Previous Article | Next Article ![]()
Journal of Virology, January 2007, p. 68-73, Vol. 81, No. 1
0022-538X/07/$08.00+0 doi:10.1128/JVI.01267-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

,
Vyacheslav Shalak,
,
Mathilde Francin,¶ and
Marc Mirande*
Laboratoire d'Enzymologie et Biochimie Structurales, CNRS, 1 Avenue de la Terrasse, 91190 Gif-sur-Yvette, France
Received 15 June 2006/ Accepted 8 October 2006
|
|
|---|
|
|
|---|
The virally encoded reverse transcriptase requires a host cell RNA primer to initiate replication of the HIV-1 RNA genome. In retroviruses, the RNA primer is a tRNA. In HIV-1, the primer binding site is complementary to the 3'-end 18 nucleotides of tRNA3Lys. The two RNA molecules form an extended template/primer complex, and in HIV virions, the tRNA is believed to be bound to the complementary primer binding site (14). Accordingly, tRNA3Lys is incorporated into HIV-1 particles (17). The other tRNALys isoacceptors, tRNA1,2Lys, are also found in the virions. Indeed, the specificity of tRNA packaging is believed to be due to the selective incorporation of host lysyl-tRNA synthetase (LysRS) within virions (4). Interestingly, decreasing cellular expression of LysRS with small interfering RNA reduced tRNALys packaging and reduced viral infectivity (12). The current model for the selective packaging of the LysRS-tRNALys complex involves the formation of a packaging complex with the two viral proteins Gag and Gag-Pol (16).
Hamster and human LysRS share 43% identical residues with bacterial LysRS (1, 26) but display N-terminal polypeptide extensions that provide the core synthetases with potent tRNA-binding capacities (9, 10). This N-terminal tRNA-binding domain is required for triggering tRNALys packaging into human immunodeficiency virus type I viral particles (3). However, in mammalian cells, aminoacylation of cytoplasmic tRNALys is accomplished by an enzyme that is exclusively recovered as 1 of the 11 polypeptide components of MARS, a stable multiaminoacyl-tRNA synthetase complex (6, 22). One puzzling observation was that the other components of this complex were not detected in HIV-1 virions along with LysRS (4). One possibility is that newly synthesized LysRS may interact with Gag before it associates with other components of the multisynthetase complex (13). However, the interaction between LysRS and Gag is not highly specific, which led to the suggestion that other factors may contribute to the specificity (18). Alternatively, another LysRS species might be targeted to the virion.
Interestingly, human cytoplasmic and mitochondrial LysRSs are encoded by a single gene by means of alternative splicing (30). The two LysRS species share 576 identical amino acid residues. Thus, polyclonal antibodies directed to the cytoplasmic protein and used to identify the presence of LysRS in HIV-1 extracts (4) are likely unable to discriminate between the two LysRS species. Only the very N-terminal sequence of 21 or 49 amino acid residues, respectively, for the cytoplasmic and mitochondrial LysRS is distinct (Fig. 1). To uncover the cellular source of viral LysRS, we raised antibodies against synthetic peptides specific for the two LysRS species and analyzed the LysRS content of HIV-1 extracts. The results show that the mitochondrial enzyme is found in the viral particles and suggest that the mitochondrion-specific sequences of LysRS may contribute to the selectivity of its packaging.
![]() View larger version (42K): [in a new window] |
FIG. 1. The cytoplasmic and mitochondrial species of LysRS are encoded by the same gene. (A) The three first exons of the KARS gene are shown. Two distinct mRNA are produced by alternative splicing. The mRNA encoding cytoplasmic LysRS (cKRS) lacks exon 2. Premitochondrial LysRS (pmKRS) is translated from an ATG codon located in exon 3. (B) Alignment of the N-terminal amino acid sequences of cKRS from hamster (Cl), mouse (Mm), or human (Hs) and of pmKRS from mouse and human. The N-terminal sequence of pmKRS putatively removed during mitochondrial import is indicated by a plus sign. The peptide sequences used to raise antibodies specific for the cytoplasmic and mitochondrial species of human LysRS are indicated by dots. (C) Localization by confocal microscopy of cKRS and pmKRS. HeLa cells were cotransfected with pEGFP/cKRS or pEGFP/pmKRS and with pDsRed2-Mito plasmids, and localization of the fusion proteins was analyzed by confocal microscopy. The overlay shows a perfect colocalization of pmKRS and of the mitochondrial marker. DIC, differential interference contrast.
|
|
|
|---|
Extracts of HIV-1 particles. The purified particles of HIV-1 were obtained from Françoise Barré-Sinoussi (Institut Pasteur, Paris). The HIV-1 LAI strain was cultured on CEM cells (25). Viral particles were concentrated by polyethylene glycol precipitation, purified on a 20 to 50% sucrose gradient, and concentrated by ultracentrifugation (8). The protein concentration of the sample was 600 µg/ml. Total extracts were prepared by heating for 2 min at 100°C in 62.5 mM Tris-HCl (pH 7.5), 2% sodium dodecyl sulfate, 5 M urea, 100 mM dithiothreitol, and 0.002% bromophenol blue and kept frozen at 70°C. Aliquots of 10 µl were analyzed by Western blotting.
Isolation of mitochondria. U937 cells were grown in suspension in RPMI medium supplemented with 10% fetal calf serum (FCS). Subcellular fractionation of U937 cell extracts was conducted essentially as described previously (29). U937 cells (100 x 106 cells) were harvested by centrifugation at 600 x g for 10 min at 4°C, washed once with 10 ml of ice-cold phosphate-buffered saline and resuspended in 2 ml of buffer MitoA (20 mM HEPES-KOH [pH 7.5], 10 mM KCl, 1.5 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 250 mM sucrose, and 1 mM dithiothreitol). All subsequent steps were conducted at 4°C. After 10 min of incubation on ice, cells were pelleted at 600 x g, resuspended in 550 µl of buffer MitoA, and incubated for 10 min. Cells were lysed with 30 to 50 strokes of a Teflon homogenizer (Kontes) and diluted with 1 volume of buffer MitoA. The lysate was centrifuged at 750 x g for 10 min and then at 900 x g for 10 min to remove cell debris and nuclei. After another centrifugation at 5,500 x g for 10 min, the supernatant was recovered and centrifuged at 8,000 xg for 10 min to remove residual mitochondria, and the resulting supernatant was referred to as the cytoplasmic fraction. The pellet from the centrifugation at 5,500 x g, containing mitochondria, was resuspended with 0.5 ml of buffer MitoA, centrifuged at 5,500 x g for 10 min, resuspended with 0.5 ml of buffer MitoA, and centrifuged at 8,000 x g for 10 min. The resulting pellet was referred to as the mitochondrial fraction.
Expression of human LysRS in yeast. The cDNAs encoding the human cytoplasmic and mitochondrial forms of LysRS were introduced between the BglII and EcoRI sites of the yeast expression vector pYeDP10 (31) after PCR amplification with oligonucleotides GGGGAGATCTCATAATGGCGGCCGTGCAGGCGGCCGA, GGGGAGATCTCATAATGGCGACCT CCTGGGCAGAGTGGGGTCAC, and GGGGAATTCCTAGACAGAACTGCCAACTGTTG to give the recombinant plasmids pyHKc and pyHKm. Recombinant proteins are expressed under the control of the PGK promoter. Transformation of yeast and sporulation were performed as described previously (1).
Transient expression of human LysRS in HeLa cells. The cDNAs encoding the human mitochondrial and premitochondrial forms of LysRS were introduced between the BamHI and EcoRV sites of the pTRE2hyg vector (BD Biosciences). HeLa Tet-Off cells were grown in F12 medium supplemented with 10% fetal calf serum and were transfected with Effectene (QIAGEN). After transfection, at the times indicated, crude extracts were prepared and analyzed by Western blotting.
Confocal imaging. The cDNAs encoding the human cytoplasmic and premitochondrial forms of LysRS were introduced between the BglII and EcoRI sites of pEGFP-N1 (BD Biosciences) to give pEGFP/cKRS and pEGFP/pmKRS. HeLa cells were grown in F12 medium supplemented with 10% fetal calf serum. Cells were transfected with Effectene (QIAGEN). For localization experiments, cells were cotransfected with a pEGFP-N1 derivative and with pDsRed2-Mito (BD Biosciences). Cells were grown into eight-well Lab-Tek II chambers (Nalge Nunc International) and observed by confocal laser scanning microscopy using a Leica TCS SP2 confocal microscope.
|
|
|---|
The two human LysRS species, cyto-LysRS and mito-LysRS, were expressed in yeast. The diploid yeast strain CCdYK01 contains a wild-type and a TRP1-disrupted KRS1 allele (in Saccharomyces cerevisiae, KRS1 is an essential gene that encodes the cytoplasmic form of LysRS (19). A second gene, MSK1, encodes the mitochondrial species (11)). After transformation of CCdYK01 with the 2µ plasmid carrying URA3 and expressing cyto-LysRS or mito-LysRS, and sporulation, spores with the Trp+ and Ura+ phenotype were isolated. These spores corresponded to haploid strains bearing a disrupted allele of the yeast KRS1 chromosomal gene rescued by plasmid-encoded human LysRS. As shown in Fig. 2, LysRS could not be identified in these strains by using antibodies directed to the yeast enzyme. In contrast, antibodies directed to the cytoplasmic form of mammalian LysRS recognized both human cytoplasmic and mitochondrial LysRS species in the corresponding haploid strains. Thus, human cyto-LysRS or mito-LysRS can functionally replace the cytoplasmic yeast enzyme. Because cyto-LysRS and mito-LysRS were expressed at similar levels (see the corresponding polypeptides stained by Coomassie blue) and were equally recognized by Western blotting, anti-KRS antibodies could not discriminate between the two forms of LysRS.
![]() View larger version (61K): [in a new window] |
FIG. 2. Expression of human cyto-LysRS and mito-LysRS in yeast. Total extracts from the yeast diploid strain ccdYK or from the yeast haploid strains cdYKxpyHKm and cdYKxpyHKc, lacking the yeast KRS1 gene but complemented with human mito-KRS or cyto-KRS, respectively, were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and stained with Coomassie blue (left panel) or subjected to Western blotting using antibodies directed to yeast LysRS (IgG x yKRS) or raised against the full-length cytoplasmic LysRS of mammalian origin (IgG x KRS). The polypeptides corresponding to mito-LysRS and cyto-LysRS, visualized by Coomassie blue staining, are indicated by dots. MARS, the multi-aminoacyl-tRNA synthetase complex purified from rabbit containing cyto-LysRS (indicated by an arrow). *, a polypeptide cross-reacting with anti-yKRS antibodies.
|
![]() View larger version (32K): [in a new window] |
FIG. 3. Analysis of the specificity of antibodies raised against N-terminal peptides of cyto-LysRS and mito-LysRS from human. (a) The yeast extracts described in Fig. 2 were analyzed by Western blotting using antibodies directed to full-length LysRS (IgG x KRS) or to synthetic peptides specific for the mitochondrial (IgG x mKRS) or cytoplasmic (IgG x cKRS) form of human LysRS. (b) Total extracts from HeLa or U937 cells were analyzed by Western blotting using antibodies directed to synthetic peptides specific for the mitochondrial (IgG x mKRS) or cytoplasmic (IgG x cKRS) form of human LysRS or antibodies directed to full-length LysRS (IgG x KRS). mKRS, polypeptide corresponding to mito-LysRS; x, a polypeptide cross-reacting with IgG x mKRS. (c) Total extracts of HeLa Tet-Off cells transfected with pTRE2hyg vectors that overexpressed the premitochondrial (pmKRS) or mitochondrial (mKRS) form of LysRS were analyzed by Western blotting using antibodies directed to the synthetic peptide specific for mito-LysRS (IgG x mKRS). The extracts were prepared 8 h, 24 h, or 32 h after transfection. C, a control extract of HeLa Tet-Off cells prepared before transfection. Note that the intensity of the cross-reacting polypeptide (x) is independent of transfection of HeLa cells with plasmids that express different forms of mito-LysRS. (d) A total extract of U937 cells (U937) or the cytoplasmic (cyto) or mitochondrial (mito) fraction obtained after subcellular fractionation of a U937 cell extract was analyzed by Western blotting using antibodies directed to full-length LysRS (KRS) or to cytochrome c (CytC) or AspRS (DRS), used as markers of the mitochondrial and cytoplasmic compartments, respectively. Lanes "cyto" and "mito" contain equivalent amounts of the initial extract of U937 cells. Lane "mito x5" contains a fivefold excess of the "mito" fraction.
|
Extracts from HIV-1 contain the mitochondrial LysRS species. Human LysRS is incorporated into HIV-1 particles (4). We first verified that polyclonal antibodies directed to full-length cytoplasmic LysRS did cross-react with a polypeptide of appropriate size within an HIV-1 extract. As expected, a polypeptide similar in size to the LysRS component of MARS or to the polypeptides revealed in total cellular extracts of U937 or HeLa cells could be detected in the extract of purified HIV-1 particles (Fig. 4A, top panel). Polypeptides of smaller sizes were also observed and may correspond to degradation products of LysRS, an enzyme very sensitive to proteolysis (5). Earlier studies also reported the presence of LysRS species with various sizes in the viruses. These truncations also occurred in protease-negative viruses, suggesting that viral protease is not involved in this process (4). Because the cytoplasmic and mitochondrial species of LysRS observed after fractionation of U937 cell extract have very similar sizes, it was not possible to assign the signal obtained from the HIV-1 extract to either of these two forms.
![]() View larger version (36K): [in a new window] |
FIG. 4. Extracts from HIV-1 viral particles exclusively contain the mitochondrial LysRS species. (A) A total extract of purified HIV-1 particles (HIV) was analyzed by Western blotting using antibodies directed to full-length LysRS (IgG x KRS) or to synthetic peptides specific for the mitochondrial (IgG x mKRS) or cytoplasmic (IgG x cKRS) form of human LysRS. The HIV extract was analyzed along with MARS, with the total and mitochondrial fractions of a U937 cell extract, and with a total extract of HeLa cells that overexpressed mito-LysRS. x, the polypeptide cross-reacting with IgG x mKRS. (B) An HIV-1 extract was also probed with antibodies directed to cytochrome c (IgG x CytC).
|
|
|
|---|
Our results also provide a rational explanation for the absence of other aminoacyl-tRNA synthetases within HIV-1 particles. Whereas cyto-LysRS is a component of MARS, a stable multisynthetase complex containing eight other aminoacyl-tRNA synthetases (20), mito-LysRS is directed to the mitochondria, where the other components of this complex are not present. Indeed, most of the other mitochondrial species of aminoacyl-tRNA synthetases are encoded by genes that are distinct from their cytoplasmic counterparts (2). Interestingly, mito-LysRS shares with cyto-LysRS the eukaryote-specific tRNA-binding domain, referred to as a tIF (tRNA-interacting factor), that provides eukaryotic LysRS with potent tRNA-binding properties compared with the bacterial enzyme (9, 10). Mutational analysis identified residues K19, K23, R24, and K27 from the N-terminal polypeptide extension of cyto-LysRS as important for the binding of the tRNA molecule (10). The amino acid residues K23, R24, and K27 are common to mito- and cyto-LysRS (Fig. 1). The residue K19 is encoded by exon 1 and is embedded in the cytoplasm-specific sequence peptide. However, in the corresponding position of mito-LysRS, this lysine residue is replaced by an amino acid with a side chain displaying similar physicochemical properties, an arginine residue. Thus, the tIF of mito-LysRS should be equivalent to the tIF of cyto-LysRS. The conservation of the tIF domain is especially important for incorporation of tRNALys into HIV-1 virions, since the deletion of this domain in cyto-LysRS is accompanied by a lower efficiency in tRNA packaging (3).
In human cells, three isoforms of LysRS are produced from a single gene. Two mRNAs are transcribed by means of alternative splicing and are translated in the cytoplasm to give the cytoplasmic species (cyto-LysRS) and the precursor of the mitochondrial form of LysRS (premito-LysRS). Cyto-LysRS associates with the other components of the multisynthetase complex, MARS (20). The matured form of mito-LysRS is produced during importation into the mitochondria by cleavage of the N-terminal targeting sequence of premito-LysRS. Whether premito- and mito-LysRS or one of these two LysRS species is the source of viral LysRS remains to be deciphered. Whereas association of premito-LysRS with viral components may explain its direct targeting to the viral particle during the packaging process, the selection of mito-LysRS would first require its release from the mitochondria. The viral protein Vpr, which has been shown to alter the permeability of the mitochondrial membrane (15, 23) and has been found to interact with LysRS (28), might be involved in this process.
The finding that mito (or premito)-LysRS is the molecular species of LysRS that is specifically packaged into HIV-1 viral particles opens new routes for understanding the function of Vpr in the HIV-1 life cycle. In addition, the role of Gag and Gag-Pol in the packaging process of LysRS should be reexamined. It is now possible to look for viral proteins that may discriminate between the cyto- and mito- forms of LysRS.
This work was supported by grants from the "Centre National de la Recherche Scientifique" (CNRS), the "Agence Nationale de Recherches sur le SIDA" (ANRS), the "Association pour la Recherche sur le Cancer" (ARC), and "La ligue." M.K. was the recipient of postdoctoral fellowships from the "Fondation pour la Recherche Médicale" and "Association pour la Recherche sur le Cancer," and V.S. was the recipient of a postdoctoral fellowship from the "Agence Nationale de Recherches sur le SIDA."
Published ahead of print on 18 October 2006. ![]()
These authors contributed equally to this work. ![]()
Present address: Institut Pasteur, Unité de Régulation Enzymatique des Activités Cellulaires, 25 Rue du Docteur Roux, 75015 Paris, France. ![]()
Present address: Institute of Molecular Biology and Genetics, 150 Acad. Zabolotnogo Street, 03143 Kiev, Ukraine. ![]()
¶ Present address: INRA, Unité Biopolymères Interactions Assemblages, Rue de la Géraudière, 44316 Nantes Cedex 03, France. ![]()
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»