours postinfection, the levels of IFN-ß and GAPDH mRNA expression were determined by RT-QPCR. Results are expressed as percentages of the IFN-ß mRNA level in uninduced cells. (B) Tet-treated 293T control and IE1-expressing inducible cell lines were transfected with poly(I-C) or poly(dA-dT) for 24 h and analyzed for IFN-ß and GAPDH mRNA expression by RT-QPCR. Results are expressed as IFN-ß mRNA levels relative to that in untransfected cells. (C) 293T control and IE1A- or IE1B-expressing inducible cell lines were infected with SeV for 24 h, after which IE1 expression was induced by Tet. Total RNA was extracted at various time points after the addition of Tet, and IFN-ß GAPDH mRNA was quantitated by RT-QPCR. (D) Triplicate cultures of 293T control and IE1A- or IE1B-expressing inducible cell lines were treated with Tet for 24 h and infected with SeV. Supernatants were collected at various times after infection and analyzed for IFN-ß protein by ELISA. Results are expressed as means ± standard deviations of IFN-ß levels (picograms per milliliter) and are representative of results from two independent experiments.

Next, a variant of the above-mentioned study was performed. Uninduced 293T control cells and 293T cells transfected with the IE1A or IE1B expression vector were first infected with SeV for 18 h, and then IE1 expression was turned on by the addition of Tet to the culture medium. Total RNA was extracted at various time points after the addition of Tet and analyzed for IFN-ß mRNA. As shown in Fig. 4C, during the first 2 h following the addition of Tet, the IFN-ß mRNA levels in the three cell lines were similar. Between 4 and 24 h after the induction of IE1 expression, a sharp drop in the levels of IFN-ß mRNA in IE1A- and IE1B-expressing 293T cells was observed while the level of IFN-ß mRNA in 293T control cells remained fairly stable. At 24 h post-Tet addition, the levels of IFN-ß mRNA in IE1-expressing cells were reduced by more than 99% compared to that in control 293T cells. GAPDH mRNA levels remained fairly stable in all cell lines and were used for normalization. These results suggest that in the presence of IE1, IFN-ß gene transcription is rapidly turned off or, alternatively, that IE1 causes the premature degradation of IFN-ß mRNA.

We next sought confirmation that the reduced IFN-ß mRNA levels observed in IE1-expressing cells led to reduced IFN-ß protein secretion. 293T control cells and 293T cells carrying the IE1A or IE1B expression vector were treated with Tet for 24 h, after which cells were infected with SeV. Supernatants were collected at various time points after infection and analyzed by ELISA. The results presented in Fig. 4D indicate that IE1-expressing cells did indeed secrete significantly less IFN-ß protein than 293T control cells in response to SeV infection. After 24 h of infection with SeV, IFN-ß levels in supernatants from IE1-expressing cells were reduced fivefold compared to those in supernatants from control cells.

IE1 does not inhibit the NF-{kappa}B signaling pathway. The IFN-ß gene is regulated in part by the NF-{kappa}B pathway, and a blockage of this pathway may lead to impaired IFN-ß gene transcription (49). To determine whether HHV-6 IE1 affected the NF-{kappa}B pathway, uninduced cells were transfected with an NF-{kappa}B-Luc reporter plasmid, followed by the induction of IE1 expression with Tet. The results presented in Fig. 5A indicate that IE1 has no negative effect on the basal NF-{kappa}B activity. In fact, a slight activation (1.5- to 4-fold) of NF-{kappa}B activity was observed when IE1 was expressed, in accordance with findings from our previous work indicating that IE1 does not activate NF-{kappa}B efficiently (28). We next determined the impact of IE1 expression on SeV-induced NF-{kappa}B activity in 293T cells. Control and IE1A- or IE1B-expressing cells were infected with SeV, and 24 h later, luciferase activity was assessed. In the absence of IE1, SeV infection led to a 30-fold activation of the NF-{kappa}B reporter, while in the presence of IE1, the NF-{kappa}B reporter was activated 140-fold. These results indicate that the HHV-6 IE1A and IE1B proteins do not negatively influence basal and SeV-induced NF-{kappa}B activity.


Figure 5
View larger version (13K):
[in this window]
[in a new window]

  		FIG. 5. Effects of HHV-6 IE1 on NF-{kappa}B activity. (A) 293T control and IE1A- or IE1B-expressing inducible cell lines were transfected with the NF-{kappa}B-Luc reporter and either left untreated (–) or treated with Tet (+) for 24 h, after which luciferase activity was assessed. (B) 293T control and IE1A- or IE1B-expressing cells were transfected with the NF-{kappa}B-Luc reporter construct and treated with Tet for 24 h, followed by infection with SeV. After an additional 24 h, cells were harvested and luciferase activity was assessed. Results are expressed as means ± standard deviations of activation levels (n-fold) and are representative of results from three independent experiments.

Interference of IE1 with the IFN-ß gene induction pathways. The pathways leading to IFN-ß gene induction involve the participation of several proteins acting in cascade. With the hopes of identifying at which level IE1 may interfere with IFN-ß gene induction, 293T cells were cotransfected with key regulatory elements of the IFN-ß pathway [RIG-I, MAVS, TBK-1, IKK{varepsilon}, and IRF3(5D)] and increasing quantities of IE1. Twenty-four hours later, IFN-ß mRNA levels were analyzed by RT-QPCR. The results obtained are presented in Fig. 6. As shown, in the absence of IE1, effectors such as RIG-I, MAVS, TBK-1, IKK{varepsilon}, and IRF3(5D) induced considerable expression of IFN-ß mRNA. However, in the presence of IE1A or IE1B, a dose-dependent inhibition of IFN-ß mRNA was observed for all effectors tested. These results suggest that IE1 inhibits the IFN-ß gene expression pathway at or downstream of IRF3.


Figure 6
View larger version (19K):
[in this window]
[in a new window]

  		FIG. 6. Effects of HHV-6 IE1 on the activation of the IFN-ß gene by key regulatory proteins. 293T cells were transfected with increasing quantities (0, 0.8, and 4.0 µg) of IE1A or IE1B together with the RIG-I (A), MAVS (B), TBK-1 (C), IKK{varepsilon} (D), or IRF3(5D) (E) expression vector. Twenty-four hours later, total RNA was extracted and the expression of IFN-ß and GAPDH genes was evaluated by RT-QPCR. Results are expressed as the increases (n-fold) in IFN-ß mRNA levels relative to the level in cells transfected in the absence of an IFN-ß inducer and were normalized by using GAPDH housekeeping gene expression. Results are representative of those from two independent experiments.

Effect of IE1 on IFN-ß mRNA stability. To determine whether the inhibition of IFN-ß mRNA expression by IE1 results from increased IFN-ß mRNA turnover, 293T cells were transfected (in triplicate) with TBK-1 (as an IFN-ß inducer) alone or together with the IE1A or IE1B expression vector. Twenty-four hours later, actinomycin D (a transcription inhibitor) was added to the culture medium, and total RNA was isolated at various time points. The decay of IFN-ß mRNA in control and IE1A- and IE1B-expressing cells was monitored over a period of 240 min and expressed relative to the levels of mRNA at time point 0 (100%). At time point 0, the IFN-ß mRNA level in TBK-1-treated cells was 10 times higher than that in cells transfected with IE1 and TBK-1 (data not shown), indicating that IE1 efficiently inhibited IFN-ß gene expression as discussed above. The results (Fig. 7) obtained showed that the rates of decay of IFN-ß mRNA were similar in the absence and in the presence of IE1 and that IFN-ß mRNA had a half-life of 3 h. These results indicate that the ability of IE1 to suppress IFN-ß mRNA and protein synthesis does not result from the accelerated turnover of IFN-ß mRNA.


Figure 7
View larger version (16K):
[in this window]
[in a new window]

  		FIG. 7. Effects of IE1 expression on IFN-ß mRNA stability. 293T cells were cotransfected (in triplicate) with 4 µg of IE1A or IE1B and 1 µg of TBK-1 for 24 h. Cells were then treated with actinomycin D (Act.D; 10 µg/ml), and total RNA was extracted at various time points, after which IFN-ß and GAPDH mRNA levels were determined by RT-QPCR. Results are expressed as percentages of the IFN-ß mRNA level at time point 0 relative to the addition of actinomycin D.

IE1 impairs TBK-1/IKK{varepsilon}-induced IRF3 nuclear translocation. The results obtained thus far indicated that IE1 negatively influences the IFN-ß gene expression pathway at the level of, or downstream of, IRF3. We next determined whether IRF3 would translocate properly to the nucleus in the presence of IE1. 293T cells were transfected with IRF3-GFP, the IRF3-activating kinase TBK-1 or IKK{varepsilon}, and IE1B and examined the next day under an inverted fluorescence microscope. As shown in Fig. 8A, cells transfected with IRF3-GFP alone had a pattern of IRF3-GFP expression that was restricted to the cytoplasm. In contrast, when TBK-1 or IKK{varepsilon} was introduced, IRF3-GFP was efficiently translocated to the nucleus, as expected. However, in the presence of IE1B, IRF3-GFP was no longer translocated to the nucleus in response to TBK-1 or IKK{varepsilon} expression. Similar results were obtained with IE1A (data not shown). These results indicate that IE1 somehow interferes with the translocation of IRF3 to the nucleus or the accumulation of IRF3 there.


Figure 8
View larger version (40K):
[in this window]
[in a new window]

  		FIG. 8. HHV-6 IE1 interferes with the nuclear translocation and dimerization of IRF3. (A) 293T cells were cotransfected with the IRF3-GFP, TBK-1, or IKK{varepsilon} and IE1 expression vectors. After 18 h, cells were observed under a fluorescence microscope to visualize cytoplasmic and nuclear fluorescence. (B) 293T cells were cotransfected with various combinations of IRF3-myc, IKK{varepsilon}-Flag, and IE1B expression vectors. After 24 h, cytoplasmic and nuclear fractions were isolated and subjected to IB using anti-actin, anti-PARP, anti-myc, anti-IE1, and anti-Flag antibodies. +, present; –, absent. (C) 293T cells were cotransfected with TBK-1 and increasing quantities of the IE1A or IE1B expression vector. After 24 h, cells were lysed in nondenaturing buffer and analyzed for IRF3 dimer formation by native gel electrophoresis followed by anti-IRF3 IB. Immunoblot detection of TBK-1 (Flag), IRF3, and actin is also presented.

These results were confirmed by studying the intracellular distribution of IRF3 in response to activation by IKK{varepsilon} in IE1-expressing cells. As shown on the right panels of Fig. 8B, the levels of IRF3 in the cytoplasmic fraction were equal in control and IE1-expressing cells. No IE1 was detected in the cytoplasm, as expected. Analyses of nuclear fractions indicated that IKK{varepsilon} caused an increase in the accumulation of nuclear IRF3. However, in IE1-expressing cells, the quantity of IRF3 present in the nucleus following IKK{varepsilon} activation was reduced by more than 60% relative to that in cells that did not express IE1. Anti-actin (cytoplasm) and anti-PAPR (nuclear) antibodies were used to assess the purity of extracts and demonstrate that equal quantities of protein extracts were loaded. These results confirmed the results presented in Fig. 8A and indicated that the accumulation of nuclear IRF3 in response to the TBK-1 or IKK{varepsilon} activator is reduced when IE1 is present. Interestingly, IE1A and IE1B were much less efficient at inhibiting SeV-induced IRF3 nuclear translocation (data not shown) but retained their ability to shut down IFN-ß gene activation. These results suggest that the prevention of IRF3 nuclear translocation is not mandatory for IE1 to inhibit IFN-ß gene transcription.

IE1 blocks IRF dimerization. IRF3 is a key IFN-ß gene regulatory element whose activity is modulated through phosphorylation by TBK-1 and IKK{varepsilon} (20, 68). Upon phosphorylation, IRF3 dimerizes and translocates to the nucleus. In light of our results indicating that in the presence of IE1, the TBK-1/IKK{varepsilon}-induced nuclear translocation of IRF3 is impaired, we next studied the TBK-1-induced dimerization of IRF3 in the absence or presence of IE1. 293T cells were transfected with TBK-1 together with increasing quantities of IE1A or IE1B, and IRF3 dimerization was studied by native gel electrophoresis and IB. As shown in Fig. 8C, under resting conditions (no TBK-1), very little dimerized IRF3 was detected. TBK-1 overexpression induced the dimerization of IRF3, as expected. In contrast, in the presence of IE1A or IE1B, a dose-dependent reduction in the amount of dimerized IRF3 was observed. These results indicate that IE1 interferes with the dimerization of IRF3 or the accumulation of dimerized IRF3.

Impaired binding of IRF3 to the IFN-ß promoter sequence in the presence of IE1. We next determined whether IRF3 is capable of efficiently binding to the IFN-ß promoter in the presence of IE1. Cells were transfected with IRF3 or IRF3 and IE1 and infected with SeV to induce IRF3 nuclear translocation. Biotinylated dsDNA oligonucleotides corresponding to the IFN-ß promoter sequence were mixed with nuclear extracts to evaluate IRF3 and IE1 binding. As presented in Fig. 9, in the absence of SeV infection, some IRF3 could be detected in the nuclear fraction but no binding to the IFN-ß promoter sequence was observed. SeV infection increased the nuclear accumulation and induced the binding of IRF3 to its target sequence. In contrast, in the presence of IE1A or IE1B, the binding of IRF3 to the IFN-ß promoter sequence was nearly abolished despite a similar pattern of accumulation of nuclear IRF3. Using the same extracts, we could not detect any binding of IE1 to the IFN-ß promoter sequence (data not shown). The bottom panel of Fig. 9 corresponds to IB of total nuclear extracts to show IRF3 and IE1 expression as well as PARP1 to demonstrate that samples contained similar quantities of proteins. These results indicate that in the presence of IE1, the binding of the IRF3 transcription factor occurs much less efficiently.


Figure 9
View larger version (49K):
[in this window]
[in a new window]

  		FIG. 9. IE1 interferes with the binding of IRF3 to the IFN-ß promoter. Control, IRF3-, and IRF3- and IE1-transfected cells were infected with SeV for 18 h, after which nuclear extracts were made and analyzed for binding to the IFN-ß promoter sequence. Promoter-bound as well as total nuclear extracts were analyzed by IB using anti-myc (IRF3), anti-IE1, and anti-PAPR1 antibodies. Results are representative of those from two experiments. +, present; –, absent.

IE1 inhibits the expression of other IRF3-responsive genes. The IRF3 transcription factor activates several genes, such as those for RANTES, ISG15, and 2',5'-OAS, whose promoters contain ISREs (27, 45). To determine whether IE1 negatively influences the expression of genes other than IFN-ß that are regulated, at least in part, by IRF3, 293T cells were transfected with TBK-1 or IKK{varepsilon} together with increasing quantities of IE1B and analyzed for RANTES, ISG15, and 2',5'-OAS mRNA expression. As shown in Fig. 10, TBK-1 and IKK{varepsilon} efficiently induced the expression of RANTES, ISG15, and 2',5'-OAS genes, as expected. In contrast, in the presence of IE1B, a dose-dependent inhibition of all three tested genes was observed. These results indicate that HHV-6 IE1 efficiently blocks the induction of genes whose transcription depends on IRF3.


Figure 10
View larger version (10K):
[in this window]
[in a new window]

  		FIG. 10. HHV-6 IE1 negatively affects the transcription of several IRF3-responsive genes. 293T cells were transfected with increasing quantities (0, 0.8, and 4.0 µg) of IE1A or IE1B together with TBK-1 or IKK{varepsilon}. Twenty-four hours later, total RNA was extracted and the expression of RANTES, ISG15, 2',5'-OAS, and GAPDH genes was evaluated by RT-QPCR. Results are expressed as increases (n-fold) in mRNA levels relative to those in cells transfected in the absence of TBK-1 or IKK{varepsilon} and were normalized by using GAPDH housekeeping gene expression. Results are representative of those from two independent experiments.


arrow
DISCUSSION
 
Herpesviruses are notorious for their ability to avoid, misguide, or impair immune system recognition, allowing them to persist within the host they infect. Ironically, despite the fact that HHV-6 is one of the most efficient human viral parasites, with nearly 100% of individuals older than 5 years of age infected by this virus, the immune evasion mechanisms deployed by HHV-6 are still poorly characterized. Previous studies have reported the ability of HHV-6 to negatively affect T-cell proliferation and interleukin-2 synthesis (22), interleukin-12 production (69), and dendritic cell maturation (70) and induce monocyte cell surface phenotypic alterations (38) that may cause immune system impairment. To our knowledge, no studies have investigated whether HHV-6 can modulate the IFN-ß biosynthesis pathway. Considering that HHV-6 tropism extends beyond T cells and macrophages to cells such as endothelial cells (10, 11), fibroblasts (62), epithelial cells (3), and hepatocytes (14) and that these cells are considered major producers of IFN-ß following infection with viruses, we deemed it relevant to characterize IFN-ß gene regulation during HHV-6 infection.

Our results indicate that the infection of PBMC with HHV-6 leads to only a small increase in IFN-ß gene induction. Conversely, when viral gene expression is inhibited (by UV radiation or CHX treatment), the level of IFN-ß gene transcription is much increased, suggesting that when HHV-6 infection is initiated, viral proteins may negatively regulate IFN-ß gene induction. In light of the fact that CHX treatment prevented the translation of viral transcripts but not viral attachment and entry and the internalization of virion proteins, the obtained results suggested that a newly synthesized protein is likely to be responsible for the negative modulation of IFN-ß gene transcription. Knowing that IFN gene induction occurs rapidly, we focused our attention on some of the most promptly expressed HHV-6 proteins, the IE1 (29) and IE2 (30) proteins. We successfully identified the IE1 protein as a negative regulator of IFN-ß gene expression in a variety of test systems. The HHV-6 IE2 protein had no negative effect on IFN-ß gene expression (data not shown).

IE1 was able to curtail the expression of the IFN-ß gene following induction by SeV infection, dsRNA and dsDNA transfection, or the expression of RIG-I, MAVS, IKK{varepsilon}, TBK-1, and IRF3(5D). HHV-6 IE1 inhibition of the IFN-ß biosynthesis pathway was not the result of accelerated IFN-ß mRNA degradation but likely a consequence of reduced IRF3 dimerization, which translated into diminished nuclear translocation of the IRF3 transcription factor in response to TBK-1/IKK{varepsilon} expression. Considering that IRF3 plays an important role in IFN-ß gene induction depending on the cell type analyzed (31, 65), the ability of IE1 to cause a reduction in the levels of nuclear IRF3 in response to TBK-1/IKK{varepsilon} is likely partly responsible for the inhibition of IFN-ß gene transcription in 293T cells. Further contributing is the interference of IE1 with the binding of IRF3 to the IFN-ß promoter sequence. Any potential negative effects of IE1 on NF-{kappa}B activation, whose roles in IFN-ß gene expression are also well recognized, can be excluded. Several nonexclusive mechanisms may explain how IE1 inhibits IFN-ß gene activation. First, IE1 may directly interfere with the activity of TBK-1 and IKK{varepsilon}, leading to reduced levels of phosphorylated IRF3. However, IE1 is a nuclear protein and TBK-1 is cytoplasmic, and the segregation of these proteins into separate cellular compartments would make it difficult for these two proteins to physically interact with each other. For IKK{varepsilon}, direct interaction with IE1 may be more conceptually acceptable because IKK{varepsilon} appears to be distributed in both cytoplasmic and nuclear compartments (17). Second, HHV-6 IE1 may directly bind IRF3 and prevent its phosphorylation. Once again, since IE1 is nuclear and unphosphorylated IRF3 is cytoplasmic (41), exactly how this could happen is not clear. However, as reported by Spiegel et al. (71), IRF3 nuclear translocation may precede the hyperphosphorylation and homodimerization of IRF3 and thus make it possible for IE1 to somehow interact with IRF3 and prevent its activation. Third, IE1 may possess intrinsic phosphatase activity that could dephosphorylate nuclear IRF3, leading to IRF3 dimer dissociation. Alternatively, IE1 may trigger the activation of Pin-1, an enzyme recently found to reduce the levels of IRF3 dimers and promote IRF3 degradation (63). Lastly, IE1 may bind and sequester and/or induce the degradation of homodimerized IRF3 once IRF3 has reached the nucleus. In fact, a recent report indicates that the HHV-8 regulator of transcription activation protein, which possesses ubiquitin-ligase activity, causes the degradation of IRF7 (80). Whether HHV-6 IE1 behaves as an E3 ubiquitin ligase is presently under investigation.

The strategy of targeting IRF3 as a mean of thwarting IFN-ß gene transcription is not unique to HHV-6 and is exploited by several viruses. For example, Ebola virus, rhesus cytomegalovirus, hepatitis C virus, and bovine respiratory virus block IFN-ß synthesis by preventing IRF3 activation (1, 5, 6, 18, 24). Rotavirus induces IRF3 degradation, while severe acute respiratory syndrome coronavirus and rhinovirus 14 interfere with IRF3 phosphorylation and dimerization, respectively (59, 71). Human herpesviruses have also evolved many different mechanisms to inhibit IFN biosynthesis, and those related to IRF3 include the following. HSV type 1 blocks the nuclear accumulation of activated IRF3 (51) in an ICP0-dependent manner (47). The HCMV pp65 virion protein negatively influences IFN-ß gene expression, but the way this is achieved remains to be fully elucidated as discordant reports have been published (1, 7). The viral IRF1 homologue, encoded by HHV-8, interferes with the trans-activating activity of cellular IRF1 and IRF3 by inhibiting the interaction between IRFs and CBP/p300, resulting in the inhibition of IFN-ß gene transcription (8, 44).

Whatever the mechanisms may be, the transcription of genes regulated by IRF3 is severely impaired when IE1 is present. Genes whose transcription is stimulated by activated IRF3 include those for IFN-ß (in combination with NF-{kappa}B and ATF-2/c-Jun genes) (40, 52, 73), ISG54, ISG56, ISG60, and to a lesser extent, 2',5'-OAS and ISG15 (27). Genes indirectly activated by IRF3 through IFN-ß secretion, IFN-{alpha}/ß receptor signaling, and ISGF3 activation include hundreds of genes having ISREs within their promoters whose functions are directly or indirectly related to the mounting of immune responses. By rapidly shunting IFN-ß gene induction, HHV-6 favors the successful establishment of infection and subsequent persistence within the infected host.


arrow
ACKNOWLEDGMENTS
 
We thank John Hiscott, Zhijian "James" Chen, and Rongtuan Lin for their generous contribution of expression and reporter plasmids.

This work was made possible with grant MT14437 from the Canadian Institutes of Health Research of Canada and a senior scholarship from the Fonds de la Recherche en Santé du Québec awarded to Louis Flamand. Nathalie Grandvaux is the recipient of a tier 2 Canada research chair.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Rheumatology and Immunology Research Center, Room T1-49, 2705 Laurier Blvd., Quebec, Quebec, Canada G1V 4G2. Phone: (418) 656-4141, ext. 46164. Fax: (418) 654-2765. E-mail: Louis.Flamand{at}crchul.ulaval.ca Back

{triangledown} Published ahead of print on 21 March 2007. Back


arrow
REFERENCES
 
    1
  1. Abate, D. A., S. Watanabe, and E. S. Mocarski. 2004. Major human cytomegalovirus structural protein pp65 (ppUL83) prevents interferon response factor 3 activation in the interferon response. J. Virol. 78:10995-11006.[Abstract/Free Full Text]
    2. 2
  2. Akira, S. 2006. TLR signaling. Curr. Top. Microbiol. Immunol. 311:1-16.[Medline]
    3. 3
  3. Arao, Y., S. Soushi, Y. Sato, E. Moriishi, Y. Ando, M. Yamada, J. Padilla, F. Uno, S. Nii, and T. Kurata. 1997. Infection of a human retinal pigment epithelial cell line with human herpesvirus 6 variant A. J. Med. Virol. 53:105-110.[CrossRef][Medline]
    4. 4
  4. Asano, Y., T. Yoshikawa, S. Suga, T. Yazaki, K. Kondo, and K. Yamanishi. 1990. Fatal fulminant hepatitis in an infant with human herpesvirus-6 infection. Lancet 335:862-863.[CrossRef][Medline]
    5. 5
  5. Basler, C. F., A. Mikulasova, L. Martinez-Sobrido, J. Paragas, E. Muhlberger, M. Bray, H. D. Klenk, P. Palese, and A. Garcia-Sastre. 2003. The Ebola virus VP35 protein inhibits activation of interferon regulatory factor 3. J. Virol. 77:7945-7956.[Abstract/Free Full Text]
    6. 6
  6. Bossert, B., S. Marozin, and K. K. Conzelmann. 2003. Nonstructural proteins NS1 and NS2 of bovine respiratory syncytial virus block activation of interferon regulatory factor 3. J. Virol. 77:8661-8668.[Abstract/Free Full Text]
    7. 7
  7. Browne, E. P., and T. Shenk. 2003. Human cytomegalovirus UL83-coded pp65 virion protein inhibits antiviral gene expression in infected cells. Proc. Natl. Acad. Sci. USA 100:11439-11444.[Abstract/Free Full Text]
    8. 8
  8. Burysek, L., W. S. Yeow, B. Lubyova, M. Kellum, S. L. Schafer, Y. Q. Huang, and P. M. Pitha. 1999. Functional analysis of human herpesvirus 8-encoded viral interferon regulatory factor 1 and its association with cellular interferon regulatory factors and p300. J. Virol. 73:7334-7342.[Abstract/Free Full Text]
    9. 9
  9. Carrigan, D. R., W. R. Drobyski, S. K. Russler, M. A. Tapper, K. K. Knox, and R. C. Ash. 1991. Interstitial pneumonitis associated with human herpesvirus-6 infection after marrow transplantation. Lancet 338:147-149.[CrossRef][Medline]
    10. 10
  10. Caruso, A., F. Favilli, A. Rotola, M. Comar, D. Horejsh, G. Alessandri, M. Grassi, D. Di Luca, and S. Fiorentini. 2003. Human herpesvirus-6 modulates RANTES production in primary human endothelial cell cultures. J. Med. Virol. 70:451-458.[CrossRef][Medline]
    11. 11
  11. Caruso, A., A. Rotola, M. Comar, F. Favilli, M. Galvan, M. Tosetti, C. Campello, E. Caselli, G. Alessandri, M. Grassi, E. Garrafa, E. Cassai, and D. Di Luca. 2002. HHV-6 infects human aortic and heart microvascular endothelial cells, increasing their ability to secrete proinflammatory chemokines. J. Med. Virol. 67:528-533.[CrossRef][Medline]
    12. 12
  12. Cassady, K. A., and M. Gross. 2002. The herpes simplex virus type 1 US11 protein interacts with protein kinase R in infected cells and requires a 30-amino-acid sequence adjacent to a kinase substrate domain. J. Virol. 76:2029-2035.[Abstract/Free Full Text]
    13. 13
  13. Cassady, K. A., M. Gross, and B. Roizman. 1998. The herpes simplex virus US11 protein effectively compensates for the {gamma}134.5 gene if present before activation of protein kinase R by precluding its phosphorylation and that of the {alpha} subunit of eukaryotic translation initiation factor 2. J. Virol. 72:8620-8626.[Abstract/Free Full Text]
    14. 14
  14. Cermelli, C., M. Concari, F. Carubbi, G. Fabio, A. M. Sabbatini, M. Pecorari, P. Pietrosemoli, M. Meacci, E. Guicciardi, N. Carulli, and M. Portolani. 1996. Growth of human herpesvirus 6 in HEPG2 cells. Virus Res. 45:75-85.[CrossRef][Medline]
    15. 15
  15. Chee, A. V., and B. Roizman. 2004. Herpes simplex virus 1 gene products occlude the interferon signaling pathway at multiple sites. J. Virol. 78:4185-4196.[Abstract/Free Full Text]
    16. 16
  16. Child, S. J., M. Hakki, K. L. De Niro, and A. P. Geballe. 2004. Evasion of cellular antiviral responses by human cytomegalovirus TRS1 and IRS1. J. Virol. 78:197-205.[Abstract/Free Full Text]
    17. 17
  17. Civas, A., P. Genin, P. Morin, R. Lin, and J. Hiscott. 2006. Promoter organization of the interferon-A genes differentially affects virus-induced expression and responsiveness to TBK1 and IKKepsilon. J. Biol. Chem. 281:4856-4866.[Abstract/Free Full Text]
    18. 18
  18. DeFilippis, V., and K. Fruh. 2005. Rhesus cytomegalovirus particles prevent activation of interferon regulatory factor 3. J. Virol. 79:6419-6431.[Abstract/Free Full Text]
    19. 19
  19. Drobyski, W. R., W. M. Dunne, E. M. Burd, K. K. Knox, R. C. Ash, M. M. Horowitz, N. Flomenberg, and D. R. Carrigan. 1993. Human herpesvirus-6 (HHV-6) infection in allogeneic bone marrow transplant recipients: evidence of a marrow-suppressive role for HHV-6 in vivo. J. Infect. Dis. 167:735-739.[Medline]
    20. 20
  20. Fitzgerald, K. A., S. M. McWhirter, K. L. Faia, D. C. Rowe, E. Latz, D. T. Golenbock, A. J. Coyle, S. M. Liao, and T. Maniatis. 2003. IKKepsilon and TBK1 are essential components of the IRF3 signaling pathway. Nat. Immunol. 4:491-496.[CrossRef][Medline]
    21. 21
  21. Flamand, L., J. Gosselin, M. D'Addario, J. Hiscott, D. V. Ablashi, R. C. Gallo, and J. Menezes. 1991. Human herpesvirus 6 induces interleukin-1 beta and tumor necrosis factor alpha, but not interleukin-6, in peripheral blood mononuclear cell cultures. J. Virol. 65:5105-5110.[Abstract/Free Full Text]
    22. 22
  22. Flamand, L., J. Gosselin, I. Stefanescu, D. Ablashi, and J. Menezes. 1995. Immunosuppressive effect of human herpesvirus 6 on T-cell functions: suppression of interleukin-2 synthesis and cell proliferation. Blood 85:1263-1271.[Abstract/Free Full Text]
    23. 23
  23. Flamand, L., I. Stefanescu, and J. Menezes. 1996. Human herpesvirus-6 enhances natural killer cell cytotoxicity via IL-15. J. Clin. Investig. 97:1373-1381.[Medline]
    24. 24
  24. Foy, E., K. Li, C. Wang, R. Sumpter, Jr., M. Ikeda, S. M. Lemon, and M. Gale, Jr. 2003. Regulation of interferon regulatory factor-3 by the hepatitis C virus serine protease. Science 300:1145-1148.[Abstract/Free Full Text]
    25. 25
  25. Gao, S. J., C. Boshoff, S. Jayachandra, R. A. Weiss, Y. Chang, and P. S. Moore. 1997. KSHV ORF K9 (vIRF) is an oncogene which inhibits the interferon signaling pathway. Oncogene 15:1979-1985.[CrossRef][Medline]
    26. 26
  26. Gosselin, J., L. Flamand, M. D'Addario, J. Hiscott, I. Stefanescu, D. V. Ablashi, R. C. Gallo, and J. Menezes. 1992. Modulatory effects of Epstein-Barr, herpes simplex, and human herpes-6 viral infections and coinfections on cytokine synthesis. A comparative study. J. Immunol. 149:181-187.[Abstract]
    27. 27
  27. Grandvaux, N., M. J. Servant, B. tenOever, G. C. Sen, S. Balachandran, G. N. Barber, R. Lin, and J. Hiscott. 2002. Transcriptional profiling of interferon regulatory factor 3 target genes: direct involvement in the regulation of interferon-stimulated genes. J. Virol. 76:5532-5539.[Abstract/Free Full Text]
    28. 28
  28. Gravel, A., V. Dion, N. Cloutier, J. Gosselin, and L. Flamand. 2004. Characterization of human herpesvirus 6 variant B immediate-early 1 protein modifications by small ubiquitin-related modifiers. J. Gen. Virol. 85:1319-1328.[Abstract/Free Full Text]
    29. 29
  29. Gravel, A., J. Gosselin, and L. Flamand. 2002. Human herpesvirus 6 immediate-early 1 protein is a sumoylated nuclear phosphoprotein colocalizing with promyelocytic leukemia protein-associated nuclear bodies. J. Biol. Chem. 277:19679-19687.[Abstract/Free Full Text]
    30. 30
  30. Gravel, A., A. Tomoiu, N. Cloutier, J. Gosselin, and L. Flamand. 2003. Characterization of the immediate-early 2 protein of human herpesvirus 6, a promiscuous transcriptional activator. Virology 308:340-353.[CrossRef][Medline]
    31. 31
  31. Honda, K., H. Yanai, H. Negishi, M. Asagiri, M. Sato, T. Mizutani, N. Shimada, Y. Ohba, A. Takaoka, N. Yoshida, and T. Taniguchi. 2005. IRF-7 is the master regulator of type-I interferon-dependent immune responses. Nature 434:772-777.[CrossRef][Medline]
    32. 32
  32. Honda, K., H. Yanai, A. Takaoka, and T. Taniguchi. 2005. Regulation of the type I IFN induction: a current view. Int. Immunol. 17:1367-1378.[Abstract/Free Full Text]
    33. 33
  33. Hornung, V., J. Ellegast, S. Kim, K. Brzozka, A. Jung, H. Kato, H. Poeck, S. Akira, K. K. Conzelmann, M. Schlee, S. Endres, and G. Hartmann. 2006. 5'-Triphosphate RNA is the ligand for RIG-I. Science 314:994-997.[Abstract/Free Full Text]
    34. 34
  34. Huang, L. M., C. Y. Lee, P. I. Lee, J. M. Chen, and P. J. Wang. 1991. Meningitis caused by human herpesvirus-6. Arch. Dis. Child. 66:1443-1444.[Abstract/Free Full Text]
    35. 35
  35. Huang, L. M., C. Y. Lee, K. H. Lin, W. M. Chuu, P. I. Lee, R. L. Chen, J. M. Chen, and D. T. Lin. 1990. Human herpesvirus-6 associated with fatal haemophagocytic syndrome. Lancet 336:60-61.[CrossRef][Medline]
    36. 36
  36. Isaacs, A., and J. Lindenmann. 1957. Virus interference. I. The interferon. Proc. R Soc. Lond. B 147:258-267.[Medline]
    37. 37
  37. Ishii, K. J., C. Coban, H. Kato, K. Takahashi, Y. Torii, F. Takeshita, H. Ludwig, G. Sutter, K. Suzuki, H. Hemmi, S. Sato, M. Yamamoto, S. Uematsu, T. Kawai, O. Takeuchi, and S. Akira. 2006. A Toll-like receptor-independent antiviral response induced by double-stranded B-form DNA. Nat. Immunol. 7:40-48.[CrossRef][Medline]
    38. 38
  38. Janelle, M. E., and L. Flamand. 2006. Phenotypic alterations and survival of monocytes following infection by human herpesvirus-6. Arch. Virol. 151:1603-1614.[CrossRef][Medline]
    39. 39
  39. Kato, H., O. Takeuchi, S. Sato, M. Yoneyama, M. Yamamoto, K. Matsui, S. Uematsu, A. Jung, T. Kawai, K. J. Ishii, O. Yamaguchi, K. Otsu, T. Tsujimura, C. S. Koh, C. Reis e Sousa, Y. Matsuura, T. Fujita, and S. Akira. 2006. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 441:101-105.[CrossRef][Medline]
    40. 40
  40. Kim, T. K., and T. Maniatis. 1997. The mechanism of transcriptional synergy of an in vitro assembled interferon-beta enhanceosome. Mol. Cell 1:119-129.[CrossRef][Medline]
    41. 41
  41. Kumar, K. P., K. M. McBride, B. K. Weaver, C. Dingwall, and N. C. Reich. 2000. Regulated nuclear-cytoplasmic localization of interferon regulatory factor 3, a subunit of double-stranded RNA-activated factor 1. Mol. Cell. Biol. 20:4159-4168.[Abstract/Free Full Text]
    42. 42
  42. Levy, J. A., F. Ferro, D. Greenspan, and E. T. Lennette. 1990. Frequent isolation of HHV-6 from saliva and high seroprevalence of the virus in the population. Lancet 335:1047-1050.[CrossRef][Medline]
    43. 43
  43. Li, M., B. Damania, X. Alvarez, V. Ogryzko, K. Ozato, and J. U. Jung. 2000. Inhibition of p300 histone acetyltransferase by viral interferon regulatory factor. Mol. Cell. Biol. 20:8254-8263.[Abstract/Free Full Text]
    44. 44
  44. Lin, R., P. Genin, Y. Mamane, M. Sgarbanti, A. Battistini, W. J. Harrington, Jr., G. N. Barber, and J. Hiscott. 2001. HHV-8 encoded vIRF-1 represses the interferon antiviral response by blocking IRF-3 recruitment of the CBP/p300 coactivators. Oncogene 20:800-811.[CrossRef][Medline]
    45. 45
  45. Lin, R., C. Heylbroeck, P. Genin, P. M. Pitha, and J. Hiscott. 1999. Essential role of interferon regulatory factor 3 in direct activation of RANTES chemokine transcription. Mol. Cell. Biol. 19:959-966.[Abstract/Free Full Text]
    46. 46
  46. Lin, R., C. Heylbroeck, P. M. Pitha, and J. Hiscott. 1998. Virus-dependent phosphorylation of the IRF-3 transcription factor regulates nuclear translocation, transactivation potential, and proteasome-mediated degradation. Mol. Cell. Biol. 18:2986-2996.[Abstract/Free Full Text]
    47. 47
  47. Lin, R., R. S. Noyce, S. E. Collins, R. D. Everett, and K. L. Mossman. 2004. The herpes simplex virus ICP0 RING finger domain inhibits IRF3- and IRF7-mediated activation of interferon-stimulated genes. J. Virol. 78:1675-1684.[Abstract/Free Full Text]
    48. 48
  48. Lin, R., L. Yang, P. Nakhaei, Q. Sun, E. Sharif-Askari, I. Julkunen, and J. Hiscott. 2006. Negative regulation of the retinoic acid-inducible gene I-induced antiviral state by the ubiquitin-editing protein A20. J. Biol. Chem. 281:2095-2103.[Abstract/Free Full Text]
    49. 49
  49. Maniatis, T., J. V. Falvo, T. H. Kim, T. K. Kim, C. H. Lin, B. S. Parekh, and M. G. Wathelet. 1998. Structure and function of the interferon-beta enhanceosome. Cold Spring Harbor Symp. Quant. Biol. 63:609-620.[CrossRef][Medline]
    50. 50
  50. Martin, M. E., J. Nicholas, B. J. Thomson, C. Newman, and R. W. Honess. 1991. Identification of a transactivating function mapping to the putative immediate-early locus of human herpesvirus 6. J. Virol. 65:5381-5390.[Abstract/Free Full Text]
    51. 51
  51. Melroe, G. T., N. A. DeLuca, and D. M. Knipe. 2004. Herpes simplex virus 1 has multiple mechanisms for blocking virus-induced interferon production. J. Virol. 78:8411-8420.[Abstract/Free Full Text]
    52. 52
  52. Merika, M., A. J. Williams, G. Chen, T. Collins, and D. Thanos. 1998. Recruitment of CBP/p300 by the IFN beta enhanceosome is required for synergistic activation of transcription. Mol. Cell 1:277-287.[CrossRef][Medline]
    53. 53
  53. Miller, D. M., B. M. Rahill, J. M. Boss, M. D. Lairmore, J. E. Durbin, J. W. Waldman, and D. D. Sedmak. 1998. Human cytomegalovirus inhibits major histocompatibility complex class II expression by disruption of the Jak/Stat pathway. J. Exp. Med. 187:675-683.[Abstract/Free Full Text]
    54. 54
  54. Miller, D. M., Y. Zhang, B. M. Rahill, W. J. Waldman, and D. D. Sedmak. 1999. Human cytomegalovirus inhibits IFN-alpha-stimulated antiviral and immunoregulatory responses by blocking multiple levels of IFN-alpha signal transduction. J. Immunol. 162:6107-6113.[Abstract/Free Full Text]
    55. 55
  55. Mossman, K. L., and A. A. Ashkar. 2005. Herpesviruses and the innate immune response. Viral Immunol. 18:267-281.[CrossRef][Medline]
    56. 56
  56. Mossman, K. L., P. F. Macgregor, J. J. Rozmus, A. B. Goryachev, A. M. Edwards, and J. R. Smiley. 2001. Herpes simplex virus triggers and then disarms a host antiviral response. J. Virol. 75:750-758.[Abstract/Free Full Text]
    57. 57
  57. Okuno, T., K. Takahashi, K. Balachandra, K. Shiraki, K. Yamanishi, M. Takahashi, and K. Baba. 1989. Seroepidemiology of human herpesvirus 6 infection in normal children and adults. J. Clin. Microbiol. 27:651-653.[Abstract/Free Full Text]
    58. 58
  58. Patra, A. K., S. Y. Na, and U. Bommhardt. 2004. Active protein kinase B regulates TCR responsiveness by modulating cytoplasmic-nuclear localization of NFAT and NF-kappa B proteins. J. Immunol. 172:4812-4820.[Abstract/Free Full Text]
    59. 59
  59. Peng, T., S. Kotla, R. E. Bumgarner, and K. E. Gustin. 2006. Human rhinovirus attenuates the type I interferon response by disrupting activation of interferon regulatory factor 3. J. Virol. 80:5021-5031.[Abstract/Free Full Text]
    60. 60
  60. Pichlmair, A., O. Schulz, C. P. Tan, T. I. Naslund, P. Liljestrom, F. Weber, and C. Reis e Sousa. 2006. RIG-I-mediated antiviral responses to single-stranded RNA bearing 5'-phosphates. Science 314:997-1001.[Abstract/Free Full Text]
    61. 61
  61. Prezioso, P. J., J. Cangiarella, M. Lee, G. J. Nuovo, W. Borkowsky, S. J. Orlow, and M. A. Greco. 1992. Fatal disseminated infection with human herpesvirus-6. J. Pediatr. 120:921-923.[CrossRef][Medline]
    62. 62
  62. Robert, C., J. T. Aubin, B. Visse, A. M. Fillet, J. M. Huraux, and H. Agut. 1996. Difference in permissiveness of human fibroblast cells to variants A and B of human herpesvirus-6. Res. Virol. 147:219-225.[CrossRef][Medline]
    63. 63
  63. Saitoh, T., A. Tun-Kyi, A. Ryo, M. Yamamoto, G. Finn, T. Fujita, S. Akira, N. Yamamoto, K. P. Lu, and S. Yamaoka. 2006. Negative regulation of interferon-regulatory factor 3-dependent innate antiviral response by the prolyl isomerase Pin1. Nat. Immunol. 7:598-605.[CrossRef][Medline]
    64. 64
  64. Salahuddin, S. Z., D. V. Ablashi, P. D. Markham, S. F. Josephs, S. Sturzenegger, M. Kaplan, G. Halligan, P. Biberfeld, F. Wong-Staal, B. Kramarsky, et al. 1986. Isolation of a new virus, HBLV, in patients with lymphoproliferative disorders. Science 234:596-601.[Abstract/Free Full Text]
    65. 65
  65. Sato, M., H. Suemori, N. Hata, M. Asagiri, K. Ogasawara, K. Nakao, T. Nakaya, M. Katsuki, S. Noguchi, N. Tanaka, and T. Taniguchi. 2000. Distinct and essential roles of transcription factors IRF-3 and IRF-7 in response to viruses for IFN-alpha/beta gene induction. Immunity 13:539-548.[CrossRef][Medline]
    66. 66
  66. Seth, R. B., L. Sun, C. K. Ea, and Z. J. Chen. 2005. Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3. Cell 122:669-682.[CrossRef][Medline]
    67. 67
  67. Severa, M., E. M. Coccia, and K. A. Fitzgerald. 2006. Toll-like receptor-dependent and -independent viperin gene expression and counter-regulation by PRDI-binding factor-1/BLIMP1. J. Biol. Chem. 281:26188-26195.[Abstract/Free Full Text]
    68. 68
  68. Sharma, S., B. R. tenOever, N. Grandvaux, G. P. Zhou, R. Lin, and J. Hiscott. 2003. Triggering the interferon antiviral response through an IKK-related pathway. Science 300:1148-1151.[Abstract/Free Full Text]
    69. 69
  69. Smith, A., F. Santoro, G. Di Lullo, L. Dagna, A. Verani, and P. Lusso. 2003. Selective suppression of IL-12 production by human herpesvirus 6. Blood 102:2877-2884.[Abstract/Free Full Text]
    70. 70
  70. Smith, A. P., C. Paolucci, G. Di Lullo, S. E. Burastero, F. Santoro, and P. Lusso. 2005. Viral replication-independent blockade of dendritic cell maturation and interleukin-12 production by human herpesvirus 6. J. Virol. 79:2807-2813.[Abstract/Free Full Text]
    71. 71
  71. Spiegel, M., A. Pichlmair, L. Martinez-Sobrido, J. Cros, A. Garcia-Sastre, O. Haller, and F. Weber. 2005. Inhibition of beta interferon induction by severe acute respiratory syndrome coronavirus suggests a two-step model for activation of interferon regulatory factor 3. J. Virol. 79:2079-2086.[Abstract/Free Full Text]
    72. 72
  72. Stetson, D. B., and R. Medzhitov. 2006. Recognition of cytosolic DNA activates an IRF3-dependent innate immune response. Immunity 24:93-103.[CrossRef][Medline]
    73. 73
  73. Wathelet, M. G., C. H. Lin, B. S. Parekh, L. V. Ronco, P. M. Howley, and T. Maniatis. 1998. Virus infection induces the assembly of coordinately activated transcription factors on the IFN-beta enhancer in vivo. Mol. Cell 1:507-518.[CrossRef][Medline]
    74. 74
  74. Yamanishi, K., T. Okuno, K. Shiraki, M. Takahashi, T. Kondo, Y. Asano, and T. Kurata. 1988. Identification of human herpesvirus-6 as a causal agent for exanthem subitum. Lancet i:1065-1067.
    75. 75
  75. Yokota, S., N. Yokosawa, T. Kubota, T. Suzutani, I. Yoshida, S. Miura, K. Jimbow, and N. Fujii. 2001. Herpes simplex virus type 1 suppresses the interferon signaling pathway by inhibiting phosphorylation of STATs and janus kinases during an early infection stage. Virology 286:119-124.[CrossRef][Medline]
    76. 76
  76. Yokota, S., N. Yokosawa, T. Okabayashi, T. Suzutani, S. Miura, K. Jimbow, and N. Fujii. 2004. Induction of suppressor of cytokine signaling-3 by herpes simplex virus type 1 contributes to inhibition of the interferon signaling pathway. J. Virol. 78:6282-6286.[Abstract/Free Full Text]
    77. 77
  77. Yoneyama, M., M. Kikuchi, T. Natsukawa, N. Shinobu, T. Imaizumi, M. Miyagishi, K. Taira, S. Akira, and T. Fujita. 2004. The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nat. Immunol. 5:730-737.[CrossRef][Medline]
    78. 78
  78. Yoshikawa, T., S. Suga, Y. Asano, T. Nakashima, T. Yazaki, R. Sobue, M. Hirano, M. Fukuda, S. Kojima, and T. Matsuyama. 1991. Human herpesvirus-6 infection in bone marrow transplantation. Blood 78:1381-1384.[Abstract/Free Full Text]
    79. 79
  79. Yoshikawa, T., S. Suga, Y. Asano, T. Yazaki, H. Kodama, and T. Ozaki. 1989. Distribution of antibodies to a causative agent of exanthem subitum (human herpesvirus-6) in healthy individuals. Pediatrics 84:675-677.[Abstract/Free Full Text]
    80. 80
  80. Yu, Y., S. E. Wang, and G. S. Hayward. 2005. The KSHV immediate-early transcription factor RTA encodes ubiquitin E3 ligase activity that targets IRF7 for proteosome-mediated degradation. Immunity 22:59-70.[CrossRef][Medline]
    81. 81
  81. Zerr, D. M., L. Corey, H. W. Kim, M. L. Huang, L. Nguy, and M. Boeckh. 2005. Clinical outcomes of human herpesvirus 6 reactivation after hematopoietic stem cell transplantation. Clin. Infect. Dis. 40:932-940.[CrossRef][Medline]
    82. 82
  82. Zerr, D. M., A. S. Meier, S. S. Selke, L. M. Frenkel, M. L. Huang, A. Wald, M. P. Rhoads, L. Nguy, R. Bornemann, R. A. Morrow, and L. Corey. 2005. A population-based study of primary human herpesvirus 6 infection. N. Engl. J. Med. 352:768-776.[Abstract/Free Full Text]
    83. 83
  83. Zhu, F. X., S. M. King, E. J. Smith, D. E. Levy, and Y. Yuan. 2002. A Kaposi's sarcoma-associated herpesviral protein inhibits virus-mediated induction of type I interferon by blocking IRF-7 phosphorylation and nuclear accumulation. Proc. Natl. Acad. Sci. USA 99:5573-5578.[Abstract/Free Full Text]

Journal of Virology, June 2007, p. 5737-5748, Vol. 81, No. 11
0022-538X/07/$08.00+0     doi:10.1128/JVI.02443-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Wang, J.-T., Doong, S.-L., Teng, S.-C., Lee, C.-P., Tsai, C.-H., Chen, M.-R. (2009). Epstein-Barr Virus BGLF4 Kinase Suppresses the Interferon Regulatory Factor 3 Signaling Pathway. J. Virol. 83: 1856-1869 [Abstract] [Full Text]  
  • Sullivan, B. M., Coscoy, L. (2008). Downregulation of the T-Cell Receptor Complex and Impairment of T-Cell Activation by Human Herpesvirus 6 U24 Protein. J. Virol. 82: 602-608 [Abstract] [Full Text]  
  • Randall, R. E., Goodbourn, S. (2008). Interferons and viruses: an interplay between induction, signalling, antiviral responses and virus countermeasures. J. Gen. Virol. 89: 1-47 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jaworska, J.
Right arrow Articles by Flamand, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jaworska, J.
Right arrow Articles by Flamand, L.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»