Previous Article | Next Article ![]()
Journal of Virology, May 2007, p. 4956-4962, Vol. 81, No. 10
0022-538X/07/$08.00+0 doi:10.1128/JVI.00104-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Division of Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle, Washington 98109
Received 16 January 2007/ Accepted 1 March 2007
|
|
|---|
|
|
|---|
The replication strategy of foamy viruses (FVs), in the spumaretroviral subfamily, is characterized by several unusual features that distinguish them from orthoretroviruses (21, 26, 34). For example, reverse transcription is a late event in the viral morphogenesis and the viral particles contain an infectious DNA genome (27, 36, 44). One of the most intriguing FV characteristics is the Gag-independent expression of the Pol protein from a subgenomic mRNA (23, 42). This lack of a Gag-Pol fusion protein raises questions regarding the mechanism of Pol encapsidation into particles. It was previously shown that the incorporation of genomic RNA is essential for Pol encapsidation (14). Moreover, two Pol encapsidation sequences (PES) seem to be required for Pol incorporation, one located in the 5' untranslated region of the viral genomic RNA (PES I) and one in the 3' region of the pol gene (PES II) (14, 16). The C terminus of Gag was also found to be involved in Pol processing and incorporation (38).
In contrast to orthoretroviruses such as HIV, in which multiple PR cleavage sites (CSs) are found within Gag and Pol, FVs undergo only limited proteolytic processing of structural and enzymatic proteins by the aspartic viral PR (8, 22, 33). Compared to HIV, where the Gag precursor protein is cleaved into MA, CA, and NC, only a subset of FV Gag molecules is cleaved once by the FV PR, near the C terminus (11, 12, 19, 28). The partial processing at the C terminus of Gag, resulting in a p71/p68 kDa protein doublet, has been shown to be critical for infectivity (8, 45). Another cleavage occurring in Gag early after infection appears to be essential for viral replication, possibly by allowing the disassembly of incoming CAs (20). Pol is synthesized as a 127-kDa precursor protein (PR-RT-IN) and is processed into only two cleavage products, an 85-kDa protein containing PR and RT and a 40-kDa IN protein (29, 33). Although only a PR-RT protein is found in the virions, expression in vitro of either PR or RT without the other domain leads to enzymatically active protein (18, 32).
Given the fact that PR-RT is a unique protein with both proteolytic and polymerase activities, we wondered whether the PR-RT-IN precursor has enzymatic activity. IN is essential for efficient viral replication (9, 25), but it is not known whether IN is active in the Pol precursor.
There are two approaches to studying the effects of polyprotein cleavage on the activities of the viral enzymes and viral infectivity: disruption of the PR activity or deletion of the CS. A mutant with a mutation in the PR domain (D/A) lacking enzymatic activity has been described previously (19). However, this mutant fails to cleave Gag, which is essential during the early phase of infection and for the efficient disassembly of incoming CAs (20). For this reason we chose to examine Pol CS mutants. In the present study, we analyzed the enzymatic activities of PR and RT in full-length Pol and found reduced levels of PR and RT activity. Although decreased levels of Pol were detected in cell-free virions, packaging of the Pol precursor protein is sufficient for the production of infectious viral particles. Interestingly, these particles cannot undergo subsequent rounds of infection.
|
|
|---|
CS (
24 nucleotides [nt]), the whole CS was deleted. In pRTstop1, the two stop codons TGA and TAG were introduced into pcHFV13 at position 5221 (forward primer TAATACCAAAAAATGATAGCTGGATGCAGAGTTG and reverse primer AACTCTGCATCCAGCTATCATTTTTTGGTATTAC), and in pRTstop2, the two stop codons TGA and TGA were introduced at position 5182 (forward primer TTGCCACCCAATGATGATATGTGGTTAATTG and reverse primer CAATTAACCACATATCATCATTGGGTGGCAA). pcHFV13-PR is similar to pcHFV13 except that the PR-encoding region contains the active-site mutation D24A, which renders the human FV (HFV) PR inactive (19, 35). Additional mutants used in these studies are mutant
Gag, lacking Gag protein expression (3), and mutant IN, lacking IN activity (25). In pcHFV
RT, the 4 amino acids (aa) of the active center of the RT (YVDD) were changed to alanines (forward primer AATGTACAAGTGGCTGCTGCTGCTATATATTTAAG and reverse primer CTTAAATATATAGCAGCAGCAGCCACTTGTACAT). |
View this table: [in a new window] |
TABLE 1. Sequence at the CS in wild-type FV and CS mutantsa
|
Cell culture. 293T cells (6), BHK cells (ATCC CCL-10), FAB cells (43), and diploid human embryonic lung (HEL) cells (ATCC CCL-137) were cultivated in Dulbecco's modified Eagle's minimal essential medium supplemented with 10% fetal bovine serum and antibiotics. FV stocks were obtained by transfection of 293T cells with either PolyFect reagent (QIAGEN) or 1 mg/ml polyethylenimine (Polysciences, Inc.) as described previously (7). For viral transfer experiments, HEL cells were infected with cell-free supernatants (0.45-µm-pore-size filter) for 8 h, washed once with fresh medium, and cultivated in fresh medium. Forty-eight hours after infection, all medium was removed and cells were passaged into new dishes. Viral supernatants were harvested and filtered 48 h after passaging, and titration was performed on FAB cells. The foamy virus-activated ß-galactosidase (ß-gal) (FAB) assay of viral infectivity was done as described previously (43).
Western blotting. Cell lysates and viral supernatants were harvested between 42 and 45 h posttransfection and prepared for immunoblotting as described previously (38). Viral supernatants were collected, passed through a 0.45-µm-pore-size filter, and then pelleted for 2 h through a 20% sucrose cushion by ultracentrifugation (24,000 rpm, 4°C; Beckman). Cell lysates and viral pellets were resuspended in 1x sodium dodecyl sulfate-polyacrylamide gel electrophoresis sample loading buffer. After protein separation on 10% sodium dodecyl sulfate-containing polyacrylamide gels, proteins were transferred to Immobilon-P membranes (Millipore) by using semidry electrophoresis. Western blot analyses were performed using anti-Gag polyclonal rabbit antiserum (4) at a 1:5,000 dilution, anti-Pol monoclonal mouse antibody (38) at a 1:800 dilution, anti-PR polyclonal rabbit antiserum at a 1:5,000 dilution, and anti-IN polyclonal rabbit antiserum at a 1:5,000 dilution. Rabbit polyclonal antiserum against prototype FV (PFV) PR (aa 1 to 128 of Pol) was generated using a glutathione-S-transferase (GST)-PR fusion protein. The antibody was shown to react to both the 127-kDa precursor Pol protein and the 85-kDa PR-RT cleavage product (data not shown). The anti-IN polyclonal rabbit serum was generated using a GST-IN fusion protein (aa 763 to 1123 of Pol) and specifically recognizes the 127-kDa Pol precursor protein and the IN domain of Pol. Blots were visualized using ECL Plus reagent (Amersham Biosciences) or the Odyssey infrared imaging system (LI-COR Biosciences). The levels of Pol were determined by using the Odyssey application software, version 1.2 (LI-COR Biosciences). This assay is roughly linear over an eightfold range of protein (data not shown).
Assay of virion-associated RT activity.
Virion-associated RT assays were performed as described previously (35). This assay uses poly(A) poly(dT)10 as the primer-template, and incorporation of [
-32P]dTTP is measured. Viral supernatants from transfected BHK cells were collected, filtered, and concentrated with Centriprep YM-50 spin columns (Amicon). For the RT reaction, 100 µl RT cocktail was added to a normalized amount of viral supernatant (total volume of 260 µl) and incubated at 37°C. After 90 min, 25 µl of the reaction mixture was taken for the analysis. Normalization of Pol molecules was done using an anti-Pol monoclonal antibody at a 1:800 dilution, and the protein was roughly quantitated using the Odyssey application software, version 1.2 (LI-COR Biosciences).
|
|
|---|
C555NTK is recognized by an aspartic PR that is part of the FV Pol precursor protein and is absolutely required for infectivity and processing (19). To analyze the role of the RT-IN CS for FV replication, Pol CS mutants were generated in the context of the full-length virus pcHFV as shown in Fig. 1 and Table 1. Wild-type (wt) and mutant proviruses were transiently transfected into 293T cells, and equal amounts of cell lysates were tested for viral protein expression. Following Western blot analyses using a polyclonal anti-Gag serum (Fig. 2A and B, lanes 2 to 8), we quantitated the total amount of Gag expressed in the cell for all CS mutants and compared these numbers to those for the wt (Table 2, first column). Mutant PR is mutated at the active center of the viral PR and is used as a control, as there is no viral PR cleavage activity (Fig. 1B). Gag expression levels are similar for all CS mutants, albeit with slightly reduced amounts for mutants CS4 and PR (24% and 27% less Gag expression, respectively).
![]() View larger version (17K): [in a new window] |
FIG. 1. Schematic representation corresponding to the PFV pol gene and its domains. (A) The locations of PR, RT, RH, and IN are shown. The arrow in wt PFV Pol indicates the position of the proteolytic CS between the RT and IN domains. (B) The D/A mutation in the PR mutant results in the expression of the Pol precursor molecule only. (C) Mutant RTstop1 contains two stop codons downstream of the Pol CS, and the IN domain is absent. (D) Mutant RTstop2 contains two stop codons at the 3' end of the RT/RH domain upstream of the Pol CS. (E) CS mutations are described in Table 1.
|
![]() View larger version (42K): [in a new window] |
FIG. 2. Analysis of Gag and Pol expression and cleavage. 293T cells were transfected with control or viral DNA, and cell lysates as well as viral supernatants were harvested at 2 days posttransfection. (A) Western blot analysis of cell lysates and cell-free virus using polyclonal anti-Gag antiserum. (B) Western blot analysis of cell lysates and cell-free virus using a monoclonal anti-Pol antibody.
|
|
View this table: [in a new window] |
TABLE 2. Gag expression, particle release, and Gag p68/p71 ratio in wt FV and mutantsa
|
Gag, which contains a large deletion of the gene (nt 1120 to 2368) (Fig. 2A, lane 12) (3). The Western blot results for released virus showed slightly reduced particle release for the
CS, CS6, and CS8 mutants (Fig. 2A, lanes 16, 19, and 20). The blots were quantitated using ImageJ software. We have determined that this assay is linear over an eightfold range (data not shown). To determine the relative number of particles released for each mutant, the amount of Gag released from the cell was divided by the total amount of Gag expressed in the transfected 293T cells. The results show that all mutants except CS2 and CS4 release fewer particles into the supernatant (Table 2, second column). However, in no case was the effect greater than twofold. The PR, RTstop1, and RTstop2 mutants are all able to release the uncleaved Gag CAs into the supernatant (Fig. 2A, lanes 21, 22, and 23).
To compare cleavage of the mutants to cleavage of wt Gag, the amounts of p68 and p71 protein in transfected cells and released particles were quantitated. Equal amounts of cell lysates and viral supernatants were analyzed by Western blot analysis. The extent of cleavage in mutant PR was set to 0 and the ratio of p68 to p71 in pcHFV and the mutants was normalized to the ratio in mutant PR. Gag cleavage in cells is reduced in most of the mutants, with about a twofold reduction (Table 2, third column). A similar pattern was observed for the p68 to p71 ratio in cell-free virus (Table 2, fourth column). Whereas minimal mutation of the CS (mutants CS2 and CS4) resulted in 1.2-fold- to 2.4-fold-reduced cleavage, more severe mutations, e.g., mutant
CS or CS8, resulted in about a fourfold-decreased p68/p71 ratio compared to that in the wt virus.
The PR-RT-IN precursor protein (P127Pol) is cleaved into an 85-kDa PR-RT protein (p85PR-RT) and a 40-kDa IN protein (p40IN). We used a mouse monoclonal antibody directed against the RH domain of PR-RT (38) to detect both the Pol precursor protein and the cleaved PR-RT protein (Fig. 2B). Compared to the amount in the wt virus (Fig. 2B, lane 2), the amount of total Pol expressed in transfected cells was roughly similar in all mutants (Fig. 2B, lanes 3 to 8). Quantitation showed that for most mutants, Pol expression is reduced from 1.3-fold to 1.8-fold, except for mutant CS2, in which there was a 1.4-fold increase in Pol expression (Fig. 3A, black bars). However, proteolytic cleavage of the Pol precursor into mature PR-RT was observed only for the CS2 construct that contains a 2-aa substitution in the residues flanking the RT-IN CS (Table 1 and Fig. 2B, lane 5). The mutants RT-IN2,
CS, CS4, CS6, and CS8, which contain a greater number of mutated amino acids, showed little or no Pol cleavage (Table 1 and Fig. 2B, lanes 3, 4, 6, 7, and 8). As PR lacks PR activity, this mutant expresses only the 127-kDa precursor protein (Fig. 2B, lane 9). Both RTstop mutants showed efficient expression of the p85PR-RT protein with no full-length Pol protein detectable (Fig. 2B, lanes 10 and 11). Transfection of
Gag resulted in both expression of the Pol precursor protein and cleavage into PR-RT (Fig. 2B, lane 12), showing that particle formation is not required for Pol cleavage. This implies that Pol can dimerize intracellularly, resulting in active PR.
![]() View larger version (30K): [in a new window] |
FIG. 3. Pol expression and Pol packaging efficiency. Equal amounts of cellular lysates or supernatants were loaded in each lane. (A) Pol expression and Pol incorporation into viral particles were normalized to wt virus Pol protein levels by using Western blot analysis and the Odyssey infrared imaging system. The mean values and standard deviations from three separate 293T transfections are normalized to the pcHFV control set as 1. Using dilutions of control wt FV Pol protein, the Western blot results were linear over an eightfold range (data not shown). (B) Ratios of viral Pol packaging efficiency to Pol expression in transfected 293T cells.
|
Gag-transfected cells, confirming that the detection of extracellular Pol requires particle formation (3). The major Pol product found in wt viral particles is the 85-kDa PR-RT protein (Fig. 2B, lane 14), and a similar profile was observed for mutant CS2 (Fig. 2B, lane 17). For the other CS mutants, the Pol precursor protein was still packaged into virions, but to a much lower extent (Fig. 2B, lanes 15, 16, 18, 19, and 20, and 3A). As shown in Fig. 3B, the mutations in the
CS and CS8 constructs showed the most severe effects on the amounts of cellular Pol that were packaged, with threefold-reduced Pol encapsidation into viral particles (Fig. 2B and 3A, gray bars, and 3B). To confirm the Pol cleavage results, we probed the blots with two polyclonal antisera that were raised against purified GST-IN (anti-IN) or GST-PR (anti-PR) fusion protein. Anti-PR recognizes p127Pol and p85PR-RT, and anti-IN recognizes P127Pol and p40IN, although for both sera, the cleaved products are recognized better than the precursor (Fig. 4A and B and data not shown). In the wt virus (Fig. 4, lane 2), the packaged Pol was efficiently cleaved to PR-RT and IN, and little or no precursor protein was detected. This was also the case for mutant CS2 (Fig. 4, lanes 5). In contrast, little or no cleaved Pol was seen in any of the other CS mutants or in mutant PR (Fig. 4, lanes 3, 4, 6, 7, 8, and 9). As reported previously (31), no detectable Pol was seen in RTstop2 particles (Fig. 4, lanes 10). As these antisera react very strongly with Pol subunits, these results confirm the lack of processed proteins in all of the CS mutants except for CS2.
![]() View larger version (37K): [in a new window] |
FIG. 4. Measurements of Pol incorporation into virus-like particles using anti-PR and anti-IN antibodies. (A) Pelleted viral supernatants from transfected 293T cells were probed in Western blot analyses using an anti-PR (A) and an anti-IN (B) antibody. Enhanced chemiluminescence reagents were used for signal detection with X-ray films. The levels of Gag expression in transfected cells and the levels of released CAs were the same in all mutants (data not shown).
|
RT). Data obtained for the
RT mutant were subtracted from the data for the wt virus and each of the CS mutants, and the wt level (pcHFV) was set to 100% (Fig. 5). All the mutants showed decreased RT activity relative to the activity in the wt virus. Mutant
CS showed the lowest level, 16% of the wt level. The decrease in RT activity for all mutants was statistically significant using a paired t test. These results indicate that blocking cleavage at the RT-IN site decreases RT activity, but does not eliminate it.
![]() View larger version (10K): [in a new window] |
FIG. 5. Virion-associated RT assay. BHK cells were transfected, and viral supernatants were harvested 4 days posttransfection and concentrated. Aliquots of pelleted supernatants were normalized for Pol content, and the RT activity was determined for each of the concentrated samples by measuring the incorporation of a radiolabeled nucleotide as described in Materials and Methods. Incorporation was measured at 90 min and normalized to that of the wt sample (pcHFV). The mean values and standard deviations from three independent experiments are shown. The levels of RT activity were assessed by a paired t test, and all mutants showed statistically significant decreases (P < 0.005, except for mutant CS2, P = 0.01, and for mutant CS8, P = 0.02; indicated by *).
|
CS, which still retained a titer of greater than 104 infectious units per ml. However, the FAB assay measures only the ability of virus to infect cells and express Tas. Since FV has a DNA genome, it is possible that Tas could be transcribed and translated from the incoming genomic DNA. Indeed, DNA extracted from extracellular virions has been shown to be infectious (36, 44). However, induction of ß-gal in the single round of infection assay does require the production of virions containing DNA. Thus, the FAB assay requires active PR and RT, but not necessarily IN. In fact, the IN mutant, lacking the IN active site, produced infectious viral particles and scored positive in the FAB assay (18.2% of the wt level). |
View this table: [in a new window] |
TABLE 3. Titers of Pol CS mutants after transfection of 293T cellsa
|
CS and CS8 (Table 1), did not replicate to detectable levels after a second round of infection, although infectious virus was produced after the first round of infection. Thus, the cleavage between RT and IN is required for efficient viral replication, although it is not absolutely required for PR or RT activities. |
View this table: [in a new window] |
TABLE 4. Titers of Pol CS mutants after infection of HEL cellsa
|
|
|
|---|
FV Pol differs from Pol of the orthoretroviruses in many respects. It is the only known enzyme that contains both RT and PR (18, 29). Some cleavage between PR and RT could be demonstrated in vitro using bacterially expressed FV Pol proteins, although the cleavage is inefficient (33). For retroviral PRs, the P2 residue (see Table 1) in a given substrate is critical for cleavage, and in most FV isolates, the PR CSs contain a Val at P2 (33). However, substrates containing Ala or Cys instead of Val are cleaved equally well by FV PR in vitro (2). In order to define the tolerated changes at the RT-IN CS, we replaced different numbers of amino acids at the CS defined by Pfrepper et al. (33) with alanines (Table 1, CS mutants). Mutant RT-IN2 contains three amino acid changes at the CS, including a Gly at P2 which has been shown to be inefficiently recognized by retroviral PR (2). In all mutants except CS2, which still contains the Val at P2, the Pol precursor protein remains uncleaved, confirming the importance of the P2 position at the CS for substrate specificity (2).
The cleavage of the Gag protein is affected in most of the CS mutants. It has been shown that only the Pol precursor protein, but not the individual PR-RT or IN subunits, is packaged into virions (31). We have also found that Pol mutants lacking the IN domain do not process Gag (mutants RTstop1 and RTstop2). Thus, this lack of Gag processing probably reflects the failure of the mutant Pol proteins to be packaged into virions where processing is believed to take place. Two PES in the viral genomic RNA are essential for Pol protein encapsidation (10, 13-16, 41), implying that Pol binds to RNA. However, it is also possible that Pol first interacts with Gag, so that a Gag-Pol complex binds to RNA and is packaged into virions through Gag determinants (E. G. Lee and M. L. Linial, unpublished data). Sequences in IN could be responsible for such an interaction with Gag.
We unexpectedly found that the levels of Pol in extracellular virions from cells transfected with most of the CS mutants are reduced more than would be expected from the intracellular Pol levels (Fig. 2 and 3). Some of these Pol mutants contain only small changes in the amino acid sequence. One explanation is that the mutations lead to a major conformational change in the structure of the Pol protein, so that it cannot bind to RNA and/or Gag. A second possibility is that the mutated Pol proteins localize incorrectly in the cell. Both Pol and Gag bear nuclear localization signals (NLSs) and are imported into the nucleus, where they might interact (17, 37). The NLS in Gag is thought to be in the C-terminal part of Gag (37). It has been proposed that at least two NLSs are present in Pol, one located in the PR-RT domain and the other one in the IN domain. However, the exact position and composition of the Pol NLSs are unknown and one could overlap the CS (17, 37). However, our results do not support incorrect localization, as Gag is cleaved in the mutants, indicating that Gag and Pol interact at some point during assembly, despite the fact that less Pol is found in mutant particles. A third possibility is that the Pol CS itself is an important domain required for interaction with the assembly complex.
Our main goal in mutating the RT-IN CS was to determine the effect on Pol enzymatic activities and infectivity. Very little is known about the effect of eliminating the PR CSs in Pol of FVs or other retroviruses. One study showed that mutations at the HIV-1 RT-RH PR CS (which does not exist in FV) resulted in greatly decreased RT activity relative to the activity in the wt virus (1). We found that elimination of the CS between RT and IN led to significant decreases in the levels of RT activity (Fig. 5). Mutants RT-IN2, CS2, and CS8 retained about half of the wt RT activity, but the deletion of 8 aa in mutant
CS appeared to lead to a sixfold loss of virion RT activity. Since FV virions contain fewer Pol molecules than other retroviruses, small negative effects on RT activity have a profound effect on viral replication (35).
As in all retroviruses, FV IN contains a zinc finger domain, a DNA binding domain, and a DD35E motif, which is the active center of the enzyme (30). Recombinant FV IN contains the expected site-specific endonuclease, IN, and disintegrase activities (30). While efficient FV replication requires IN (9, 25), the FAB assay is designed to measure only a single round of infection. Reverse transcription is a late event in FV morphogenesis, and infectious particles consist of a DNA genome instead of RNA (27, 42, 44). This means that, to score positive in the FAB assay, active PR and RT must both be made in the producer cell; however, integration appears not to be necessary. The IN mutant lacking the active site scores positive in the FAB assay, but cannot replicate in subsequent rounds (Tables 3 and 4) (25). Most of the CS mutants behave like the IN mutant, in that virions can score positive in the FAB assay but either fail to replicate after a second round of infection or do so at a greatly reduced titer. It is probable that genomic DNA introduced after infection of FAB cells can be used as a template for transcription and translation of enough Tas to activate the LTR and produce ß-gal. Our results lead to the hypothesis that failure to cleave IN from the Pol precursor prevents at least one of the enzymatic activities of IN. Testing this hypothesis awaits the development of an in vitro integration assay for FVs. However, some of the CS mutants are more defective than the IN mutant in a single-round assay (Table 2). This suggests that IN activity as well as the reduced level of Pol packaging and PR and RT activity leads to the defects in replication of CS mutant viruses.
This work was supported by grant CA-18282 from the NIH to M.L.L. J.R. was partially supported by grant RO3013/1-1 from the DFG.
Published ahead of print on 7 March 2007. ![]()
|
|
|---|
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»