This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Adang, L. A.
Right arrow Articles by Kedes, D. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Adang, L. A.
Right arrow Articles by Kedes, D. H.

 Previous Article  |  Next Article 

Journal of Virology, May 2007, p. 5079-5090, Vol. 81, No. 10
0022-538X/07/$08.00+0     doi:10.1128/JVI.02738-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Intracellular Kaposi's Sarcoma-Associated Herpesvirus Load Determines Early Loss of Immune Synapse Components{triangledown}

Laura A. Adang,1,2,{dagger} Costin Tomescu,1,2,{dagger} Wai K. Law,1,2 and Dean H. Kedes1,2,3*

Myles H. Thaler Center for AIDS and Human Retrovirus Research,1 Departments of Microbiology,2 Medicine, University of Virginia, Charlottesville, Virginia 229083

Received 12 December 2006/ Accepted 20 February 2007


arrow
ABSTRACT
 
Lifelong infection is a hallmark of all herpesviruses, and their survival depends on countering host immune defenses. The human gammaherpesvirus Kaposi's sarcoma-associated herpesvirus (KSHV) encodes an array of proteins that contribute to immune evasion, including modulator of immune recognition 2 (MIR2), an E3 ubiquitin ligase. Exogenously expressed MIR2 downregulates the surface expression of several immune synapse proteins, including major histocompatibility complex (MHC) class 1, ICAM-1 (CD54), and PECAM (CD31). Although immunofluorescence assays detect this lytic gene in only 1 to 5% of cells within infected cultures, we have found that de novo infection of naive cells leads to the downregulation of these immune synapse components in a major proportion of the population. Investigating the possibility that low levels of MIR2 are responsible for this downregulation in the context of viral infection, we found that MIR2 transduction recapitulated the patterns of surface downregulation following de novo infection and that both MIR2 promoter activation, MIR2 expression level, and immune synapse component downregulation were proportional to the concentration of KSHV added to the culture. Additionally, MIR2-specific small interfering RNA reversed the downregulation effects. Finally, using a sensitive, high-throughput assay to detect levels of the virus in individual cells, we also observed that downregulation of MHC class I and ICAM-1 correlated with intracellular viral load. Together, these results suggest that the effects of MIR2 are gene dosage dependent and that low levels of this viral protein contribute to the widespread downregulation of immune-modulating cell surface proteins during the initial stages of KSHV infection.


arrow
INTRODUCTION
 
Kaposi's sarcoma (KS)-associated herpesvirus (KSHV or human herpesvirus 8) is a member of the gamma (lymphotropic) subfamily of herpesviruses and is responsible for several distinct human diseases, including KS, primary effusion lymphoma, and multicentric Castleman's disease (8, 13, 28, 41). While pathologically diverse, these disorders are all primarily associated with an immunocompromised state, and thus, KSHV infection poses a significant threat to human immunodeficiency virus type 1-infected individuals and solid organ transplant recipients worldwide. In infected individuals, KSHV elicits both a humoral and a cellular host immune response that are directed against lytic and latent proteins of the virus (5, 19, 38). However, this response, even in healthy persons, is unable to eradicate KSHV from the body. This suggests that KSHV, similar to other human herpesviruses, possesses the ability to evade effective immune responses during infection.

Recent studies have identified a panoply of KSHV proteins that exert potential immune regulatory roles during lytic replication. These include inhibition of apoptosis by vBcl-2 (32) and open reading frame (ORF) K7 (37), complement deregulation by ORF 4 (33), Th2 type polarization by vMIP-II (39), and inhibition of the interferon antiviral response by viral interferon regulatory factor 1 (14), viral interferon regulatory factor 3 (23), and viral interleukin-6 (9). Furthermore, KSHV also encodes two early lytic proteins, MIR1 (encoded by ORF K3) and MIR2 (encoded by ORF K5), that downregulate immune proteins such as major histocompatibility complex class I (MHC-I; MIR1 and MIR2), ICAM-1 (CD 54, MIR2 only), and PECAM (CD 31, MIR2 only) from the surface of cells, thus limiting recognition by circulating immune cells in the second phase of the viral life cycle, lytic reactivation (6, 10, 16, 17, 24, 30).

KSHV, however, most often follows the general gene expression paradigm of herpesvirus infection; namely, a primarily latent phase of infection marked by a highly restricted pattern of viral protein production (40). The prevalence of KSHV-infected cells both in vitro and in vivo undergoing lytic (productive) infection is typically low (1 to 5%), with the remaining infected cells harboring the virus in its latent form (29). Thus, mechanisms of immune evasion contingent upon genes expressed solely during the lytic cycle would protect only a small fraction of KSHV-infected cells. It follows, therefore, that KSHV may require additional mechanisms of evasion active during the nonlytic stages of its life cycle. The focus of this study is to investigate the potential role of MIR2 in the downregulation observed during the earliest phases of infection preceding the establishment of latency.

We have previously shown that direct infection of both primary and immortalized endothelial cells with KSHV results in the downregulation of MHC-I, PECAM, and ICAM-1 from the surface of newly infected cells (36). In this paper, we propose that MIR2, a protein canonically classified as a lytic gene product, is responsible for this early surface marker loss, in spite of the fact that less than 1% of the infected cells expressed lytic proteins as detectable by immunofluorescence assays (IFA). Recent findings indicate that its gene, ORF K5, is among a cluster of lytic genes expressed during the early events of KSHV infection in both endothelial cells and fibroblasts and that sensitive immunoperoxidase staining detects MIR2 in a majority of infected cells (21). Therefore, we explored the possibility that low levels of the MIR2 protein may be involved in the immune regulatory protein downregulation we observe following KSHV infection.

Using a sensitive assay for transcriptional activation, we found that that de novo KSHV infection itself activates the MIR2 promoter. Furthermore, this promoter activation correlated with immune molecule downregulation, the functional output of MIR2 activity. Through the use of MIR2-specific small interfering RNA (siRNA), we confirmed that MIR2 is responsible for a major portion of the downregulation of MHC-I and ICAM-1 following de novo infection in both cultured cells and primary dermal microvascular endothelial cells. Additionally, we demonstrated that the degree of KSHV infection correlated with the level of MIR2 expression, which in turn corresponded with MHC-I and ICAM-1 downregulation. To directly measure the effects of viral load on downregulation, we compared the number of intranuclear LANA dots (an indicator of viral genome copies) to levels of downregulation using high-throughput multispectral imaging flow cytometry (MIFC) (1). We found that as little as one LANA dot per individual cell correlated with surface molecule downregulation and that ICAM-1 was more sensitive than MHC-1 to these low levels of infection.


arrow
MATERIALS AND METHODS
 
Cell culture. BCBL-1 cells were grown in RPMI 1640 media (Gibco) supplemented with 10% fetal bovine serum (FBS), 10 mM HEPES (pH 7.5), 100 U/ml penicillin, 100 µg/ml streptomycin, 2 mM L-glutamine, 0.05 mM ß-mercaptoethanol, and 0.02% (wt/vol) sodium bicarbonate. Telomerase-immortalized dermal microvascular endothelial (T4 TIME) cells were created as previously described (36) and were grown in EGM-2 MV media (Clonetics) with 50 U/ml of penicillin and 50 µg/ml streptomycin substituted for amphotericin B and gentamicin. HeLa and 293T cells were grown in Dulbecco's modified Eagle's medium (DMEM; Gibco) supplemented with 10% FBS, 100 U/ml of penicillin, and 100 µg/ml streptomycin. To block virion production in long-term cultures of KSHV-infected HeLa cells, 400 µM phosphonoacetic acid (PAA) (Sigma) was added to the culture media.

Construction of expression plasmids. The MIR2 promoter/luciferase reporter construct was created by PCR and cloned into pGL3.1 (Promega). The promoter lengths (200, 400, 600, 800, 1,000) represent the base pair distance upstream of the translational start site. Forward primers contained an engineered BglII site and were –1000 (tatcaccAAGCTTagaaaccccaaatag), –800 (actcaccAAGCTT ccaaattctaaaag), –600 (gctcgaggcgAAGCTTccatcgtgcgcc), –400 (tctctcataaAAGCTTatgacgcgtgtccc), and –200 (aaaaatacagAAGCTTagctaaagcaggg) (uppercase type indicates restriction enzyme sites). Reverse primer ctagacttcAAGCTTctctgcagctggggtgg contained an engineered HindIII site.

The MIR2 promoter/enhanced green fluorescent protein (EGFP) reporter construct (pMIR2-EGFP) was created by PCR amplification of the 1-kbp region upstream of the MIR2 ATG start site and restriction enzyme-mediated ligation into KpnII and ApaII in the multiple cloning site of the pEGFP (Clontech) vector directly upstream of the EGFP gene. To control for nonspecific activation of EGFP, the 1-kbp ORF K5 promoter region was cloned in the inverted orientation into the same sites in the pEGFP vector to create pORF INV K5/EGFP. The MIR2 retroviral plasmid construct (MIR2/pLNCX2) was created by PCR amplification of the entire 721-bp coding region of ORF K5 and HindIII and NotI restriction enzyme-mediated ligation into the multiple cloning site of the pLNCX2 (Clontech) vector under control of a cytomegalovirus immediate early promoter. All plasmid constructs were sequenced to confirm their fidelity.

The MIR2-FLAG tagged construct was a kind gift of L. Coscoy (University of California-Berkley) and contains a FLAG tag fused to the amino terminus of the MIR2 protein, within a pCR3.1 backbone.

Cell-free virus infection with KSHV. BCBL-1 cells were induced with a 12-h exposure to 20 ng/ml O-tetradecanoylphorbol-13-acetate and 300 µM sodium butyrate, and virus was collected from the supernatant on the sixth day after induction by centrifugation at 13,000 x g for 3 h. The viral pellet was resuspended in 1/100 the original volume in the appropriate culture media, and aliquots were frozen at –80°C. Increasing amounts of concentrated virus were then used to infect target cells in the presence of 8 µg/ml Polybrene (Sigma Aldrich) for 2 h.

Determining titers of KSHV. To calculate viral infectious particle concentration (which we designate as multiplicity of infection [MOI]), 5 x 104 HeLa cells per eight-well chamber slide (Falcon) were infected with serial dilutions of viral stocks in the presence of 8 µg/ml Polybrene (Sigma-Aldrich) as previously described (36). Cells were incubated with virus for 2 h at 37°C. Cells were harvested 24 h later by methanol-acetone (20°C, 1:1) fixation and permeabilization. Slides were blocked with 10% normal goat serum, 3% bovine serum albumin, and 1% glycine, stained for LANA expression with a rat monoclonal antibody (ABI) conjugated to Alexa 488 (Invitrogen) according to the manufacturer's instructions. Cells were incubated with the conjugated monoclonal antibody for 1 h at 25°C. Nuclei were counterstained with 0.5 µg/ml 4',6-diamidino-2-phenylindole (DAPI; Sigma) in 180 mM Tris-HCl (pH 7.5).

Viral titers were calculated following examination of slides at x40 magnification using a Nikon TE2000-E fluorescence microscope. Titers of all viral stocks were determined prior to use. Similar viral particle concentration results were obtained from each preparation, approximately 4 x 106 to 5 x 106 infectious particles/ml. Control inactivated KSHV was prepared by incubating viral stocks with UV light as previously described (36). KSHV infection titers were similar for both pDMVEC and HeLa cells.

Transfection. Promoter-EGFP transfections were carried out using the calcium phosphate precipitation method as described previously (12). Briefly, 10 µg of each plasmid DNA in 1,500 µl of DNA cocktail (250 mM CaCl2, Tris (pH 8.0), 100 mM NaCl, EDTA [pH 8.0]) was added to 1,500 µl of 2x transfection cocktail (50 mM HEPES [pH 8.0], 1 mM Na2PO4, 100 mM NaCl) with bubbling. The entire 1-ml DNA cocktail mix was then added dropwise to 3 x 106 target cells in 30 ml of fresh media with gentle swirling. Cells were incubated for 6 h with the transfection cocktail, washed twice, and then overlaid with fresh media for 1 to 2 days. All other plasmid transfections employed Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Transfection of siRNA constructs utilized siPORT (Invitrogen).

Generation and transduction of a VSV-G-pseudotyped MMLV retrovirus encoding MIR2. The pLNCX2 retroviral plasmid containing the complete KSHV ORF K5 gene was cotransfected into 293T cells with expression constructs containing the gag-pol genes of murine Moloney leukemia (MMLV) and the vesicular stomatitis virus glycoprotein G (VSV-G) (a kind gift from L. Hammarskjold and D. Rekosh). VSV-G-pseudotyped MMLV retroviruses containing the MIR2 expression plasmid were harvested from the supernatant at days 2 to 6 posttransfection and concentrated by centrifugation at 13,000 x g for 3 h. The viral pellet was resuspended in 1/100 the original volume in the appropriate culture media, and aliquots were frozen at –80°C. The virus was then transduced into T4 TIME cells by spinfection for 2 h at 2,000 x g in the presence of 8 µg/ml Polybrene.

Generation of cell lines stably expressing ORF K5 (or inverted ORF K5) promoter fragment upstream of EGFP. Stable HeLa cell lines expressing the EGFP gene under control of the ORF K5 promoter in the correct and inverted orientation were created by calcium phosphate transfection of HeLa cells with pORF K5/EGFP and pORF INV K5/EGFP plasmids, respectively. Transfected cells were then selected for neomycin resistance by growth in 2 mg/ml G418 antibiotic for 1 month, at which point a series of bulk cultures were analyzed for baseline EGFP expression by fluorescence-activated cell sorting. Cells expressing the intermediate basal levels of EGFP (10 to 100 fluorescence units) were utilized for subsequent analysis. Percentages of EGFP positive, MHC-I downregulated, and ICAM-1 downregulated were gated on a dot plot of the experimental parameter (EGFP, MHC-I allophycocyanin, or ICAM-1 allophycocyanin) on the x axis and side scatter on the y axis.

Luciferase assays. All cell cultures for the luciferase assays were conducted directly in tissue culture grade opaque white 96-well plates (Costar, Fisher). Promoter construct activity was measured 24 h posttransfection using the Dual-Luciferase Reporter assay system (Promega) according to the manufacturer's instructions. Briefly, 30 µl of passive lysis buffer was used to lyse the cells. Assays were either run immediately or stored at –80°C until acquisition. One hundred microliters of Luciferase assay reagent II (Promega) was injected into each well, followed by 1 s of automated shaking and 10 s of luminescence acquisition on a FLUOstar Optima luminometer (BMG Laboratories). Excel (Microsoft) was used for data analysis.

Flow cytometry. Target cells were infected with KSHV as described above and harvested for flow cytometry at the indicated times. Cells were detached from the plate with a 0.25% trypsin-EDTA solution (Gibco), and 0.5 x 106 cells per sample were then transferred to a 96-well plate after assessing cell count and viability by trypan blue exclusion. For surface staining, samples were washed twice with 1x phosphate-buffered saline [PBS] with 0.09% sodium azide and blocked for 30 min with antibody staining buffer (3% FBS in 1x PBS with 0.09% sodium azide [FSB]). Cell surface staining was then carried out for 1 h at 4°C in the dark. All cell surface antibodies and isotype controls were obtained from BD Pharmingen and used at the recommended dilution of 0.25 µg antibody/106 cells in antibody-staining solution. Cells were then washed twice with cold 1x PBS and fixed with 2% methanol-free formaldehyde. To identify MIR2-transfected cells, we permeabilized cells with 0.5% Triton in FSB for 10 min at room temperature, blocked cells with FSB for 10 min at room temperature, and incubated cells with a 1:500 dilution of anti-FLAG tag mouse monoclonal antibody M2 (Stratagene) directly conjugated to Alexa 488 using a Zenon kit (Molecular Probes) according to the manufacturer's instructions. Flow cytometry was performed with a FACSCalibur flow cytometer (Becton Dickenson) and analyzed with FlowJo 6.4.2 software (Tree Star). Prior to analysis, all samples were gated by forward scatter and side scatter to exclude dead cells and debris.

Immunoblots. Cells transfected with siRNA were harvested 2 days postinfection with radioimmunoprecipitation assay buffer supplemented with protease inhibitors. All samples were run on a large-format sodium dodecyl sulfate-polyacrylamide gel electrophoresis, with 12% resolving gel and 5% stacking gel; 30 µg of each sample was loaded as quantified by spectroscopy using Bradford reagent (Bio-Rad). Primary antibodies, rabbit anti-MIR2 (gift of G. Hayward) and mouse anti-alpha tubulin (Sigma), were diluted in 5% milk in Tris-buffered saline-Tween to 1:1,500 and 1:4,000, respectively. Secondary horseradish peroxidase-conjugated antibodies, donkey anti-rabbit (Jackson Laboratory) and rabbit anti-mouse (Jackson Laboratory), were used at 1:10,000 and 1:7,500, respectively, also in 5% milk in Tris-buffered saline-Tween.

For the immunoblot showing the correlation between MOI and MIR2 expression, proteins were harvested as previously described (20), and 30 µg of total protein was loaded into each lane of a 10% Bis-Tris gel (Invitrogen).

Expression of MIR2-specific siRNAs during KSHV infection. Specific siRNAs complementary to the ORF K5 gene (MIR2 protein) were designed using the Cenix algorithm (Ambion Corporation, Cambridge, MA) and chemically synthesized as described by the manufacturer. A 5'-targeted oligonucleotide (GGACGTAGAAGAGGGTGTAGAG) and a 3'-targeted oligonucleotide (GGGAACATTCTCCCCCGGGGCC) were both tested. As a control, a nonspecific siRNA was similarly tested. The siRNAs (100 nM) were transfected into HeLa or pDMVEC cells using the siPORT lipid transfection protocol (Ambion Corporation) as described by the manufacturer. Cells treated with siRNA were infected 12 h after siRNA transfection with KSHV virus as described above, retransfected with an equivalent amount of siRNA 12 h after infection, and harvested 2 days after KSHV infection for flow cytometry as described above.

Multispectral imaging flow cytometry. Two days after KSHV infection, HeLa cells were stained for surface expression with phycoerythrin-conjugated monoclonal antibodies to ICAM-1 (BD Biosciences) and MHC-I (BD Biosciences), as described previously (36). Following fixation with 2% paraformaldehyde, cells were permeabilized with a solution of 0.2% saponin in 2% FBS and PBS. Intracellular LANA levels were detected using a monoclonal rat anti-LANA antibody (ABI) conjugated to Alexa 488 (Molecular Probes). LANA dot intensity was measured by the Imagine and Ideas programs (Amnis Corporation) (1, 15) (see Fig. 4a, for a result from a representative experiment). Bars are ratios of mean fluorescence intensity (MFI) (MFI for LANA dot value of 1, 3, or ≥5 [A in the following equation] divided by MFI for 0 LANA dot value [B in the following equation]) ± ratio of standard error of the mean (SEM) {A/B x [square root][(ASEM/A)2 + (BSEM/B)2]}. DNA was counterstained with DRAQ5 (Biostatus Limited) at a nonsaturating concentration.


Figure 4
View larger version (26K):
[in this window]
[in a new window]

 
FIG. 4. Surface molecule downregulation peaks early postinfection, despite persistent viral infection. To determine the time course of downregulation, HeLa cells were infected with KSHV and surface molecule levels were analyzed by flow cytometry at various time points. (A) KSHV-infected HeLa cells were analyzed for MHC-I and ICAM-1 surface levels at 0, 8, 16, 29, 42, and 66 h postinfection. Bars represent the percentages of cells that have downregulated MHC-I (white bars) or ICAM-1 (black bars) in the total cellular population and are from a representative experiment. (B) MHC-I, ICAM-1, and LFA-3 surface expression in HeLa cells 2 and 7 days postinfection. Results from representative experiments with or without PAA are shown; PAA (400 µM) was used to block virion production and subsequent reinfection in culture. Results for isotype antibody controls (solid gray histogram), mock infection (gray histogram), and KSHV infection (black histogram) are shown. (C) Persistence of viral infection was measured by IFA of LANA expression. The total percentage of infected cells (left graph) and average number of LANA dots per cell (right graph) at 2 and 7 days postinfection are shown. Values for cultures in the absence (white bars) and presence (black bars) of PAA are shown (n = 2 ± range).


arrow
RESULTS
 
MIR2 transduction mirrors downregulation observed during the establishment of KSHV infection in endothelial cells. Previous studies have shown that MIR2 protein expression alone is sufficient to induce MHC-I and ICAM-1 downregulation from the surface of epithelial and lymphocyte cell lines, and recently, others have described the downregulation of PECAM in lytically infected endothelial cells (24). However, to our knowledge, previous studies have not established MIR2's role in immunological synapse component downregulation in the early phases of infection. Furthermore, the phenomenon of ICAM-1 and MHC-I downregulation has not been investigated in endothelial cells, one of the likely target cells of KSHV infection within Kaposi's sarcoma lesions (4). We have previously shown that infection of T4 TIME cells with KSHV results in the dramatic downregulation of MHC-I, ICAM-1 (CD54), and PECAM (CD31) from the surface of newly infected cells (Fig. 1A) (36). Additionally, we demonstrated that this loss of surface protein was not mediated by viral or cellular soluble factors (36). Therefore, we sought to identify the viral protein(s) responsible for this downregulation of immune modulatory proteins in endothelial cells infected with KSHV.


Figure 1
View larger version (42K):
[in this window]
[in a new window]

 
FIG. 1. Patterns of PECAM, ICAM-1, and MHC-I downregulation were similar following either KSHV infection or MIR2 transfection of T4 TIME cells. To compare the patterns of downregulation between early infection with KSHV and MIR2 expression alone, surface expression of MHC-I, ICAM-1, and PECAM was analyzed. (A) Flow cytometric analysis of mock-infected or KSHV (MOI, 5)-infected T4 TIME cells. (B) Flow cytometry analysis of MIR2 retrovirus transduction. Gating was based on mock-treated conditions (UV-KSHV infection or vector alone). T4 TIME cells were stained for surface protein expression (MHC-I, ICAM-1, and PECAM) with the indicated antibodies 48 h after infection. The percentage of cells contained within each quadrant is shown in the corners of each scatter plot.

We first compared the patterns of downregulation resulting from KSHV infection with those following transduction with a MIR2-expressing retroviral expression vector. To this end, we created a VSV-G-pseudotyped MMLV encoding the full-length KSHV ORF K5 gene/MIR2 protein. Consistent with earlier transfection studies with epithelial and lymphocyte cells, we found that MIR2 expression in endothelial cells resulted in a distinctive pattern of MHC-I and ICAM-1 downregulation (Fig. 1B, right column). Specifically, expression of MIR2 in T4 TIME cells led to a significant downregulation of MHC-I and ICAM-1 in the transduced cell population. Cells transduced with an empty retrovirus lacking MIR2 failed to exhibit downregulation of either cell surface protein (Fig. 1B, left column). In addition to MHC-I and ICAM-1 downregulation, we also observed a significant loss of PECAM from the surface of transduced cells, as previously reported (24). Moreover, the relative levels of MHC-I, ICAM-1, and PECAM codownregulation following MIR2 expression in T4 TIME cells was strikingly similar to the pattern we observed with infection of T4 TIME cells with intact KSHV (Fig. 1A, right column) compared to mock-infected cells (Fig. 1A, left column) (36). Together, these data suggested that MIR2 expression in endothelial cells was sufficient for the downregulation of the same three immunomodulatory proteins previously reported to be downregulated following de novo infection with KSHV (36). Both the targets and patterns of surface molecule loss shown by these data suggested that MIR2 was a prime candidate for the downregulation observed in the early stages of viral infection.

Activation of the ORF K5 (MIR2) promoter by KSHV infection. Infection of both primary and immortalized endothelial cells with KSHV results in fewer than 1% of infected cells expressing lytic genes, including RTA, MIR1, and MIR2, as detected by IFA (data not shown) (11, 18, 26, 31, 34-36, 40). However, we were unable to rule out the possibility that newly infected cells may express low levels of MIR2 in quantities below the sensitivity of our IFA, as suggested by the "early lytic burst" phenomenon proposed by the laboratory of Krishnan et al. (21). Since we additionally do not detect MIR2 protein within purified KSHV virions by mass spectrometry (M. Cranford, C. O'Connor, and D. Kedes, unpublished data), we reasoned that any MIR2 evident in cells postinfection would likely arise from de novo transcription of ORF K5. If true, we predict that the MIR2 promoter should be active immediately following infection.

To investigate this possibility, we characterized MIR2 promoter activity following infection. Previous work has established that the MIR2 promoter is moderately responsive to RTA (although its activation is not dependent on it) and is also activated by the Notch pathway (6, 7, 25). To determine if the MIR2 promoter is activated in the early events following de novo KSHV infection, we transfected HeLa cells with various lengths of the putative MIR2 promoter driving luciferase expression (pMIR2-luciferase –200, –400, –600, –800, and –1,000 bp from the translational start site) (Fig. 2A). We then infected the transfected cells with UV-inactivated or untreated KSHV at 2 MOIs (2.5 and 5) and measured luciferase activity 24 h later (Fig. 2B). We found that de novo infection strongly activated the MIR2 promoter and was KSHV dose dependent. Compared to UV-inactivated virus (pre-UV MOI of 5), infection with an MOI of 2.5 KSHV and an MOI of 5 KSHV led to 16-fold and 426-fold activation of the –1,000 K5 promoter construct, respectively. In parallel assays, the –800 increased by 50-fold and 370-fold, the –600 by 2-fold and 11-fold, the –400 by 2-fold and 6-fold, and the –200 by 2-fold and 3-fold, respectively. These promoter truncation mutants indicated that the region between –800 and –600 was critical for promoter activation following de novo infection, as promoter constructs lacking this area were dramatically less sensitive to KSHV infection (Fig. 2B). Promoter constructs transfected into HeLa cells in the absence of viral infection or UV-KSHV resulted in minimal background activation, on average less than twofold over empty vector (data not shown). As an additional control for specificity, promoter constructs in reverse orientation showed no pattern of activation by KSHV infection and had low overall levels of luciferase activity (data not shown).


Figure 2
View larger version (13K):
[in this window]
[in a new window]

 
FIG. 2. Dose-dependent activation of MIR2 promoter-luciferase constructs following de novo KSHV infection. To examine the dosage effects of KSHV infection on MIR2 promoter activity, cells transfected with MIR2 promoter constructs were infected with UV-inactivated KSHV or one of two concentrations of live virus. Promoter activity was measured at 24 h postinfection. (A) pMIR2-luciferase promoter constructs contained the regions –1,000, –800, –600, –400, and –200 bp from the MIR2 translational start site. (B) The luciferase activity levels are shown in duplicate (± range) at 24 h after exposure to UV-KSHV (pre-UV MOI of 5; black bars), KSHV (MOI of 2.5; white bars), or KSHV (MOI of 5; gray bars). Note the logarithmic y axis.

Although the luciferase reporter constructs indicated that KSHV infection led to the activation of the MIR2 promoter in pooled cellular samples, these experiments were unable to distinguish moderate promoter activity throughout the population from high promoter activity in a small percentage of cells. To distinguish between these possibilities and, thus, more definitively establish the relationship between MIR2 promoter stimulation and infection, we sought to simultaneously measure transcriptional activity and cell surface expression of MHC-I and ICAM-1 in individual cells within the culture. We first generated a cell line stably transfected with the longest (–1,000 bp) MIR2 promoter (Fig. 2A) driving EGFP expression. Next, we infected these cells with increasing amounts of virus and, 48 h later, simultaneously assessed EGFP expression and surface levels of MHC-I and ICAM-1 by flow cytometry (Fig. 3). We again found that, as with the pMIR2-luciferase constructs, KSHV activation of the MIR2 promoter was dose dependent (UV, 6% upregulated; MOI of 1, 8%; MOI of 2, 16%; MOI of 3, 26%) (Fig. 3, top row). In parallel with the rise in EGFP expression, the increasing amounts of input virus led to a dose-dependent increase in the number of cells exhibiting downregulation of MHC-I (UV, 1% downregulated; MOI of 1, 3%; MOI of 2, 15%; MOI of 3, 36%) (Fig. 3, center row) and ICAM-1 expression (UV, 10% downregulated; MOI of 1, 15%; MOI of 2, 34%; MOI of 3, 46%) (Fig. 3, bottom row). The activation of the pMIR2-EGFP reporter and concomitant cell surface protein downregulation was specific to active virus and did not occur with UV-inactivated KSHV (Fig. 3). Of note, at all levels of viral infection, more cells lost surface ICAM-1 expression than MHC-I (Fig. 3). Also of interest, the expression of EGFP following infection was extremely modest, while the concomitant increase in downregulation was quite pronounced. Although EGFP is only a surrogate marker for MIR2 expression in the infected cells, these results suggested that even a small increase in promoter activity correlated with a significant loss of surface marker expression.


Figure 3
View larger version (38K):
[in this window]
[in a new window]

 
FIG. 3. The dose-dependent activation of the ORF K5 promoter by KSHV infection correlates with MHC-I and ICAM-1 downregulation. Using a construct containing 1 kb upstream of the MIR2 transcriptional start site driving EGFP expression, expression of EGFP was compared to MHC-I and ICAM-1 expression in HeLa cells 48 h after KSHV infection. Flow cytometric analysis of EGFP (top), MHC-I (middle), and ICAM-1 (bottom). Cells were infected with increasing amounts of KSHV. KSHV with an MOI of 1 (left column), an MOI of 2 (center column), and an MOI of 3 (right column) are indicated by unfilled gray histograms. Mock-infected cells were incubated with UV-inactivated KSHV (black histograms). Shaded histograms represent the isotype antibody controls. Values shown in the upper-right-hand corner are percentages of cells from the infected population exhibiting EGFP upregulation or MHC-I/ICAM-1 downregulation.

Time course of MHC-I and ICAM-1 downregulation following de novo KSHV infection. As detailed in the previous set of experiments, we observed a specific activation of the full-length MIR2 promoter within the first day after KSHV infection. In clinical samples, viral protein expression appears to follow the canonical latent-lytic pattern (40). As such, we hypothesized that the expression of the lytic protein MIR2 may be transient when expressed early following infection. Subsequently, we were interested in the time course of immune synapse downregulation. To do this, we infected HeLa cells with KSHV and measured MHC-I and ICAM-1 levels 8, 16, 29, 42, and 66 h after infection. Values, as shown in Fig. 4A, have been normalized to the 0-h time point and are shown as percentages of the total cellular population that exhibited low surface molecule expression. We observed a slight upregulation of ICAM-1 expression at the 8-h time point, although this reversed by 16 h. The peak of downregulation was between 1 and 2 days postinfection.

Next, we wished to investigate the pattern of downregulation at a significantly later time point. By 1 week postinfection, the population of infected cells lost the pronounced downregulation of MHC-I, while ICAM-1 was slightly upregulated in approximately 40% of cells (Fig. 4B). To eliminate the possibility of release of progeny virions resulting in a superinfection of the cells and subsequently affecting surface molecules, we conducted the same time course in the presence of PAA, which blocks productive virion synthesis in infected cells (Fig. 4B) (22). Overall, it appeared that reinfection does not contribute significantly to downregulation (or upregulation) at either day 2 or day 7.

As the surface downregulation of MHC-I and ICAM-1 appeared to be transient immediately following infection, we wondered if this loss was associated with a concomitant loss in viral episome persistence. To test this, we harvested HeLa cells for LANA quantitation by IFA in the same populations measured in Fig. 4B. We found that the overall levels of infection were unchanged in the absence of PAA (day 2, 89.8 ± 5.9 range; day 7, 84.9 ± 2.3) (Fig. 4C). In the presence of PAA, there was a slight decrease in the percentage of infected cells (day 2, 91.7 ± 1.0; day 7, 78.9 ± 10.2). Moreover, the loss of downregulation in the majority of infected cells could not be attributed to the temporal redistribution of LANA among the total population (PAA day 2, 9.0 ± 0.2; PAA+ day 2, 10.0 ± 1.9; PAA day 7, 11.0 ± 0.7; PAA+ day 7, 7.2 ± 1.1). Of note, treatment with PAA alone (Fig. 4B) had a slight effect on surface molecule levels. In total, these data suggest that the effects of MIR2 expression are most pronounced in first 2 days postinfection, and despite persistent levels of infection, surface molecule levels return to baseline levels.

Level of MIR2 expression positively correlates with degree of surface molecule downregulation. As suggested by the MIR2 promoter studies, we hypothesized that the KSHV MOI correlates with MIR2 expression; thus, it was important to investigate the correlation between MIR2 expression and the degree of surface molecule downregulation. Low-level expression of MIR2 following de novo KSHV infection prevented us from accurately quantifying small changes in this ligase using traditional or imaging flow cytometry or IFA (data not shown). To overcome this problem, we transfected HeLa cells with a construct expressing FLAG-tagged MIR2 (see Materials and Methods). The sensitivity of the FLAG tag-specific antibody is markedly greater than that of the polyclonal MIR2 antibody, thereby allowing for a finer separation of cells expressing different levels of MIR2 (data not shown). Vector-transfected cells demonstrated a background MFI of 3.6 ± 3.6 (standard deviation) with the anti-FLAG antibody. Although the dynamic range from the FLAG tag signal is diminished in cells permeabilized for simultaneous intracellular and cell surface (ICAM-1, MHC-I) analyses, we were able to gate transfected cells into three groups based on differing levels of MIR2 expression. The low, medium, and high MIR2-FLAG expression groups had MFI values of 5.9 ± 0.8 (32% of the population), 8.9 ± 1.2 (5% of the population), and 17.6 ± 9.0 (1% of the population), respectively.

Populations transfected with MIR2 exhibited a pronounced decrease in both MHC-I and ICAM-1 compared to vector-transfected cells (Fig. 5A). Moreover, we observed a dosage effect of MIR2 on the downregulation of ICAM-1 and MHC-I (Fig. 5B). The levels of downregulation for each gate reflected data from 3,000 to 90,000 cells. Of note, even within the high MIR2 expression group (Fig. 5B, bottom histograms), downregulation was not complete. Although the majority of cells within this category lost MHC-I and ICAM-1 expression (75% and 76%, respectively), one-quarter of the total population was resistant to MIR2-dependent downregulation. These refractory cells, however, had a 25% reduced MFI of both surface markers compared to the low MIR2 expression category (Fig. 5B, top histograms), suggesting that MIR2 partially downregulated these surface proteins.


Figure 5
View larger version (30K):
[in this window]
[in a new window]

 
FIG. 5. Level of MIR2 expression correlates with degree of MHC-I and ICAM-1 downregulation and KSHV MOI. HeLa cells were transfected with vector alone or a full-length MIR2 construct containing a FLAG recognition site. MHC-I and ICAM-1 surface levels were measured at 24 h posttransfection. (A) MHC-1 and ICAM-1 surface expression are presented as histogram analyses for vector alone or the MIR2 total transfected population (ungated). (B) Expression of MHC-I and ICAM-1 for the three MIR2 expression gates, low, medium, and high, as based on detection by an anti-FLAG antibody. (C) Levels of MIR2 and alpha-tubulin proteins were compared in samples following infection with MOIs of 0, 10, 20, and 30 at 2 days after infection. This was compared to MIR2-transfected, uninfected cells as shown in the lane labeled MIR2 (24 h posttransfection).

To correlate directly the intracellular viral load with the degree of MIR2 expression, we infected cells with KSHV and then performed immunoblot assays to determine MIR2 levels 48 h later. In parallel, at 24 h, we assessed levels of infection for each sample by immunofluorescence-based LANA dot quantitation (see Materials and Methods). Thus, for each protein sample, we were able to able to accurately estimate the viral episome copy number per cell (i.e., MOI) (1, 3). When we compared cell populations with an average of 0, 10, 20, and 30 viral copies per cell, we observed a correlative increase in the level of MIR2 expression (Fig. 5C). By an MOI of 20, a prominent MIR2 band was evident and an MOI of 30 led to an even further increase in this signal. (Of note, even an MOI of 30 did not lead to the level of MIR2 expression as observed following transfection of the FLAG-tagged MIR2 construct.) This experiment strongly indicated that MIR2 expression directly correlated with degree of infection and supported the early findings that increased MOI led to increased MIR2 promoter activity.

Intracellular viral load determines level of MHC-I and ICAM-1 downregulation in HeLa cells. While the degree of KSHV infection positively corresponded with the amount of MIR2 expressed in the population, we wanted to evaluate the role of KSHV-episome dosage on downregulation in individual cells to ascertain whether this effect could occur in cells infected with minimal numbers of virions, as would likely occur in vivo (2). Although it seemed clear that the degree of downregulation of ICAM-1 and MHC-I paralleled the level of input virus added to a population of target cells (Fig. 3), traditional flow cytometry is unable to distinguish the precise level of infection (viral load) within individual cells (1). To address this issue, we employed high-throughput MIFC) to estimate the levels of intracellular viral load by determining the number of LANA dots in each cell while simultaneously measuring surface molecule expression (1, 27). MIFC fully integrates morphological information with fluorescence data and is, therefore, able to sensitively and accurately measure small focal intensities, such as the nuclear puncta exhibited by LANA. Intranuclear LANA dot fluorescence correlates with KSHV DNA, allowing the estimation of viral burden in each cell (1). Using traditional scatter plots, we observed an inverse correlation between LANA dot fluorescence and surface molecule expression (data not shown). The trends indicated that higher LANA dot fluorescence correlated with lower levels of MHC-I and ICAM-1. To analyze these data more methodically and determine how levels of infection correlated with downregulation, we binned cells into 4 categories based on the number of visualized LANA dots (0, 1, 3, and ≥5 [mean of 5.7 ± 1.1 standard deviation]) and calculated the MFI for each group (Fig. 6A). We found that cells with approximately one copy of KSHV (one LANA dot) showed only a slight but consistent decrease in surface molecule expression (~20% of ICAM-1 and ~5% for MHC-I) (Fig. 6A). Direct visual analysis of these infected cells confirmed the flow data (Fig. 6B). While increased intracellular levels of KSHV correlated with both ICAM-1 and MHC-I downregulation, ICAM-1 was invariably more sensitive than MHC-I to the virus (Fig. 6B). The relationship between surface molecule expression and increasing numbers of LANA dots suggested that KSHV-induced modulation of immune synapse components was dependent on intracellular viral copy number. Moreover, these data also indicated that downregulation was evident even with the lower levels of viral load reminiscent of those in the infected cells of KS (2).


Figure 6
View larger version (29K):
[in this window]
[in a new window]

 
FIG. 6. Distinct sensitivity of MHC-I and ICAM-1 downregulation to intracellular viral load. MIFC was used to compare intracellular viral load (LANA dots) to levels of MHC-I and ICAM-1 surface expression. (A) MFIs of ICAM-1 and MHC-I were compared for cells containing 0, 1, 3, or ≥5 LANA dots (viral genome equivalents) per cell. Cells were harvested 2 days post-KSHV infection. Data are ratios of MFI ± ratio of SEM. (B) Representative images were selected showing cells containing 0, 1, 3, and ≥5 LANA dots per cells. Images include bright field (BF), ICAM-1 or MHC-I, LANA, and DRAQ5 nuclear dye (NUC).

Knockdown of MIR2 results in loss of downregulation following de novo KSHV infection. While overexpression studies are helpful in evaluating potential functions of specific viral proteins, it is equally important to determine their effects in the context of whole-virus infection where their molecular environment and levels of expression may be markedly different. To this end, we wanted to evaluate the role of MIR2 following de novo infection when the protein levels, though present, are below detection by IFA (data not shown) (21, 36). To evaluate the potential immunomodulatory role of endogenous low-level MIR2 expression following KSHV infection, we designed MIR2-specific siRNA and assayed its ability to inhibit virus-induced immune regulatory protein downregulation. We also estimated the transfection efficiency with fluorescently conjugated siRNA oligonucleotides (data not shown) and found it to be approximately 70% in both HeLa and pDMVEC cells. Immunoblot analysis confirmed the efficacy of the MIR2-directed siRNA compared to control siRNA with an overall reduction in the protein by the former of approximately 60% among the newly infected HeLa cells (Fig. 7A), which correlated strongly with transfection efficiency. Using flow cytometry, we then measured ICAM-1 and MHC-I surface downregulation 2 days after KSHV infection in cells transfected with either MIR2-specific or control siRNAs. We observed a clear inhibition of downregulation in the presence of MIR2-specific siRNA but not control siRNA (Fig. 7B). A similar siRNA reversal of downregulation was evident following KSHV infection of primary endothelial cells (pDMVEC) (Fig. 8). Of note, a second MIR2-specific siRNA designed against the middle of the MIR2 mRNA was less effective in reducing MIR2 levels and, correspondingly, was also less efficient in inhibiting the downregulation (data not shown).


Figure 7
View larger version (25K):
[in this window]
[in a new window]

 
FIG. 7. MIR2-targeted siRNA reverses downregulation phenotype in infected HeLa cells. (A) Transfection of MIR2-specific siRNA led to a decrease in MIR2 protein, as shown by immunoblotting, at 48 h postinfection. Alpha-tubulin was used as a specificity and loading control. The left and right columns represent KSHV (MOI, 10)-infected cells that were transfected with either scramble (nonsense) or MIR2-specific siRNA, respectively. (B) In HeLa cells, MIR2 siRNA led to a loss of downregulation. Black lines are UV-infected cells, dotted lines are KSHV-infected plus scramble siRNA, and gray lines are KSHV-infected plus MIR2 siRNA. Isotype controls are represented by shaded histograms.


Figure 8
View larger version (34K):
[in this window]
[in a new window]

 
FIG. 8. Role of MIR2-dependent downregulation in KSHV-infected pDMVEC cells. Primary dermal microvascular cells exhibited minimal downregulation and full reversion of MHC-I expression following infection with KSHV (MOI, 10) and MIR2 siRNA transfection. Following the same procedures, ICAM-1 exhibited strong downregulation in the majority of the population but only partial reversion with MIR2 siRNA. Black lines are UV-infected cells, dotted lines are KSHV-infected plus scramble siRNA, gray lines are KSHV-infected plus MIR2 siRNA. Isotype controls are represented by shaded histograms.


arrow
DISCUSSION
 
In this study, we investigated the role of intracellular viral load and low-level MIR2 expression in virus-induced immune regulatory protein downregulation. Previous reports have explored the role of MIR2 through transfection studies or following lytic induction (10, 16, 17, 24, 30). The present data demonstrate that low-level de novo infection leads to expression of MIR2 levels sufficient for the detectable downregulation of immunological synapse components, MHC-I and ICAM-1 (Fig. 6). Transduction studies confirmed the potential of MIR2 to downregulate cell surface molecules in endothelial cells and produced a pattern of surface molecule loss remarkably similar to that following de novo KSHV infection (Fig. 1). To confirm that this pattern of downregulation following de novo infection could be due to MIR2 expression, we examined the activation of the MIR2 promoter using several promoter-reporter constructs. The pMIR2-luciferase constructs mapped an essential de novo infection responsive region to between –800 and –600 bp from the transcriptional start site (Fig. 2). Further studies into the relevant regions contained within the promoter are necessary to fully understand the transcriptional activation pathways involved and how these might differ from those involved in RTA responsiveness. Strikingly, the regions involved in Notch signaling activation of MIR2 appeared to be localized closer to the translational start site, suggesting that regulation of MIR2 transcription may differ during the initial infection and lytic reactivation (6, 7). We also found, using an EGFP reporter system that the MIR2 promoter activity correlated with MOI and the degree of downregulation (Fig. 3). Of note, ICAM-1 exhibited a more pronounced downregulation at all levels of virus compared to MHC-I. Elucidation of the mechanisms underlying this difference will require further study (see below). Additionally, the level of MIR2 expression correlated positively with the degree of surface molecule downregulation (Fig. 5A and B), and predictably, the level of MIR2 expression corresponded with the MOI (Fig. 5C).

To assess more directly the potential role of MIR2 in the downregulation of immune synapse components during the early events following KSHV infection, we transfected infected cells with MIR2-specific siRNA and found that this reversed the downregulation of MHC-I and ICAM-1 in the majority of both primary and cultured cells. Remarkably, in infected HeLa cells, this reversal was essentially complete in most of the cells, though a small portion of the population showed little to no effect. Although this bimodal result most likely reflects an incomplete transfection efficiency of MIR2 siRNA (Fig. 5A), it is possible that another viral or host gene, at least in some individual cells, may have contributed to immune regulatory protein downregulation during infection. Primary DMVEC cells show a less bimodal distribution following siRNA knockdown, which may be due to the decreased transfection efficiency in primary cells. The virally encoded protein with similar E3-ubiquitanase function, MIR1 (ORF K3), is not expressed during this early time period and leads to a pattern of downregulation distinct from that of MIR2 (21). We also noted (particularly with ICAM-1 expression) that in the cells that did show reversal of downregulation, the mean level of surface expression was consistently higher than on uninfected (UV-KSHV) cells (Fig. 7B). This suggested that endogenous expression of MIR2 might overcome an inherent upregulation of immunomodulatory surface molecules following infection. Thus, comparisons of cell surface downregulation pre- and postinfection likely generate a minimal estimate of the true magnitude of the effects of MIR2. Supporting this notion, we found that a defined percentage of infected cultures upregulated levels of ICAM-1 expression at early time points (8 h) postinfection (Fig. 4). This interpretation is also consistent with our earlier results, indicating that the media from similarly infected cells is proinflammatory and, alone, upregulates ICAM-1 and PECAM expression on naive T4 TIME cells (36).

Despite the critical role of MIR2 in mediating the KSHV-induced immune regulatory protein downregulation in infected HeLa cells, IFA evidence of MIR2 protein expression was present in less than 1% of these cells (data not shown). Since MIR2 is a membrane-associated type 3 ubiquitin ligase that targets surface molecules for internalization, its enzymatic nature could potentially allow even extremely low levels of the protein (undetectable by standard IFA) to successfully induce surface molecule downregulation (10, 16, 17, 24, 30). More sensitive techniques, in fact, demonstrate that KSHV infection of HFF and HMVEC-d cells results in MIR2 expression in an appreciable portion of the cells (21). Moreover, we observed the pattern of downregulation changes over time. The effects of MIR2 on ICAM-1 and MHC-I are transient, peaking approximately 2 days postinfection (Fig. 4A). By 1 week, the cultures, despite stable levels of infection, have lost the pronounced MHC-I downregulation and have upregulated ICAM-1 (Fig. 4).

Using MIFC, we found that the degree of ICAM-1 and MHC-I downregulation was directly dependent on intracellular KSHV viral load and, presumably, a corresponding amount of MIR2 (see below and Fig. 3) but that these immune synapse components differed in their sensitivity to infection (Fig. 4). The presence of approximately one LANA dot (approximately one KSHV genome copy) was sufficient to effect an approximately 20% decrease in ICAM-1 levels but an imperceptible decrease in MHC-I, which required three LANA dots before reaching similar degrees of downregulation. Similarly, five or more LANA dots resulted in effectively undetectable levels of ICAM-1 but only a 40% reduction in the total amount of MHC-I fluorescence intensity. Although ICAM-1 is more sensitive than MHC-I to the effects of MIR2, the reason for this difference is unclear. Possibilities include differences in their susceptibility to ubiquitylation, proteosomal degradation, or half-lives on the cell surface.

Additionally, we observed a direct correlation between downregulation and the intracellular levels of MIR2. We observed a dosage effect of both intracellular viral load and MIR2 expression on the degree of surface molecule downregulation (ICAM-1 and MHC-I). We hypothesized that MIR2 expression is closely linked to viral load, as the MIR2 promoter in luciferase and EGFP studies is sensitive to MOI (Fig. 2 and 3). Moreover the effects of MIR2 (surface molecule downregulation) also increase with virus titers (Fig. 3). When the effects of MIR2 are blocked by siRNA, there is a loss of downregulation in a large proportion of the population. Although low levels of expression in each individual cell hinder direct assessment of MIR2 following infection, the degree of exogenous MIR2 expression correlated with the degree of downregulation (Fig. 5).

It is probable that the correlation between viral load and the extent of surface downregulation of these surface proteins shortly after infection reflect differences in expression of MIR2. The simultaneous measurement of intracellular viral load and cellular (or viral) genes in a high-throughput single-cell assay such as MIFC has generated direct support for this idea that, previously, has been somewhat difficult to ascertain with less sensitive or pooled analyses. To the best of our knowledge, this is the first study to show the differential effects of viral load on KSHV-induced phenotypic changes within infected cells.

Together, the findings in this study demonstrate that the downregulation of cell surface immune modulatory proteins during the establishment of KSHV infection is due to the expression of low levels of the early lytic protein, MIR2. Physiologically, it would be advantageous for the virus to avoid detection during this potentially vulnerable period in the viral life cycle, prior to the establishment of latency. Our results and this interpretation are consistent with those suggested by others declaring that transient expression of a subset of lytic genes following cell entry may, in part, mediate early immunoprotection (21). Although MIR2 falls within the traditional classification of an early lytic herpesvirus protein, our data suggest that its gene, K5, is transcriptionally active, and the protein is functional in endothelial cells following de novo infection despite little to no evidence for subsequent completion of the (productive) lytic cycle (21). This adds to the growing body of evidence that argues that gene expression in KSHV is complex and highly dynamic and may defy exclusive categorization into either classically defined latent or lytic groups (7, 21, 25).

Modulation of individual or subsets of genes appears to be finely controlled to optimize viral survival. MIR2, in particular, is expressed during several time points in the viral life cycle: following entry and later during lytic reactivation and viral replication. Our results also indicate that, at least during the period of initial infection, effects of MIR2 appear to be dependent on the degree of infection in individual cells, with the most pronounced levels of cell surface protein downregulation arising in the most highly infected cells (i.e., a gene dose effect). Likewise, it is equally attractive to speculate that other differences, such as modulations in gene expression patterns, in various cell types and/or stages of KSHV infection may, in part, vary with different levels of intracellular viral load. These gene dosage effects could conceivably hold true for other herpesviruses as well. Although these latter possibilities await further study, the implications of our findings not only contribute to a greater understanding of the immune evasion tactics of KSHV but also support a less restrictive interpretation of the relationship between latent and lytic gene expression within herpesviruses.


arrow
ACKNOWLEDGMENTS
 
We thank David Lukac, Yan Yuan, and Gary Hayward for the kind gifts of polyclonal antisera for this project. We also thank Robert Weinberg for providing us with the pBABE vector encoding hTERT, Christian Brander for sharing data prior to publication and for helpful discussions, Mark Hoofnagle for technical assistance with the luciferase assays, Brandon E. Kremer for critical review of the manuscript, and Joanne Lannigan and Michael Solga of the UVA flow cytometry core.

Funding was provided by the National Institutes of Health (DHK R-01CA88768), Doris Duke Clinical Scientist Development Award (DHK 20000355), Pew Memorial Trust (DHK 97003260-000), and through the University of Virginia Cancer Center (P30 CA44579). L.A.A. was supported in part by Medical Scientist Training Grant T32 GM 07267-27 from the NIH and is an ISAC Scholar.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Box 800734, University of Virginia Health Sciences, Charlottesville, VA 22908. Phone: (434) 243-2758. Fax: (434) 982-1071. E-mail: kedes{at}virginia.edu Back

{triangledown} Published ahead of print on 28 February 2007. Back

{dagger} These authors contributed equally to this work. Back


arrow
REFERENCES
 
    1
  1. Adang, L. A., C. H. Parsons, and D. H. Kedes. 2006. Asynchronous progression through the lytic cascade and variations in intracellular viral loads revealed by high-throughput single-cell analysis of Kaposi's sarcoma-associated herpesvirus infection. J. Virol. 80:10073-10082.[Abstract/Free Full Text]
  2. 2
  3. Asahi-Ozaki, Y., Y. Sato, T. Kanno, T. Sata, and H. Katano. 2006. Quantitative analysis of Kaposi sarcoma-associated herpesvirus (KSHV) in KSHV-associated diseases. J. Infect. Dis. 193:773-782.[CrossRef][Medline]
  4. 3
  5. Ballestas, M. E., P. A. Chatis, and K. M. Kaye. 1999. Efficient persistence of extrachromosomal KSHV DNA mediated by latency-associated nuclear antigen. Science 284:641-644.[Abstract/Free Full Text]
  6. 4
  7. Blackbourn, D. J., E. Lennette, B. Klencke, A. Moses, B. Chandran, M. Weinstein, R. G. Glogau, M. H. Witte, D. L. Way, T. Kutzkey, B. Herndier, and J. A. Levy. 2000. The restricted cellular host range of human herpesvirus 8. AIDS 14:1123-1133.[CrossRef][Medline]
  8. 5
  9. Brander, C., P. O'Connor, T. Suscovich, N. G. Jones, Y. Lee, D. Kedes, D. Ganem, J. Martin, D. Osmond, S. Southwood, A. Sette, B. D. Walker, and D. T. Scadden. 2001. Definition of an optimal cytotoxic T lymphocyte epitope in the latently expressed Kaposi's sarcoma-associated herpesvirus kaposin protein. J Infect. Dis. 184:119-126.[CrossRef][Medline]
  10. 6
  11. Chang, H. 2006. Notch signal transduction induces a novel profile of Kaposi's sarcoma-associated herpesvirus gene expression. J. Microbiol. 44:217-225.[Medline]
  12. 7
  13. Chang, H., D. P. Dittmer, Y. C. Shin, Y. Hong, and J. U. Jung. 2005. Role of Notch signal transduction in Kaposi's sarcoma-associated herpesvirus gene expression. J. Virol. 79:14371-14382.[Abstract/Free Full Text]
  14. 8
  15. Chang, Y., E. Cesarman, M. S. Pessin, F. Lee, J. Culpepper, D. M. Knowles, and P. S. Moore. 1994. Identification of herpesvirus-like DNA-sequences in Aids-associated Kaposis-sarcoma. Science 266:1865-1869.[Abstract/Free Full Text]
  16. 9
  17. Chatterjee, M., J. Osborne, G. Bestetti, Y. Chang, and P. S. Moore. 2002. Viral IL-6-induced cell proliferation and immune evasion of interferon activity. Science 298:1432-1435.[Abstract/Free Full Text]
  18. 10
  19. Coscoy, L., D. J. Sanchez, and D. Ganem. 2001. A novel class of herpesvirus-encoded membrane-bound E3 ubiquitin ligases regulates endocytosis of proteins involved in immune recognition. J. Cell Biol. 155:1265-1273.[Abstract/Free Full Text]
  20. 11
  21. Dittmer, D., and D. H. Kedes. 1998. Do viral chemokines modulate Kaposi's sarcoma? Bioessays 20:367-370.[CrossRef][Medline]
  22. 12
  23. Fouillard, L. 1996. Physical method for gene transfer: an alternative to viruses. Hematol. Cell Ther. 38:214-216.[CrossRef][Medline]
  24. 13
  25. Franceschi, S., L. Dal Maso, P. Pezzotti, J. Polesel, C. Braga, P. Piselli, D. Serraino, G. Tagliabue, M. Federico, S. Ferretti, V. De Lisi, F. La Rosa, E. Conti, M. Budroni, G. Vicario, S. Piffer, F. Pannelli, A. Giacomin, F. Bellu, R. Tumino, M. Fusco, G. Rezza, and C. A. R. L. Study. 2003. Incidence of AIDS-defining cancers after AIDS diagnosis among people with AIDS in Italy, 1986-1998. J. Acquir. Immune Defic. Syndr. 34:84-90.[CrossRef][Medline]
  26. 14
  27. Gao, S. J., C. Boshoff, S. Jayachandra, R. A. Weiss, Y. Chang, and P. S. Moore. 1997. KSHV ORF K9 (vIRF) is an oncogene which inhibits the interferon signaling pathway. Oncogene 15:1979-1985.[CrossRef][Medline]
  28. 15
  29. George, T. C., B. E. Hall, C. A. Zimmerman, K. Frost, M. Seo, W. E. Ortyn, D. Basiji, and P. Morrissey. 2004. Distinguishing modes of cell death using imagestream (TM) multispectral imaging cytometry. Cytometry A 59A:118.
  30. 16
  31. Ishido, S., J. K. Choi, B. S. Lee, C. Wang, M. DeMaria, R. P. Johnson, G. B. Cohen, and J. U. Jung. 2000. Inhibition of natural killer cell-mediated cytotoxicity by Kaposi's sarcoma-associated herpesvirus K5 protein. Immunity 13:365-374.[CrossRef][Medline]
  32. 17
  33. Ishido, S., C. Wang, B. S. Lee, G. B. Cohen, and J. U. Jung. 2000. Downregulation of major histocompatibility complex class I molecules by Kaposi's sarcoma-associated herpesvirus K3 and K5 proteins. J. Virol. 74:5300-5309.[Abstract/Free Full Text]
  34. 18
  35. Katano, H., T. Sata, T. Suda, T. Nakamura, N. Tachikawa, H. Nishizumi, S. Sakurada, Y. Hayashi, M. Koike, A. Iwamoto, T. Kurata, and S. Mori. 1999. Expression and antigenicity of human herpesvirus 8 encoded ORF59 protein in AIDS-associated Kaposi's sarcoma. J. Med. Virol. 59:346-355.[CrossRef][Medline]
  36. 19
  37. Kedes, D. H., E. Operskalski, M. Busch, R. Kohn, J. Flood, and D. Ganem. 1996. The seroepidemiology of human herpesvirus 8 (Kaposi's sarcoma-associated herpesvirus): distribution of infection in KS risk groups and evidence for sexual transmission. Nat. Med. 2:1041.[CrossRef]
  38. 20
  39. Kremer, B. E., T. Haystead, and I. G. Macara. 2005. Mammalian septins regulate microtubule stability through interaction with the microtubule-binding protein MAP4. Mol. Biol. Cell 16:4648-4659.[Abstract/Free Full Text]
  40. 21
  41. Krishnan, H. H., P. P. Naranatt, M. S. Smith, L. Zeng, C. Bloomer, and B. Chandran. 2004. Concurrent expression of latent and a limited number of lytic genes with immune modulation and antiapoptotic function by Kaposi's sarcoma-associated herpesvirus early during infection of primary endothelial and fibroblast cells and subsequent decline of lytic gene expression. J. Virol. 78:3601-3620.[Abstract/Free Full Text]
  42. 22
  43. Lagunoff, M., J. Bechtel, E. Venetsanakos, A. M. Roy, N. Abbey, B. Herndier, M. McMahon, and D. Ganem. 2002. De novo infection and serial transmission of Kaposi's sarcoma-associated herpesvirus in cultured endothelial cells. J. Virol. 76:2440-2448.[Abstract/Free Full Text]
  44. 23
  45. Lubyova, B., and P. M. Pitha. 2000. Characterization of a novel human herpesvirus 8-encoded protein, vIRF-3, that shows homology to viral and cellular interferon regulatory factors. J. Virol. 74:8194-8201.[Abstract/Free Full Text]
  46. 24
  47. Mansouri, M., J. Douglas, P. P. Rose, K. Gouveia, G. Thomas, R. E. Means, A. V. Moses, and K. Fruh. 2006. Kaposi's sarcoma herpesvirus K5 eliminates CD31/PECAM from endothelial cells. Blood 108:1932-1940.[Abstract/Free Full Text]
  48. 25
  49. Okuno, T., Y. B. Jiang, K. Ueda, K. Nishimura, T. Tamura, and K. Yamanishi. 2002. Activation of human herpesvirus 8 open reading frame K5 independent of ORF50 expression. Virus Res. 90:77-89.[CrossRef][Medline]
  50. 26
  51. Parravicini, C., B. Chandran, M. Corbellino, E. Berti, M. Paulli, P. S. Moore, and Y. Chang. 2000. Differential viral protein expression in Kaposi's sarcoma-associated herpesvirus-infected diseases: Kaposi's sarcoma, primary effusion lymphoma, and multicentric Castleman's disease. Am. J. Pathol. 156:743-749.[Abstract/Free Full Text]
  52. 27
  53. Parsons, C. H., L. A. Adang, J. Overdevest, M. O'Connor, C. J. R. Taylor, D. Camerini, and D. H. Kedes. 2006. KSHV targets multiple leukocyte lineages during long-term productive infection in NOD/SCID mice. J. Clin. Investig. 116:1963-1973.[CrossRef][Medline]
  54. 28
  55. Rabkin, C. S., R. J. Biggar, M. S. Baptiste, T. Abe, B. A. Kohler, and P. C. Nasca. 1993. Cancer incidence trends in women at high-risk of human-immunodeficiency-virus (HIV) infection. Int. J. Cancer 55:208-212.[Medline]
  56. 29
  57. Renne, R., W. Zhong, B. Herndier, M. McGrath, N. Abbey, D. Kedes, and D. Ganem. 1996. Lytic growth of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in culture. Nat. Med. 2:342-346.[CrossRef][Medline]
  58. 30
  59. Sanchez, D. J., L. Coscoy, and D. Ganem. 2002. Functional organization of MIR2, a novel viral regulator of selective endocytosis. J. Biol. Chem. 277:6124-6130.[Abstract/Free Full Text]
  60. 31
  61. Sarid, R., O. Flore, R. A. Bohenzky, Y. Chang, and P. S. Moore. 1998. Transcription mapping of the Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) genome in a body cavity-based lymphoma cell line (BC-1). J. Virol. 72:1005-1012.[Abstract/Free Full Text]
  62. 32
  63. Sarid, R., T. Sato, R. A. Bohenzky, J. J. Russo, and Y. Chang. 1997. Kaposi's sarcoma-associated herpesvirus encodes a functional bcl-2 homologue. Nat. Med. 3:293-298.[CrossRef][Medline]
  64. 33
  65. Spiller, O. B., M. Robinson, E. O'Donnell, S. Milligan, B. P. Morgan, A. J. Davison, and D. J. Blackbourn. 2003. Complement regulation by Kaposi's sarcoma-associated herpesvirus ORF4 protein. J. Virol. 77:592-599.[CrossRef][Medline]
  66. 34
  67. Staskus, K. A., W. Zhong, K. Gebhard, B. Herndier, H. Wang, R. Renne, J. Beneke, J. Pudney, D. J. Anderson, D. Ganem, and A. T. Haase. 1997. Kaposi's sarcoma-associated herpesvirus gene expression in endothelial (spindle) tumor cells. J. Virol. 71:715-719.[Abstract]
  68. 35
  69. Talbot, S. J., R. A. Weiss, P. Kellam, and C. Boshoff. 1999. Transcriptional analysis of human herpesvirus-8 open reading frames 71, 72, 73, K14, and 74 in a primary effusion lymphoma cell line. Virology 257:84-94.[CrossRef][Medline]
  70. 36
  71. Tomescu, C., W. K. Law, and D. H. Kedes. 2003. Surface downregulation of major histocompatibility complex class I, PE-CAM, and ICAM-1 following de novo infection of endothelial cells with Kaposi's sarcoma-associated herpesvirus. J. Virol. 77:9669-9684.[Abstract/Free Full Text]
  72. 37
  73. Wang, H. W., T. V. Sharp, A. Koumi, G. Koentges, and C. Boshoff. 2002. Characterization of an anti-apoptotic glycoprotein encoded by Kaposi's sarcoma-associated herpesvirus which resembles a spliced variant of human survivin. EMBO J. 21:2602-2615.[CrossRef][Medline]
  74. 38
  75. Wang, X. P., Y. J. Zhang, J. H. Deng, H. Y. Pan, F. C. Zhou, E. A. Montalvo, and S. J. Gao. 2001. Characterization of the promoter region of the viral interferon regulatory factor encoded by Kaposi's sarcoma-associated herpesvirus. Oncogene 20:523-530.[CrossRef][Medline]
  76. 39
  77. Weber, K. S., H. J. Grone, M. Rocken, C. Klier, S. Gu, R. Wank, A. E. Proudfoot, P. J. Nelson, and C. Weber. 2001. Selective recruitment of Th2-type cells and evasion from a cytotoxic immune response mediated by viral macrophage inhibitory protein-II. Eur. J. Immunol. 31:2458-2466.[CrossRef][Medline]
  78. 40
  79. Zhong, W., H. Wang, B. Herndier, and D. Ganem. 1996. Restricted expression of Kaposi sarcoma-associated herpesvirus (human herpesvirus 8) genes in Kaposi sarcoma. Proc. Natl. Acad. Sci. USA 93:6641-6646.[Abstract/Free Full Text]
  80. 41
  81. Ziegler, J. L., A. C. Templeton, and C. L. Vogel. 1984. Kaposis sarcoma-a comparison of classical, endemic, and epidemic forms. Semin. Oncol. 11:47-52.[Medline]


Journal of Virology, May 2007, p. 5079-5090, Vol. 81, No. 10
0022-538X/07/$08.00+0     doi:10.1128/JVI.02738-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Mansouri, M., Rose, P. P., Moses, A. V., Fruh, K. (2008). Remodeling of Endothelial Adherens Junctions by Kaposi's Sarcoma-Associated Herpesvirus. J. Virol. 82: 9615-9628 [Abstract] [Full Text]  
  • Thomas, M., Boname, J. M., Field, S., Nejentsev, S., Salio, M., Cerundolo, V., Wills, M., Lehner, P. J. (2008). Down-regulation of NKG2D and NKp80 ligands by Kaposi's sarcoma-associated herpesvirus K5 protects against NK cell cytotoxicity. Proc. Natl. Acad. Sci. USA 105: 1656-1661 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Adang, L. A.
Right arrow Articles by Kedes, D. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Adang, L. A.
Right arrow Articles by Kedes, D. H.