In Vivo Packaging of Brome Mosaic Virus RNA3, but Not RNAs 1 and 2, Is Dependent on a cis-Acting 3' tRNA-Like Structure

The four encapsidated RNAs of brome mosaic virus (BMV; B1, B2,B3, and B4) contain a highly conserved 3' 200-nucleotide (nt)region encompassing the tRNA-like structure (TLS) which is requiredfor packaging in vitro (Y. G. Choi, T. W. Dreher, and A. L.N. Rao, Proc. Natl. Acad. Sci. USA 99:655-660, 2002). To validatethese observations in vivo, we performed packaging assays usingAgrobacterium-mediated transient expression of RNAs and coatprotein (CP) (P. Annamalai and A. L. N. Rao, Virology 338:96-111,2005). Coexpression of TLS-less constructs of B1 or B2 or B3and CP mRNAs in Nicotiana benthamiana leaves resulted in packagingof TLS-less B1 and B2 but not B3, suggesting that packagingof B3 requires the TLS in cis. This conjecture was confirmedby the efficient packaging of a B3 chimera in which the viralTLS was replaced with a cellular tRNA^Tyr. When N. benthamianaleaves were infiltrated with a mixture of transformants containingwild-type B1 (wtB1) plus wtB2 plus a TLS-less B3 (wtB1+wtB2+TLS-lessB3),the 3' end of progeny B3 was restored by heterologous recombinationwith that of either B1 or B2. This intrinsic cis-requirementof TLS in promoting B3 packaging was further confirmed whena mixture containing agrotransformants of TLS-less B1+B2+B3was supplemented with either wtB4 or a 3' 200-nt or 3' 336-ntuntranslated region (UTR) of B3. Northern blot analysis followedby sequencing of B3 progeny revealed that replication of TLS-lessB3, but not TLS-less B1 or B2, was fully restored due to recombinationwith TLS from transiently expressed wtB4 or the B3 3' UTR. Collectively,these observations suggested that the requirement of a cis-actingTLS is distinct for B3 compared with B1 or B2.

INTRODUCTION

Top

INTRODUCTION

Purified virions of brome mosaic virus (BMV), the prototypeof the plant virus family Bromoviridae (38), contain four single-stand,positive-sense RNAs. Among these, the largest three RNAs aregenomic (gRNA) and the fourth is subgenomic (sgRNA). BMV replicationis dependent on efficient interaction between two nonstructuralproteins, 1a and 2a, encoded by monocistronic gRNA1 (B1) andgRNA2 (B2), respectively (28). Nonstructural protein 1a (109kDa) contains a methyltransferase/guanyltransferase domain inits N-terminal half and a helicase domain in its C-terminalhalf, while nonstructural protein 2a (94 kDa) contains a centralpolymerase-like domain (28). The third gRNA3 (B3) encodes a5' nonstructural movement protein (MP) of 32 kDa and a 3' capsidprotein (CP) of 20 kDa. Only the 5' proximal MP gene, not the3' proximal CP gene, is translated directly from B3. Instead,the CP is translated from an sgRNA (sgB4), which is synthesizedby internal initiation on minus-strand progeny of B3 (31). Thetwo gene products encoded by the dicistronic B3 are dispensablefor viral replication but are required for infection of wholeplants (33, 47). All four RNAs contain a highly conserved 3'200-nucleotide (nt) sequence and assume a tRNA-like structure(TLS) (19, 21). The TLS has been shown to be multifunctionalsince it not only harbors recognition signals for viral replicaseto initiate minus-strand synthesis (20) but also mimics severaltRNA-associated activities such as aminoacylation or interactionwith nucleotidyltransferase (21). In addition, the TLS alsoserves as a 3' telomere by recruiting the tRNA-specific hostCCA nucleotidyltransferase to maintain intact 3' CCA termini(27, 41).

BMV is a T=3 icosahedral virus (29) composed of 180 identicalprotein subunits (29, 49). Based on physical and biochemicalanalysis of BMV virions, it was hypothesized that genomic B1and B2 are packaged independently into two virions whereas genomicB3 and the sgB4 are copackaged into a third virion (39). Thesethree virion populations are physically and morphologicallyindistinguishable. The mechanism by which the CPs regulate thisbalanced distribution of four BMV RNAs into three individualvirions remains elusive. However, the ability to reassemblevirions in vitro from the dissociated CP and RNA allowed theidentification of RNA sequences required for packaging. A seriesof in vitro assembly assays performed in our laboratory (13)demonstrated (i) that BMV genomic and sgRNAs lacking the 3'TLS failed to assemble in vitro into virions and this defectiveassembly could be rescued by the addition of a 3' 201-nt sequenceencompassing the viral TLS to the assembly mixture; (ii) thattRNAs of wheat germ and yeast supplied in trans were similarlyactive in promoting the assembly of truncated BMV RNAs intovirions; and (iii) that virions assembled from truncated BMVRNAs in the presence of cellular tRNAs or viral TLS did notincorporate the latter molecules. Based on these observations,it was hypothesized that the highly conserved 3' TLS servesas a chaperone, in a transient association with virion CP, functioningas nucleating element (NE) to initiate the assembly of viralRNA into BMV virions.

In order to validate these in vitro findings in vivo and toanalyze the extent to which the tRNAs of cellular and viralorigin contribute toward the packaging of the four BMV RNAs,in this study we employed an efficient in vivo transient expressionsystem that has proven to be ideal for dissecting replicationfrom packaging (5). The results of this study indicated thata cis-acting TLS element of viral origin is obligatory for packagingB3 but not B1 or B2. The importance of this differential requirementby the tRNA elements in RNA packaging is discussed.

MATERIALS AND METHODS

Top

MATERIALS AND METHODS

Wild-type BMV transformants for agroinfiltration. The construction and characterization of transfer DNA (T-DNA)-basedplasmids for transient expression of full-length BMV genomicRNAs 1 (35S-B1), 2 (35S-B2), and 3 (35S-B3) and the CP mRNA(35S-B4.1) were described previously (5). Each plasmid contains,in sequential order, a double 35S promoter, cDNA complementaryto the respective full-length BMV RNAs, ribozyme (RZ) sequence,and 35S terminator (Fig. 1A).

View larger version (48K):
[in this window]
[in a new window]

FIG. 1. (A) Characteristics of T-DNA plasmids (agrotransformants) harboring BMV genomic RNAs used for Agrobacterium-mediated transient expression in plants. The 35S-B1, 35S-B2, and 35S-B3 constructs contain full-length cDNA copies of BMV genomic RNAs 1 (B1), 2 (B2), and 3 (B3), respectively (5). Filled arrows at the 5' end represent the double 35S promoter (35S) whereas open boxes at the 3' indicating RZ and T, indicate, respectively, the ribozyme sequence cassette derived from satellite tobacco ring spot virus and the 35S-polyadenylation terminator signals. The bent arrow represents the ribozyme cleavage site. The lengths of wt BMV RNAs and the number of nonviral nucleotides left after self-cleavage by ribozyme (shown in bracket) are indicated. (B) Characteristics of agrotransformants of BMV genomic RNAs lacking the 3' TLS ( ${Delta}$ TLS). All other features are same those described for panel A. (C) Characteristic features of sgB4 agrotransformants of wild-type (35S-B4.1) and TLS-less (35S-B4.1/ ${Delta}$ TLS) constructs used for transient expression studies. Agrotransformants 35S-B3/TLS and 35S-B3/3'UTR were designed, respectively, to express either the 3' 200-nt region or the entire 3' UTR. All other features are same those described for panel A. (D) Transient expression and packaging in plants of individual BMV RNAs. N. benthamiana leaves were infiltrated with indicated Agrobacterium cultures, and the total and virion RNAs recovered 4 days postinfiltration were subjected to Northern blot hybridization. Approximately 5 µg of total nucleic acid preparations from agroinfiltrated leaves or 0.5 µg of virion RNA was denatured with formamide-formaldehyde and subjected to 1.2% agarose electrophoresis prior to vacuum blotting to a nylon membrane. The blot was then hybridized with ³²P-labeled riboprobes complementary to the homologous 3' TLS present on all four BMV RNAs (3' TLS probe). The position of all four BMV RNAs is shown to the right of each panel. Marker lane B123 represents wt BMV virion RNA recovered from leaves infiltrated with a mixture containing all three wt BMV RNAs. (E) Transient expression and packaging of TLS-less BMV RNAs. The conditions of agroinfiltration and Northern blot analysis of total and virion RNAs are as described above. The blots were hybridized with either a ³²P-labeled 3' TLS probe or a mixture of riboprobes specific for each of the three genomic RNAs (B1-, B2-, and B4-specific RNAs) (15). Note that since the entire sequence of B4 is present in the 3' half of B3, riboprobe complementary to the CP ORF sequences (referred to as B4 probe) would detect both B3 and B4. Conditions of hybridization are as described previously (5). The position of four BMV RNAs is shown to the right. wt BMV virion RNA was used as a size marker. For Western blot analysis, total protein extracts from leaves agroinfiltrated independently with the indicated mixture of agrotransformants were fractionated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to polyvinylidene difluoride membrane, and probed with antibodies prepared against purified BMV (35).

Construction of TLS-less BMV genomic and sgRNA agrotransformants. To construct TLS-less agrotransformants of B1 (B1/ ${Delta}$ TLS), B2 (B2/ ${Delta}$ TLS),and B3 (B3/ ${Delta}$ TLS) (Fig. 1B), sequence cassettes lacking the 3'TLS sequence were amplified by PCR with the 5' primers d(CGACTCACTGCAGTAGACCACGGAACGAGG)(PstI site is underlined), d(CGACTCACTTACGTAAACCACGGAACGAGG)(SnaBI site is underlined), and d(CGACTCACTTACGTAAAATACCAACTAATT)(SnaBI site is underlined), respectively, for B1, B2, and B3,and the 3' reverse primer d(GTTATAGCACGGATCCAGCTAGTCTTG) (BamHIsite is underlined) for B1 and d(TATCAGTTATTGTACGGATCCAACAAGC)(BamHI site is underlined) for B2 and B3. The resulting productswere digested with either PstI (for B1) or SnaB1 (for B2 andB3), treated with T4 DNA polymerase to create blunt-ended products,digested with a commonly shared BamHI, and finally subclonedinto pCASS4-RZ vector as SnaBI-BamHI fragments (5). For constructingTLS-less B4.1 (B4.1/ ${Delta}$ TLS), a 200-nt region (encompassing the3' TLS) located between restriction sites HindIII and BamHIwas excised by digesting the 35S-B4.1 (5) with these two enzymes,and the gel-purified largest fragment was blunt-ended with T4DNA polymerase, ligated, and transformed. The resulting construct35S-B4.1 ${Delta}$ TLS contains, in sequential order, a double 35S promoter,tobacco etch virus enhancer element, BMV RNA4 sequence, anda 35S terminator (Fig. 1C).

Construction of plasmid 35S-B4 ${delta}$ . A variant of pCASS4-RZ (5) was constructed to substitute thetobacco ringspot ribozyme with hepatitis delta virus ribozymein PCR using a forward primer d(AGGGAATTCGGTACCCCATGGGGTCGGCATGGCATCTC)(boldface and underline sequences, respectively, represent KpnIand NcoI sites) and reverse primer d(GCTCGGTACGAGCTCTCCTGGCTCTCCCTTAGC)(SacI site is underlined). The resulting fragment was digestedwith KpnI and SacI and ligated into similarly treated pCASS4-RZ,yielding pCASS4-HDV ${delta}$ . Full-length wild-type (wt) B4 sequencewas amplified in a PCR using a forward primer d(TGTCCTAATTCTACGTATTAATAATGTC)(SnaBI is underlined) and reverse primer d(ACACACACCATATGGTCTCTTTTAGAG)(NdeI site is underlined). The resulting product was digestedwith NdeI and blunt ended with mung bean nuclease, followedby digestion with SnaBI, and it was then subcloned into pCASS4-HDV ${delta}$ previously digested with StuI/NcoI and blunt ended with mungbean nuclease.

Construction of plasmid 35S-TLS²⁰⁰ and 35S-UTR³³⁶. Plasmid 35S-B4.1 was digested with either HindIII/BamHI to releasethe 3' 200-nt region encompassing the TLS region or StuI/BamHIto release the 3' 336-nt region encompassing the entire untranslatedregion (UTR). Each fragment was gel purified, blunt ended withT4 DNA polymerase, and ligated into similarly treated pCASS4-RZvector as described above.

Construction of plasmid 35S-B3^Tyr. To replace the 3' TLS with cellular tRNA^Tyr in B3, a two-stepPCR procedure was used. In the first-round PCR, 3' TLS (200nt) was precisely replaced with a 68-nt sequence complementaryto cellular tRNA^Tyr by amplifying a 585-nt fragment using the5' primer d(TGGGAGGCGTCTTCGGAC) (located between nucleotidepositions 1410 to 1427 of the CP open reading frame [ORF]) anda 3' reverse primer d(TTTTGGATCCTGGTCCGACCTACCGGATTCGAACCAGTGACCTAAGGATCTACAGTCCTCCGCTCTACCAACTGAGCTAAGGTCGGTGTCAACCACGACTATCAGT)(BamHI site is underlined and italicized bases denote sequencecomplementary to the CP ORF sequence located between positions1941 to 1961, and other bases represent a complementary sequenceto cellular tRNA^Tyr). During a second-round PCR this 585-ntfragment and the cDNA of wt B3 clone (pT7B3) (22) were usedas templates along with a forward 5' primer for B3, d(CGACTCACTTACGTAAAATACCAACTAATT)(SnaBI site is underlined), and the 3' reverse primer shownabove. The resulting 1,985-nt fragment was digested with SnaBIand BamHI and ligated into StuI/BamHI-treated pCASS4-RZ vector(5). The authenticity of all genetically engineered clones wasconfirmed by restriction analysis followed by sequencing.

Agroinfiltration. The agroinfiltration procedure was performed as previously described(2). Briefly, Agrobacterium strain EHA105 containing the desiredtransformant was initially streaked on an LB plate containingthe antibiotics kanamycin (50 µg/ml) and rifampin (10µg/ml) and incubated at 28°C. A single colony wasinoculated into a 2 ml of LB medium with the above antibioticsand grown at 28°C for 48 h with vigorous shaking. One milliliterof the culture was transferred to 50 ml of LB medium containingthe above antibiotics, 10 mM MES (morpholineethanesulfonic acid),pH 5.6, and 40 µM acetosyringone. After incubation at28°C for 16 h with vigorous shaking, the optical densityat 600 nm of the culture reached 1.0. The bacteria were spundown at 2,000 x g for 10 min, the pellet was resuspended in50 ml of 10 mM MgCl₂, and then 125 µl of 100 mM acetosyringonewas added. To maintain a uniform concentration of Agrobacteriumin coinfiltration experiments involving two or more Agrobacteriumcultures, the optical density at 600 nm of each culture wasadjusted to 1.0, and equal volumes of desired bacterial cultureswere mixed. The mixture was kept at room temperature for atleast 3 h without shaking. These mixtures were infiltrated intothe abaxial surface of the fully expanded Nicotiana benthamianaleaves using a 1-ml syringe without a needle.

Progeny analysis and packaging assays. Total RNA from agroinfiltrated leaves was extracted using thehot phenol method (5), and the RNA pellet was suspended in RNase-freewater. RNase-resistant virions were purified from agroinfiltratedleaves as described previously (42). For Northern blot analysis,samples of virion RNA (0.5 µg) or plant total RNA (5 µg)were dried in a microcentrifuge tube, suspended in 10 µlof sample buffer (10x MOPS [morpholinepropanesulfonic acid]buffer-formamide-formaldehyde-H₂O in a ratio of 1:1.8:5:2.2,respectively), heated at 65°C for 10 min, and electrophoresedin 1.2% agarose-formaldehyde gel (46). In all Northern blots,total RNA and virion RNA recovered from leaves infiltrated witha mixture containing agrotransformants of all three wt BMV RNAs(referred to as B123) were used as markers. Following a 3-helectrophoresis, fractionated RNA was transferred to a nylonmembrane with a VacuGene XL blotting unit (Pharmacia Biotech).The blot was then processed for prehybridization and hybridizationusing ³²P-labeled riboprobes corresponding to either the 3'conserved region (41), the MP ORF, the CP ORF, or sequencesspecific for B1 and B2 as described previously (14). CP sampleswere analyzed by Western blotting as described previously (35).Reverse transcription-PCR (RT-PCR) was performed using eithervirion or total RNA progeny recovered from several independentlyinfiltrated leaf samples and the desired set of forward andreverse primers complementary to the B3 sequence using an AccessQuickRT-PCR system according to the manufacturer instructions (Promega,Wisconsin), and the product was sequenced.

RESULTS

Top

RESULTS

In vivo packaging of TLS-less BMV genomic RNAs. In the absence of sustained replication, mechanical inoculationsof individual BMV gRNA transcripts are hard to detect, mainlydue to our inability to control the amount of inoculum thatenters each cell. T-DNA vectors harboring viral genes were deliveredinto plant cells via Agrobacterium and remained transientlyin the nucleus, leading to high-level expression of mRNAs forseveral days even in the absence of sustained replication (5,26). Furthermore agroinfiltration offers synchronized deliveryof multiple transformants to the same cell, a trait particularlyuseful for dissecting replication from packaging (5, 30). Consequentlythis approach allowed us to demonstrate that coexpression ofCP mRNA and either B1, B2, or B3 in a replication-independentmode resulted in the assembly of RNA containing virions fromtransiently expressed CP subunits (5). Furthermore, we alsodemonstrated that transiently expressed B1 ${Delta}$ TLS and B2 ${Delta}$ TLS RNAsare competent for efficient packaging by the CP subunits translatedfrom transiently expressed CP mRNA (5). Since packaging in vitroof B1 and B2 requires the TLS or cellular tRNAs functioningas nucleating agents (13), the efficient packaging of B1 ${Delta}$ TLSand B2 ${Delta}$ TLS in these in vivo assays can be attributed to transcomplementation of the required function by either B4 TLS orcellular tRNAs (5).

To further unravel this issue and to compare the relative packagingefficiencies of B3 and B3 ${Delta}$ TLS, N. benthamiana leaves were coinfiltratedwith Agrobacterium transformants of B4.1 and either B1 ${Delta}$ TLS, B2 ${Delta}$ TLS,or B3 ${Delta}$ TLS (Fig. 1B). Plants infiltrated with B4.1 and eitherB1, B2, or B3 served as controls. Total and virion RNA preparationsisolated from infiltrated leaves were subjected to Northernhybridization. Efficient packaging into virions of individualwt BMV RNAs by the transiently expressed CP was observed inleaves infiltrated with control transformants (Fig. 1D). Similaranalysis of leaves agroinfiltrated with transformants of B1 ${Delta}$ TLS,B2 ${Delta}$ TLS, or B3 ${Delta}$ TLS resulted in efficient expression and accumulationof the respective truncated RNAs, and the absence of the 3'TLS in each RNA component was confirmed by hybridization withprobes specific for B1, B2, or B3 but not with the 3' TLS probe(Fig. 1E, top and middle blots). Despite efficient levels ofCP expression in each sample (refer to Western blot shown inFig. 1E), Northern blot analysis of virion RNA showed detectablelevels of B1 ${Delta}$ TLS and B2 ${Delta}$ TLS but not B3 ${Delta}$ TLS (Fig. 1E, bottom blot).

Previous in vitro RNA packaging assays demonstrated that efficientassembly of BMV gRNAs into virions requires the 3' TLS and thatthe defective packaging exhibited by TLS-less BMV gRNA can becomplemented in trans by tRNAs of cellular origin (13). Consequently,the packaging of B1 ${Delta}$ TLS and B2 ${Delta}$ TLS observed in the above experimentas well as similar results from other studies (4, 5) could havebeen due to trans complementation with either cellular tRNAsor the TLS present on CP mRNA.

Effect of cis-acting cellular tRNA^Tyr on B3 packaging. Contrary to in vitro packaging assays where the defective packagingof B3 ${Delta}$ TLS could be rescued in trans by cellular tRNAs (13), transientlyexpressed B3 ${Delta}$ TLS failed to get encapsidated by the CP subunits(Fig. 1E). To verify whether B3 packaging in vivo requires theTLS in cis, a 68-nt sequence encompassing the cellular tRNA^Tyr(Fig. 2A) was substituted for a 200-nt sequence of the 3' TLS(Fig. 2A). Since BMV RNAs are specifically aminoacylated withtyrosine (21), cellular tRNA^Tyr was selected. Furthermore, inorder to produce B4 with authentic 5' and 3' ends, another agrotransformantreferred to as 35S-B4 ${delta}$ (Fig. 1B) was constructed. In this construct,a self-cleaving ribozyme from hepatitis delta virus (37) wasengineered such that the de novo synthesized RNA transcriptsterminate correctly with a natural 3' CCA sequence. Northernblot analysis of N. benthamiana leaves infiltrated with 35S-B4 ${delta}$ revealed the accumulation of a single, discrete transcript ofB4 ${delta}$ mRNA identical to wt B4 (Fig. 2C), and Western blot analysis(Fig. 2C) confirmed its ability to translate BMV CP subunits.

View larger version (52K):
[in this window]
[in a new window]

FIG. 2. (A) Schematic representation of secondary structure of the 3' 200-nt TLS of BMV RNA3 and 75 nt of cellular tRNA^Tyr. (B) Characteristics of T-DNA construct of sgB4 (35S-B4 ${delta}$ ) used for transient expression with authentic 5' and 3' termini. In 35S-B4 ${delta}$ , the position of the hepatitis delta ribozyme ( ${delta}$ ) is shown. All other features are same those described in the legend of Fig. 1A. Viral and nonviral nucleotide sequences located at the 3' end are shown by upper- and lowercase, respectively, and the bent arrow represents the ribozyme cleavage site. (C) Packaging competence in vivo of B3 ${Delta}$ TLS and B3^Tyr by transiently expressed CP subunits. N. benthamiana leaves were infiltrated with indicated mixtures of Agrobacterium cultures, and the total and virion RNAs recovered were subjected to Northern hybridization with the indicated riboprobes as described in the legend of Fig. 1D. Marker lane B123 represents wt BMV virion RNA recovered from leaves infiltrated with a mixture containing all three wt BMV RNAs. Western blot analysis of viral CP was performed as described in the legend of Fig. 1D. The positions of B3 and B4 are shown to the right. (D) Packaging efficiency of B3 ${Delta}$ TLS and B3^Tyr. The Northern blots shown in panel C were subjected to quantitation by a Typhoon 9410 PhosphoImager using wt B3 and B4 as internal standards. Histograms represent the relative accumulation of respective total RNA (TR) and virion RNA (VR) for either wt B4 (B4 ${delta}$ ), wt B3 (B3), B3^Tyr, or B3 ${Delta}$ TLS.

N. benthamiana leaves were infiltrated with agrobacterium culturescontaining a mixture of B4 ${delta}$ and B3^Tyr. Leaves infiltrated withB4 ${delta}$ or with B4 ${delta}$ and B3 (B4 ${delta}$ +B3) or B4 ${delta}$ +B3 ${Delta}$ TLS served as controls.Results of Northern blot hybridization of total and virion RNAsrecovered from agroinfiltrated leaves are shown in Fig. 2C,and the relative packaging efficiency of each B3 variant isquantitatively shown in the histogram (Fig. 2D). In leaves infiltratedwith either B4 ${delta}$ alone or B4 ${delta}$ +B3, most of the transiently expressedRNAs were packaged (Fig. 2C, lanes 1 and 2). However, in leavesinfiltrated with B4 ${delta}$ +B3^Tyr, packaging of B3^Tyr and B4 was partiallyrestored (Fig. 2C, lane 3). By contrast, in leaves infiltratedwith B4 ${delta}$ +B3 ${Delta}$ TLS, none of the transiently expressed RNAs were foundto be packaged. Collectively, these observations suggested that(i) TLS when present in cis has profound influence on packagingand (ii) efficient packaging prefers homologous TLS over cellularTLS.

Requirement of a cis-acting, homologous TLS for packaging selects for biologically active B3 recombinants. From the results of encapsidation assays of three TLS-less BMVRNAs by the CP subunits expressed in trans (Fig. 1 and 2), itis evident that, unlike B1 and B2, B3 requires a TLS in cis.To further address this issue, two independent agroinfiltrationassays were performed. In the first assay, each agrotransformantof B1 ${Delta}$ TLS, B2 ${Delta}$ TLS, or B3 ${Delta}$ TLS was mixed with wild-type counterpartsand infiltrated into N. benthamiana leaves. The results of Northernhybridization analysis are summarized in Fig. 3. In leaves infiltratedwith either B1 ${Delta}$ TLS (Fig. 3, lanes 1 and 4), B2 ${Delta}$ TLS (Fig. 3, lanes2 and 4), or B1 ${Delta}$ TLS and B2 ${Delta}$ TLS (Fig. 3, lane 4) along with thewt counterparts, the engineered deletion was conserved in eachcase (Fig. 3). Deletion of the TLS either in B1 or B2 couldstill provide a sufficient amount of viral replicase proteinfor the replication of B3 and transcription of B4 (Fig. 3, lanes1, 2, and 4). By contrast, infiltration of the inoculum containingwt B1 and B2 and B3 ${Delta}$ TLS also resulted in the synthesis of sgB4,and restoration of the 3' TLS in B3 was confirmed by hybridizationwith riboprobes specific for the 3' region (Fig. 3, lane 3).Furthermore, the migration of the progeny B3 and sgB4 was slightlyslower than the wild type. Since the 3' TLS also functions asa minus-strand promoter (20), the origin of the TLS region ofB3 must be either from B1 or B2 and involve homologous or heterologousrecombination. To verify this assumption, the 3' end of B3 progenywas subjected to RT-PCR, followed by sequencing. Two groupsof recombinants were identified (Table 1). The first group wascharacterized by having 230 nt from B1 while the other had 306nt from B2, based on the diagnostic nucleotide specific foreach 3' end (43). Within the 3' 200-nt region, B3 can be distinguishedfrom B2 by a single base substitution of G at position 43; B1can be distinguished from B2 and B3 by 11 additional base substitutions(43). The nucleotide sequence in each BMV RNA, upstream to the3' TLS region, is heterologous. Since B3 ${Delta}$ TLS was characterizedby precise deletion of a 3' 200-nt region, recovery of B3 progenywith a 3' sequence having an extra 30 nt and 106 nt in the firstand second group of recombinants, respectively (Table 1), suggestedthat the restoration of the 3' end involved heterologous recombination.

View larger version (35K):
[in this window]
[in a new window]

FIG. 3. In vivo expression and packaging competence of each of the three replication-defective BMV RNAs. N. benthamiana leaves were infiltrated with indicated mixtures of Agrobacterium cultures (lanes 1 through 5), and the total and virion RNAs recovered were subjected to Northern hybridization with the indicated set of riboprobes. Marker lane B123 represents wt BMV virion RNA recovered from leaves infiltrated with a mixture containing all three wt BMV RNAs.

View this table:
[in this window]
[in a new window]

TABLE 1. Characteristics of recombinant B3 progeny

In the experiments described above B3 acquired TLS from replication-competentwt B1 and B2. To verify whether TLS provided in trans as a nonreplicatedtemplate can be used as a substrate for recombination, an inoculumcontaining a mixture of all three BMV RNAs lacking the 3' TLSwas infiltrated, and progeny were analyzed by Northern hybridization(Fig. 4). Hybridization with a riboprobe complementary to the3' TLS failed to detect any RNA, while hybridization with riboprobesspecific for each of the three BMV RNAs detected, albeit atlow levels, B1 and B2 but not B3 (Fig. 4). Interestingly, whenan agrotransformant of sgB4 was complemented, accumulation ofB3 and sgB4 RNAs in total nucleic acid preparations was evidentin hybridization assays identical to those performed above (Fig.4). These observations suggested that once again the 3' endwas restored for B3 but not for B1 or B2. Hybridization of virionRNA confirmed the encapsidation of B1 ${Delta}$ TLS, B2 ${Delta}$ TLS, and the newlygenerated progeny of B3 and sgB4 (Fig. 4). Unlike in the previousexperiment (Fig. 4), neither B1 nor B2 had the 3' TLS. Therefore,the only source to provide the 3' TLS was the transiently expressedB4.1 mRNA. Sequence analysis confirmed that the progeny B3 acquiredthe 3' TLS region from transiently expressed B4.1 mRNA by homologousrecombination (Table 1). Since the entire sequence of sgB4 iscontained within the 3' half of gRNA3, it is difficult to determinethe crossover sites involved in recombination. Agroinfiltrationexperiments similar to these were also performed with B3^Tyr.Since B3^Tyr cannot be recognized by the viral replicase, detectionof sgRNA4 in leaves infiltrated with B1 ${Delta}$ TLS+B2 ${Delta}$ TLS+B3^Tyr+B4.1suggested that the 3' end of B3^Tyr was replaced by a functional3' TLS (data not shown). Subsequent cloning of progeny B3 andsequencing confirmed that homologous recombination with the3' end B4.1 (the only 3' TLS sequences available) rendered abiologically active B3 (Table 1). Once again, because the 3'halves B3 and B4 are identical, it is difficult to preciselymap the crossover sites involved in recombination.

View larger version (44K):
[in this window]
[in a new window]

FIG. 4. (A) Restoration of the deleted 3' TLS of B3. N. benthamiana leaves were infiltrated with indicated mixtures of Agrobacterium cultures and the total (T) and virion (V) RNAs recovered were subjected to hybridization with the indicated set of riboprobes as described in the legend of Fig. 1D. Note that detection of sgB4 in total and virion RNAs indicates restoration of a functional 3' end in B3. In each blot, marker lane B123 represents wt BMV virion RNA recovered from leaves infiltrated with a mixture containing all three wt BMV RNAs.

Transiently expressed 3' TLS or 3' UTR sequences serve as efficient substrates for recombination. Results of the experiments presented above suggested that presenceof a homologous TLS offers a convenient way to restore the biologicalactivity of B3. However, in these experiments the homologousTLS was present either on B1 or B2 (Fig. 3) or on B4 (Fig. 4).The question that remains to be addressed is whether transientlyexpressed sequences encompassing only the 3' TLS can functionas efficient substrates for recombination. To address this question,two constructs amenable for transient expression of the 3' TLSsequence were designed. Constructs 35S-TLS²⁰⁰ and 35S-UTR³³⁶(Fig. 1C), respectively, direct the transcription of an RNAsequence encompassing the 3' 200 nt and the 3' 336 nt of theentire B3 3' UTR.

A mixture of agrotransformants containing all three BMV RNAslacking the 3' TLS were complemented with either TLS²⁰⁰ or UTR³³⁶,infiltrated into the leaves of N. benthamiana, and the progenyin total and virion RNA preparations was analyzed by Northernhybridization (Fig. 5). Plants infiltrated with a mixture ofall three BMV RNAs lacking the 3' TLS served as negative controls.As observed in previous experiments (Fig. 1 to 4), the fastermigration pattern of RNAs corresponding to B1 and B2 suggestedthat the engineered TLS deletion was conserved. By contrast,transcripts of B3 lacking the 3' TLS were not detected. Sincetranscripts of B1 ${Delta}$ TLS and B2 ${Delta}$ TLS are packaged by the transientlyexpressed CP (Fig. 5, lane 1), they are protected from degradationby host nucleases whereas the transcripts of B3 ${Delta}$ TLS are not.This explains why the transcripts of B3 ${Delta}$ TLS are not detected(Fig. 5, lane 1). Similar observations were reported previouslywith nonreplicating or inefficiently replicating BMV RNA3 variants(1, 4). By contrast, efficient accumulation and detection ofsgB4 in samples complemented with either TLS²⁰⁰ or UTR³³⁶ suggestedthat the 3' end of the B3 ${Delta}$ TLS progeny was restored, permittingB3 to enter replication. This restoration of the cis-acting3' TLS allowed B3 to package efficiently (Fig. 5, lanes 2 and3). Sequence analysis once again confirmed that transientlyexpressed RNAs of TLS²⁰⁰ or UTR³³⁶ served as substrates forviral replicase to mediate homologous recombination (Table 1).

View larger version (39K):
[in this window]
[in a new window]

FIG. 5. Evidence for restoration of a functional viral TLS in B3 by recombination with transiently expressed 3' end sequences. N. benthamiana leaves were infiltrated with the indicated mixtures of Agrobacterium cultures (lanes 1 through 4), and the total and virion RNAs recovered were subjected to Northern hybridization with a mixture of riboprobes specific for B1, B2, and B4 as described in the legend of Fig. 1D. Detection of sgB4 in total and virion RNAs indicates restoration of a functional 3' end in B3. Note that in the first lane, the absence of the TLS in the inoculum failed to restore the 3' end while packaging of B1 ${Delta}$ TLS and B2 ${Delta}$ TLS was not affected. In each blot, marker lane B123 represents wt BMV virion RNA recovered from leaves infiltrated with a mixture containing all three wt BMV RNAs.

DISCUSSION

Top

DISCUSSION

The rationale for this study emerged from three sets of independentobservations concerning BMV packaging. First, the highly conserved3' TLS of BMV RNA not only functions as a promoter to initiateminus-strand synthesis by viral replicase (20, 27) but is alsoobligatory for promoting packaging of all four BMV RNAs in vitro(13). Despite association with these two intrinsic processes,deletion of the 3' TLS in B1 and B2 was preserved in agroinfiltratedleaves (5). Second, our recent observations that copackagingof sgB4, the mRNA for CP translation, is replication contingentimplies that, unlike B1 and B2, B3 must preserve its 3' endsince synthesis of sgB4 occurs only if B3 enters the replicationcycle (32). Results from a series of agroinfiltration experimentsdesigned to clarify the discriminative role of viral TLS inthis study revealed that the packaging requirement of the 3'TLS for B3 is distinct from that of B1 and B2. Furthermore theneed for a cis-acting TLS not only to function as a minus-strandpromoter (20) but also to participate in packaging (16) selectsfor biologically functional B3 recombinants (Fig. 3 to 5). Takentogether, the data indicate that a cis-acting TLS is obligatoryfor direct packaging of B3 but not B1 and B2.

Role of viral TLS in packaging BMV genomic RNAs. Previous in vitro assembly assays showed that the 3' TLS isobligatory for packaging of all four BMV RNAs, and the functioncan be complemented in trans either by viral TLS or cellulartRNAs (13). Despite this intrinsic requirement, TLS-less B1and B2 are efficiently packaged in vivo (Fig. 1 and 3). Thiscan be because of trans complementation by cellular tRNAs orbecause their packaging in vivo is independent of TLS. In contrastto B1 and B2, the requirement of TLS appears to be distinctfor B3. A cis-acting TLS is required for B3 to perform two importantroles. First, B3 functions as a minus-strand promoter. In BMV,synthesis of multifunctional CP is linked to replication ofB3 since sgRNA is synthesized only from minus-strand B3 progenyby internal initiation (24, 48). Second, TLS plays an importantrole in RNA packaging. In vitro assembly assays performed witha series of B3 variants demonstrated (16, 17) that efficientpackaging of B3 requires a bipartite signal: a 3' TLS functioningas an NE and a 187-nt sequence located in the MP functioningas a packaging element; the function of TLS as NE can be complementedin trans (16). However, recent in vivo experimental evidencesuggested that efficient packaging of BMV sgRNA is functionallycoupled to replication-dependent transcription and translationof CP. Therefore, in order to perform the dual role, a strongselection exists to acquire viral TLS during replication eitherby homologous (9) or heterologous recombination (Table 1). Theseobservations explain why the requirement of the 3' TLS is distinctfrom that or B1 or B2.

Restoration of a defective 3' end in BMV RNAs by homologousor heterologous recombination by a copy choice mechanism hasbeen extensively documented (10, 11, 43, 44). Previous in vivoexperiments demonstrated that a requirement for a functional3' end of B1 or B2 readily selected for functional recombinants(11, 40, 44, 45). By contrast, in this study restoration ofa defective 3' end by recombination was observed only for B3and not for either B1 or B2 (Fig. 3 and Table 1). The reasonfor this observed variation between two independent studiesis not immediately obvious. It is likely that the experimentalapproaches and host systems used could have a profound influenceon the outcome, as suggested recently (26).

The mechanistic role of TLS in packaging of other eukaryotic RNA viruses. The genomes of several groups of plant viruses and insect virusesof the family Tetraviridae have been shown to terminate in aTLS (19). In all these viruses the critical involvement of theTLS in replication is well established (19) while the role inpackaging is not known. However, cellular tRNAs have in someinstances been reported in the icosahedral capsids of RNA viruses.Two to three molecules of RNA with the properties of tRNA^Lys,with smaller amounts of other tRNAs, were reported in the topcomponent particles of a tymovirus eggplant mosaic virus (7).Virion preparations from other tymoviruses also contain RNAs(presumably tRNAs) capable of accepting a range of amino acidsother than the valine bound by the viral RNA (50). However,it is not known in these cases whether these tRNAs are accidentallycopackaged or whether their presence reflects active selectionby the viral CP. Recent experimental evidence suggests thatthe requirement of TLS in packaging is distinct between virusesof the same taxonomic group. For example, in vitro assemblyassays demonstrated that, unlike BMV, genomic RNA transcriptsof another bromovirus, cowpea chlorotic mottle virus, lackingthe 3' TLS are efficiently packaged by CP subunits (3). Similarly,packaging of the genomic RNA of turnip yellow mosaic virus isindependent of the 3' TLS (12). However, in these two instancesthe possibility that host tRNAs function as nucleating agentsof CP subunits during the assembly process cannot be excluded.Another interesting scenario with regard to the role of theTLS in packaging has been suggested for cucumber mosaic virus(CMV) belonging to Cucumovirus genus of family Bromoviridae(36). In the subgroup II of CMV, a 3' 301-nt noncoding regionencompassing the TLS is generated as a discrete RNA fragment(RNA5) during replication by an unknown mechanism (6). Sincethis RNA5 is efficiently packaged into virions, a potentialrole for its involvement in packaging has been suggested (18).However, this scenario differs from the one we have describedhere for BMV. Unlike CMV RNA5, trans complementing sequencesencompassing the viral TLS or host tRNAs are not found in theassembled virions (13).

A scenario reminiscent of cis-acting tRNA-dependent replicationand packaging was also observed in Sindbis virus (SIN) whosegenome does not terminate in a TLS. However, a biologicallyactive naturally occurring Sindbis virus defective interferingRNA (SIN DI RNA) having a cellular tRNA^Asp sequence at the 5'end has been isolated and characterized (34). Subsequent invivo packaging studies revealed that SIN DI RNA having the 5'tRNA^Asp sequence replicated and packaged at higher levels thanviruses containing the authentic 5' terminus (8, 23, 25). Clearly,additional studies addressing whether the role of viral TLSin promoting RNA packaging is universally conserved or restrictedto only some viruses such as BMV are needed to provide valuableinsight into the mechanism of RNA packaging in viruses havingicosahedral symmetry.

ACKNOWLEDGMENTS

We thank Shou-Wei Ding for the generous gift of pCass4 plasmidand Melissanne de Wispelaere for helpful discussions.

Research in this laboratory was supported by a grant from NationalInstitutes of Health (GM 064465-01A2).

FOOTNOTES

* Corresponding author. Mailing address: University of California, Department of Plant Pathology, 3264 Webber Hall, Riverside, CA 925211-0122. Phone: (951) 827-3810. Fax: (951) 827-4294. E-mail: arao{at}ucr.edu.

Published ahead of print on 27 September 2006.

REFERENCES

Top