This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brenner, M.
Right arrow Articles by Kirchhoff, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brenner, M.
Right arrow Articles by Kirchhoff, F.

 Previous Article  |  Next Article 

Journal of Virology, May 2006, p. 4469-4481, Vol. 80, No. 9
0022-538X/06/$08.00+0     doi:10.1128/JVI.80.9.4469-4481.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Importance of the N-Distal AP-2 Binding Element in Nef for Simian Immunodeficiency Virus Replication and Pathogenicity in Rhesus Macaques

Matthias Brenner,1,{dagger} Jan Münch,1,{dagger} Michael Schindler,1 Steffen Wildum,1 Nicole Stolte,2 Christiane Stahl-Hennig,2 Dietmar Fuchs,2 Kerstin Mätz-Rensing,2 Monika Franz,2 Jonathan Heeney,3 Peter Ten Haaft,3 Tomek Swigut,4 Katarzyna Hrecka,4 Jacek Skowronski,4 and Frank Kirchhoff1*

Department of Virology, Universitätsklinikum, Albert-Einstein-Allee 11 89081 Ulm, Germany,1 German Primate Center, Kellnerweg 4, 37077 Goettingen, Germany,2 Biomedical Primate Research Centre, 2280GH Rijswijk, The Netherlands,3 Cold Spring Harbor Laboratory, 1 Bungtown Road, Cold Spring Harbor, New York 117244

Received 5 October 2005/ Accepted 6 February 2006


arrow
ABSTRACT
 
Point mutations in SIVmac239 Nef disrupting CD4 downmodulation and enhancement of virion infectivity attenuate viral replication in acutely infected rhesus macaques, but changes selected later in infection fully restore Nef function (A. J. Iafrate et al., J. Virol. 74:9836-9844, 2000). To further evaluate the relevance of these Nef functions for viral persistence and disease progression, we analyzed an SIVmac239 Nef mutant containing a deletion of amino acids Q64 to N67 ({Delta}64-67Nef). This mutation inactivates the N-distal AP-2 clathrin adaptor binding element and disrupts the abilities of Nef to downregulate CD4, CD28 and CXCR4 and to stimulate viral replication in vitro. However, it does not impair the downmodulation of CD3 and class I major histocompatibility complex (MHC-I) or MHC-II and the upregulation of the MHC-II-associated invariant chain, and it has only a moderate effect on the enhancement of virion infectivity. Replication of the {Delta}64-67Nef variant in acutely infected macaques was intermediate between grossly nef-deleted and wild-type SIVmac239. Subsequently, three of six macaques developed moderate to high viral loads and developed disease, whereas the remaining animals efficiently controlled SIV replication and showed a more attenuated clinical course of infection. Sequence analysis revealed that the deletion in nef was not repaired in any of these animals. However, some changes that slightly enhanced the ability of Nef to downmodulate CD4 and moderately increased Nef-mediated enhancement of viral replication and infectivity in vitro were observed in macaques developing high viral loads. Our results imply that both the Nef functions that were disrupted by the {Delta}64-67 mutation and the activities that remained intact contribute to viral pathogenicity.


arrow
INTRODUCTION
 
The nef gene is conserved among all human and simian immunodeficiency viruses (HIV and SIV, respectively). Nef is dispensable for efficient viral replication in many cell culture systems but critical for the full pathogenic potential of primate lentiviruses (4, 20, 36, 37). Several Nef activities that likely contribute to efficient viral spread and disease progression are conserved among HIV type 1 (HIV-1) and SIVmac. These include downmodulation of CD4, CD28, and class I and II major histocompatibility complexes (MHC-I and -II, respectively); upregulation of the invariant chain (Ii) associated with immature MHC-II molecules; enhancement of virion infectivity; and stimulatory effects on virus replication in primary T cells (1-3, 5, 8, 14, 18, 24-26, 28, 30, 40, 41, 44, 46, 55, 56, 59, 63). In contrast to HIV-1, the SIVmac Nef also efficiently downmodulates CD3 surface expression (7, 31). Studies with SIVmac Nef mutants selectively altered in some functional aspects indicate that most or all of these activities mediate some selective advantage in vivo and might contribute to viral pathogenesis (22, 34, 47, 48, 54, 61). However, their relative contributions to the virulence of SIVmac and HIV-1 remained largely elusive.

Downmodulation of CD4, the primary receptor of HIV and SIV, is one of the best established Nef functions. The viral Env protein and the accessory HIV-1 Vpu protein also participate in CD4 downmodulation, suggesting that this function is critical for efficient viral spread in the infected host (reviewed in references 15, 21, 39, and 66). The mechanism of Nef-mediated CD4 downmodulation has been extensively studied. Nef induces CD4 endocytosis via the AP-2 clathrin adaptor pathway, and this probably involves the formation of ternary complexes comprising Nef, CD4, and AP-2 (29, 50), analogous to the previously reported CD3-Nef-AP-2 complex (62). The internalized CD4 is degraded in an acidic compartment (23, 29, 50). The physiological relevance of CD4 downmodulation is less clear, but it has been suggested that this activity might prevent superinfection, facilitate virion release, increase Env incorporation into virions, and impair T-cell receptor function (6, 9, 17, 38, 52).

Several lines of evidence indicate that CD4 downmodulation is important for viral pathogenesis. Nef alleles derived from some HIV-1-infected long-term nonprogressors are defective in this function (12, 45, 65). In contrast, HIV-1 nef alleles obtained during late stages of disease progression show enhanced activity (13). It has also been shown that CD4 downmodulation by HIV-1 Nef correlates with the efficiency of HIV-1 replication in primary T lymphocytes (43) and with viral replication and CD4+ T-cell depletion in human lymphoid tissue ex vivo (27). We have previously analyzed an SIVmac239 variant containing three amino acid substitutions in Nef disrupting the downregulation of CD4 and enhancement of viral infectivity and replication but not the downmodulation of CD3, MHC-I, and MHC-II and the upregulation of Ii (34). These mutations attenuated SIV replication during acute infection. Thereafter, however, viruses containing reversions and compensatory changes in Nef emerged. Notably, restoration of the disrupted Nef functions correlated with increasing viral loads and disease progression. Thus, these results showed that the ability of Nef to downmodulate CD4 and/or to enhance viral infectivity is critical for efficient replication during acute infection but did not provide information on the relevance of these Nef activities to viral persistence and the clinical outcome of infection.

To further evaluate the relevance of CD4 downmodulation to viral replication and pathogenesis, we investigated an SIVmac239 Nef variant containing a difficult-to-revert deletion of amino acids Q64 to N67 ({Delta}64-67Nef). It has been previously shown that these residues are involved in the interaction of Nef with AP-2 clathrin adaptor proteins and critical for the efficient downregulation of CD4, CD28, and CXCR4 and the stimulation of viral replication but not for other Nef functions (32, 42, 63). Here we demonstrate that the {Delta}64-67Nef virus shows pathogenic properties intermediate between wild-type SIVmac239 and forms containing grossly defective nef genes. In conclusion, Nef-mediated CD4 downregulation and enhanced replication are important in vivo, but other functions also contribute to the virulence of SIVmac.


arrow
MATERIALS AND METHODS
 
Plasmids and proviral constructs. Generation of bicistronic pCGCG expression vectors coexpressing the green fluorescent protein (GFP) alone or in conjunction with the wild-type SIVmac239 (239wt) or {Delta}64-67Nef has been described previously (42, 63). The proviral 239wt clone, the 239(EDR)-Nef mutant, and {Delta}NU, containing deletions of 515 bp in the nef-long terminal repeat region, have been previously described (34, 36).

Cells, virus stocks, and infectivity assays. HeLa CIITA, P4-CCR5, 293T, and Jurkat cells were cultured as described previously (47, 49, 53). For virus production, 293T cells were transfected by the calcium phosphate method (19) with 10 µg of the proviral constructs. The medium was changed after overnight incubation, and virus was harvested 24 h later. The p27 antigen concentrations were quantified by using an SIV enzyme-linked immunosorbent assay provided by the NIH AIDS Reagent Program. Cells were infected with virus stocks containing normalized quantities of p27 antigen, and virus production was measured by using a reverse transcriptase assay at 2- to 3-day intervals (51). Rhesus blood mononuclear cells (rPBMC) were isolated as described previously (40), and immediately infected with aliquots of the virus stocks containing 1 ng of p27 and kept in RPMI 1640 with 10% fetal calf serum (FCS). Residual virus was removed by washing the cells 16 to 18 h after infection. At 3 days after infection cells were stimulated with phytohemagglutinin (2 µg/ml; Sigma) for 3 days, washed, and maintained in RPMI 1640 with 20% FCS and 100 U of interleukin-2 (IL-2)/ml. The rhesus T-cell line 221-89 (3) was maintained in the presence of 100 U of IL-2/ml (Boehringer, Heidelberg, Germany) and 20% FCS. Infections were performed in the absence of exogenous IL-2 or in the presence of 50 U of IL-2/ml and 5% FCS. In the Nef trans-complementation assay 293T cells were cotransfected with 4 µg of a nef-defective SIVmac239 proviral construct and 3 µg of a bicistronic pCGCG vector expressing Nef. Virus was harvested 3 days posttransduction and used to infect P4-CCR5 or TZM-bl indicator cells as described previously (49).

Flow cytometry. Jurkat T cells were either transfected by using the DMRIE-C reagent (Gibco-BRL) for subsequent detection of CD3, CD4, MHC-I, and CD28 or electroporated as described previously (32, 33) to analyze the effect of Nef on CXCR4 surface expression. Efficient transfection with the DMRIE-C reagent involves stimulation with phytohemagglutinin, which leads to CXCR4 downmodulation. Therefore, Jurkat cells were transfected by using two different methods. HeLa CIITA cells were transfected with Metafectene (Biontex) according to manufacturer's instructions. Expression of CD3, CD4, MHC-I, CD28, and CXCR4 on Jurkat T cells and MHC-II or Ii surface expression on HeLa CIITA cells transfected with bicistronic vector coexpressing Nef and GFP were measured as described previously (32, 53, 54). Quantification of Nef-mediated down- or upregulation of the respective surface markers was performed as described elsewhere (13, 53, 54). Briefly, the mean channel numbers of red fluorescence were determined for cells expressing no (N), low (L), medium (M), or high (H) levels of GFP. The mean channel numbers of red fluorescence obtained for cells transfected with the nef construct expressing GFP only were divided by the corresponding numbers obtained for cells coexpressing Nef and GFP to calculate the values for X-fold down- or upmodulation, respectively.

Infection of rhesus macaques. Six juvenile rhesus macaques of Indian origin were infected by intravenous inoculation of SIVmac239 {Delta}64-67Nef containing 10 ng of p27 produced by transfected 293T cells. Animals were housed at the German Primate Center in Gottingen in accordance with the institutional guidelines. The macaques were healthy and seronegative for SIV, D-type retroviruses, and simian T-cell leukemia virus type 1 at the time of infection. Sera and cells were collected at regular intervals, and serological, virological, and immunological analysis was performed as described previously (57, 58, 64).

Nef amplification and sequence analysis. Viral plasma RNA was isolated with the QIAamp RNA Kit (Diagen, Basel, Switzerland) and reverse transcribed with superscript reverse transcriptase (Gibco-BRL, Eggenstein, Germany). SIV sequences spanning the entire nef gene were amplified from cDNA with a nested PCR approach essentially as described previously (34). All nef alleles were first cloned into the bicistronic CMV-based pCGCG vector coexpressing GFP and Nef using XbaI and MluI restriction sites flanking nef. Subsequently, some nef alleles were introduced into the proviral SIVmac239 genome by splice overlap extension PCR as described previously (34, 48). All PCR-derived inserts were sequenced on both strands to confirm that the constructs expressed the correct Nef variants.

Western blot. 293T cells were transfected with 5 µg of pCGCG expression vectors (42) coexpressing GFP and Nef using the calcium phosphate method as described previously (11, 54). At two days posttransfection cells were pelleted, and lysates were generated and separated by sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis as described previously (11, 54). Expression of Nef and p27 in whole cellular lysates was analyzed by immunoblotting. Proteins were detected with a 1:2,500 dilution of pooled sera from SIVmac239-infected rhesus macaques and a 1:5,000 dilution of an alkaline phosphatase-conjugated secondary anti-human immunoglobulin G antibody (Jackson Immunoresearch) as described by the manufacturer.

GenBank accession numbers. SIVmac239 nef sequences derived from macaques infected with the {Delta}64-67Nef variant were submitted to the GenBank sequence database and have been assigned the accession numbers DQ411004 to DQ411025.


arrow
RESULTS
 
Functional characterization of the SIVmac239 {Delta}64-67Nef. Prior to animal studies, we confirmed and extended the in vitro characterization of the {Delta}64-67Nef. In agreement with previous reports (32, 42, 63), we found it to be defective in downregulation of CD4, CD28, and CXCR4 cell surface expression (Fig. 1A, B, and E). Notably, deletion of residues 64 to 67 did not affect the activity of Nef in downmodulating CD3 and class I or II MHC (Fig. 1C, D, and F). The {Delta}64-67Nef also upregulated Ii surface expression albeit with moderately reduced efficiency compared to 239wt Nef (Fig. 1G). Thus, the {Delta}64-67 mutation, which removes the N-distal AP-2 binding element (42, 63), disrupted the effect of SIVmac239 Nef on three of the seven cell surface receptors under study.


Figure 1
View larger version (53K):
[in this window]
[in a new window]
 
FIG. 1. Modulation of human cell surface receptors by the SIVmac239 {Delta}64-67 Nef. Human CD4+ Jurkat T cells (A to E) or HeLa CIITA cells (F and G) were transiently transfected with plasmids expressing GFP alone (nef–) or together with the 239wt and {Delta}64-67 Nef alleles. The surface expression of CD4 (A), MHC-I (B), CD3 (C), CD28 (D), CXCR4 (E), MHC-II (F), and Ii (G) was measured as described in Materials and Methods. The results were confirmed in independent experiments.

Next, we introduced the {Delta}64-67Nef into the full-length SIVmac239 provirus and investigated its effect on viral replication and infectivity. Infection of the rhesus macaque T-cell line 221-89 presents a useful system for investigating the ability of Nef to cause lymphocyte activation (3). As shown in Fig. 2A, the {Delta}64-67Nef was unable to enhance SIVmac239 replication in 221-89 cells both in the absence and in the presence of exogenous IL-2. Compared to 239wt the {Delta}64-67Nef mutant virus also replicated with delayed kinetics and reduced efficiency in rPBMC that were infected immediately after isolation and stimulated 3 days later (Fig. 2B). In most experiments, however, the {Delta}64-67Nef variant replicated slightly better than the 239nef* containing a disrupted nef open reading frame (ORF), indicating that it maintains some residual activity in this assay. Consistent with the published data (42), the {Delta}64-67Nef enhanced virion infectivity, albeit with moderately reduced efficiency (Fig. 2C). These results are in agreement with previous observations with HIV-1 nef, suggesting that Nef-mediated CD4 downregulation usually correlates with the efficiency of viral replication in vitro but not with enhancement of virion infectivity (27, 40, 43). Together, our in vitro data demonstrate that the {Delta}64-67Nef does not efficiently downmodulate CD4, CD28, and CXCR4 or stimulate viral replication in vitro but is active in modulating MHC-I, MHC-II, Ii, and CD3 surface expression and enhancing virion infectivity.


Figure 2
View larger version (33K):
[in this window]
[in a new window]
 
FIG. 2. Deletion of residues 64 to 67 impairs the ability of Nef to stimulate SIV replication but not to enhance the infectivity of progeny virions. (A) Replication of SIVmac239 containing wild type ({blacksquare}), {Delta}64-67 ({blacktriangleup}), or a disrupted nef gene ({square}) in 221-89 cells in the presence (left) or absence (right) of exogenous IL-2 (100 U/ml). (B) Replication of SIVmac239 nef variants in rhesus PBMC infected immediately after isolation and stimulated 3 days later. PSL, photon-stimulated light emission. Similar results were obtained in two independent experiments using different virus stocks. {triangleup}, Uninfected cells. (C) P4-CCR5 cells were infected in triplicate with aliquots of three different 293T cell-derived virus stocks containing 100 ng of p27 core antigen. Infectivity is shown relative to the 239wt virus. U, uninfected cells.

The {Delta}64-67Nef attenuates SIV replication during acute infection. Six rhesus macaques were intravenously infected with SIVmac239 containing the {Delta}64-67Nef to evaluate the effect of this deletion on viral replication and pathogenesis in vivo. As expected from previous studies (34, 36, 40), peak levels of plasma viremia and of viral RNA were observed at 2 weeks postinfection (wpi). During acute infection, the average levels of p27 plasma antigenemia in the animals that received the {Delta}64-67Nef mutant (219 ± 101 pg/ml, n = 6) were ~16-fold lower than those detected in 239wt-infected macaques (3,612 ± 708, n = 11) (Fig. 3A). However, they were threefold higher than those observed in grossly nef-deleted 239{Delta}NU-infected macaques (68 ± 23, n = 4) and in six animals that received the 239(EDR)-Nef variant (65 ± 30, n = 6) (34). In comparison, the peak levels of viral RNA (2.5 x 106 ± 4.2 x 106) in {Delta}64-67Nef infection were only 4.8-fold lower than those observed in the 239wt infection (1.2 x 107 ± 1.8 x 106, n = 22; P = 0.01) but 8.5-fold higher than those observed in macaques inoculated with the {Delta}NU variant (2.9 x 105 ± 1.2 x 105, n = 22; P = 0.02) (Fig. 3B). On average, the levels of RNA were also 13.3-fold higher than those previously observed in macaques infected with the 239(EDR)-Nef variant (1.9 x 105 ± 7.7 x 104, n = 6). Consistent with the intermediate levels of SIVmac239 {Delta}64-67 replication, the urinary neopterin levels, a marker for nonspecific immune stimulation (58), were also higher than in 239(EDR)-Nef and {Delta}NU-infected animals but lower than in 239wt infection (Fig. 3C). These results demonstrate that the deletion of residues 64 to 67 in Nef attenuates SIVmac239 replication early in infection. The disruptive effects were less severe, however, than those of large deletions in {Delta}NU Nef or the point mutations present in the 239(EDR)-Nef variant (Fig. 3) (34).


Figure 3
View larger version (27K):
[in this window]
[in a new window]
 
FIG. 3. Replication of SIVmac239 containing the {Delta}64-67 Nef variant early during infection. The peak plasma levels of p27 and viral RNA in six acutely infected rhesus macaques, which were observed at 2 weeks postinfection, are shown. (A) Levels of p27 plasma antigenemia. The limit of detection is approximately 10 pg/ml. (B) Viral RNA load. (C) Levels of neopterin, a marker for nonspecific immune activation (58). For comparison, values obtained from animals infected with 239wt, the grossly nef-defective {Delta}NU virus, and from six macaques inoculated with the 239(EDR)Nef mutant (34) are also indicated. The upper panels give individual values, and the lower panels indicate the average values ± the standard deviation. U, uninfected cells.

Reduced virulence of SIVmac239 {Delta}64-67Nef during later stages of infection. After the acute phase of infection, the viral loads decrease in the great majority of animals inoculated with nef-deleted SIVmac239 but usually remain high in animals infected with 239wt (36). In contrast, the outcome of infection in the animals infected with the {Delta}64-67Nef variant varied. Three of the six animals—Mm9024, Mm10026, and Mm10027—maintained intermediate to high levels of viral RNA and cell-associated viral loads (Fig. 4, left panels). The remaining macaques—Mm9044, Mm9051, and Mm10028—developed low RNA loads, similarly to attenuated {Delta}NU infection (Fig. 4A, left panel). Furthermore, the cell-associated viral loads were 2 to 3 orders of magnitude lower than those usually observed in 239wt infection (Fig. 4B, left panel). Between 12 and 52 wpi, the average RNA loads in the six animals that were inoculated with the {Delta}64-67Nef mutant (3.5 x 105 ± 1.6 x 105) were 27-fold higher compared to {Delta}NU infection (1.3 x 104 ± 6.7 x 103; P = 0.0004) but 22-fold lower than those in 239wt-infected macaques (7.9 x 106 ± 4.2 x 106; P = 0.0015) (Fig. 4A, right panel). Typically, the cell-associated viral loads declined only marginally after the acute phase of 239wt infection but dropped dramatically in animals that received the {Delta}NU or {Delta}64-67Nef variants (Fig. 4B, left panel). However, 3 of 6 {Delta}64-67Nef and 3 of 15 {Delta}NU-infected macaques showed increasing cell-associated viral loads after 12 and 20 wpi, respectively (Fig. 4B and data not shown). In contrast, the average cell-associated virus loads in 239wt-infected animals declined slowly during later stages of 239wt infection due to the death of several rapid progressors showing high levels of replication during the investigation period. On average, the number of infectious cells increased earlier in {Delta}64-67Nef-infected animals compared to {Delta}NU infection (Fig. 4B, right panel). It is noteworthy that the cell-associated viral loads in {Delta}64-67Nef-infected macaques were reduced more severely than the viral RNA loads. Consequently, the plasma RNA copy numbers per infectious cell detected in the periphery of both {Delta}64-67Nef (3,273 ± 693)- and 239wt (5,899 ± 2,111)-infected macaques were significantly higher than those detected in {Delta}NU infection (352 ± 70; P = 0.0006 and 0.013, respectively; the numbers indicate the average number of RNA copies per infectious cell ± the standard error of the mean [SEM]).


Figure 4
View larger version (45K):
[in this window]
[in a new window]
 
FIG. 4. Persistence of the SIVmac239 {Delta}64-67 Nef variant in rhesus macaques. (A) Viral RNA load and (B) number of infectious cells per 1 million PBMC. The right panels show average values ± the standard deviations. For comparison, values obtained from macaques infected with SIVmac239 {Delta}NU ({square}) or wild-type SIVmac239 ({blacksquare}) are indicated. Parameters were determined as described in Materials and Methods.

Consistent with the variable efficiency of viral replication, the six animals infected with the {Delta}64-67Nef variant showed differential clinical courses of infection. The two animals with the highest viral loads, Mm9024 and Mm10026, showed declining CD4+ T-cell numbers after 16 wpi and developed a moderate lymphadenopathy by 4 wpi. Mm9024 also developed increasing thrombocytopenia after 6 wpi and persistent splenomegaly by 16 wpi and had to be euthanized by 69 wpi because of diarrhea and severe immunodeficiency. Histopathological examination revealed moderate to severe follicular hyperplasia with progression to depletion of multiple lymphatic organs and a chronically active gastroenteritis induced by opportunistic infections (Giardia). Mm10026 also became immunodeficient, and autopsy at 53 wpi revealed a moderate chronically active gastroenteritis partially induced by parasites, SIV-induced arteriopathy of the respiratory tract, and severe generalized lymphatic hyperplasia with the beginning of a pleomorphic malignant lymphoma in some lymph nodes and spleen. The third animal that showed relatively high viral loads after infection with the {Delta}64-67Nef variant, Mm10027, developed a persistent mild lymphadenopathy from 8 wpi and a mild anemia and thrombocytopenia after 28 wpi. Histological examination at 53 wpi revealed mild generalized follicular hyperplasia in lymphatic organs. Consistent with the low viral loads detected in Mm9044, this animal remained healthy with stable CD4 counts throughout the observation period and was euthanized at 75 wpi. Postmortem examination revealed no clinical abnormalities except a mild hyperplasia in lymphatic tissues. Mm9051 also did not show signs of immunodeficiency, except for a mild lymphadenopathy occurring between 4 and 48 wpi. Autopsy was performed at 75 wpi and revealed a moderate generalized follicular hyperplasia in lymphatic tissues and generalized lymphatic activation but no opportunistic infections. Despite low levels of viral replication (Fig. 4) Mm10028 showed a decline in the number of CD4+ T cells after 36 wpi and developed a persistent anemia by 20 wpi, which was severe at necropsy at 54 wpi. Histopathological examination revealed a moderate to severe chronic active gastroenteritis and a moderate interstitial pneumonia.

In summary, all six animals infected with the {Delta}64-67Nef variant became slow progressors and survived at least 1 year after infection, whereas ca. 70% of the SIVmac 239-infected rhesus macaques developed severe immunodeficiency and died within this time period. However, two animals (Mm9024 and Mm10026) with high viral loads developed AIDS. In contrast, Mm9044 and Mm9051 with low viral loads remained clinically healthy during the 75-week observation period. The remaining two macaques, Mm10027 with intermediate viral loads and Mm10028 with low viral loads, showed signs of progressive infection but did not develop AIDS for about 1 year of follow-up. Thus, both the replicative capacity and the pathogenetic properties of the {Delta}64-67Nef variant were intermediate between 239wt and {Delta}NU.

Nef sequence alterations selected in vivo. Three of the six animals infected with the {Delta}64-67Nef variant (Mm9024, Mm10026, and Mm10027, [designated Mm-M for moderate]) developed viral loads that were moderately reduced compared to the pathogenic SIVmac 239wt, whereas the remaining three macaques (Mm9044, Mm9051, and Mm10028 [designated Mm-L for low]) showed more attenuated levels of viral replication resembling grossly nef-deleted {Delta}NU infection (Table 1 and Fig. 4). It is known that small deletions in nef can be "repaired" and function can be restored during the course of SIV infection (11, 67). Therefore, we next investigated whether the different levels of viral replication observed in the six animals infected with the {Delta}64-67Nef variant correlate with reversions or second-site compensatory changes in Nef. Sequence analysis of PCR fragments amplified from plasma viral RNA at sequential time points revealed that the {Delta}64-67 deletion in nef was not repaired in any of the six animals (Fig. 5). However, as summarized in Table 1, the frequency of nucleotide changes and deduced amino acid substitutions was ~3-fold higher in the three animals with high viral loads. Although this may be the consequence rather than the cause of efficient replication, it is noteworthy that 91% of the nucleotide changes in Mm-M but only 75% in Mm-L were nonsynonymous. Moreover, all 36 nef ORFs derived from Mm-M at 24 or 40 wpi predicted full-length proteins, whereas 12 of the 40 sequences derived from Mm-L were truncated (Table 1). These results indicate a high selective pressure for amino acid changes and full-length Nef expression in animals that developed relatively high viral loads. To further assess the Nef sequence alterations selected in vivo, we also analyzed genomic DNA samples derived from lymph nodes obtained at necropsy. env-nef fragments could be readily amplified from the three animals with moderate to high viral loads (Mm9024, Mm10026, and Mm10027) but only from one animal with low viral loads (Mm10028). The results confirmed that the {Delta}64-67 deletion was stable and that a larger number of changes was observed in the nef sequences derived from the three animals with the relatively high viral loads compared to Mm10028 showing low viral loads (Table 1).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Viral load and changes in nef in macaques infected with the {Delta}64-67Nef variant


Figure 5
View larger version (80K):
[in this window]
[in a new window]
 
FIG. 5. Alignment of Nef sequences derived from macaques infected with the SIVmac239 {Delta}64-67 Nef variant. The SIVmac239 sequence is shown in the upper panel for comparison. Dots indicate amino acid identity, and dashes indicate gaps introduced to optimize the alignment. Some sequence motifs in Nef, including the N-terminal myristoylation signal, the acidic region, a C-proximal adaptor-protein (AP) interaction site, and the position of the {Delta}64-67 deletion are indicated. The "#" symbol denotes positions where changes in Nef were selected in several animals. The numbers in parenthesis give the number of clones analyzed. w, wpi; Ln, lymph node.

Importantly, at five positions (M7, E75, A136, E191, and Y193) amino acid substitutions were observed in at least two of the three macaques with relatively high viral loads but not in the remaining animals (Fig. 5). Of these alterations the E191K and Y193C changes were most interesting because they were consistently observed in Mm-M infection and became predominant in animals Mm9024 and Mm10026, which developed the most severe clinical symptoms. Furthermore, they are located in the ExxxLM sequence, which may be involved in the interaction of Nef with clathrin adaptor protein complexes (10, 18) and critical for downmodulation of CD4 and CD28 (63), as well as upregulation of Ii by SIVmac239 Nef (53, 59). Notably, HIV-1 Nef proteins do not contain the N-terminal AP-binding motif, and some HIV-1 Nef proteins contain a cysteine at the position corresponding to Y193 in SIV Nef. Thus, the Y193C change might partially compensate for the loss of the N-terminal AP-2 binding element in {Delta}64-67 SIV Nef by generating a more "HIV-1-like" C-terminal sequence. In addition to these point mutations, 45 nucleotides flanking the {Delta}64-67 mutation were deleted in three of five nef alleles derived from Mm10027 at 24 wpi, predicting the deletion of amino acid residues 61 to 80 (Fig. 5). The majority of nef alleles derived from Mm9044 at 24 wpi and from Mm10028 at both 24 and 40 wpi also contained a mutation of AAAAGAAAAGGGGGG to AAAAAAAAAGGGGGG in the polypurine tract, predicting the substitution of E125K (Fig. 5).

Functional activity of Nef variants selected in vivo. Our observation that some changes were consistently observed in nef alleles derived from animals with relatively high viral loads, suggested that they may functionally compensate for the {Delta}64-67Nef deletion. To evaluate this possibility, representative nef alleles PCR amplified from the six animals at 24 and 40 wpi were cloned into the bicistronic vector coexpressing Nef and GFP for flow cytometric analysis. Western blot analyses revealed that, with the exception of the 9,044-k6 allele containing a premature stop codon at position 122 of the nef ORF, all Nef variants were expressed in transfected 293T cells (Fig. 6 and data not shown). The electrophoretic mobility differed from that of the 239wt Nef due to the {Delta}64-67 and {Delta}61-80 deletions and the presence of up to 10 amino acid substitutions.


Figure 6
View larger version (19K):
[in this window]
[in a new window]
 
FIG. 6. Expression of nef alleles selected in SIVmac239 {Delta}64-67Nef-infected macaques. 293T cells were transfected with proviral SIVmac239 constructs encoding the indicated Nef proteins or containing a disrupted nef gene (nef*). Pooled sera from SIVmac239-infected rhesus macaques were used for the detection of Nef and p27, respectively.

Flow cytometric analysis revealed that the ability of Nef to efficiently downmodulate CD4, CD28, and CXCR4 was not restored in any of the six animals infected with the {Delta}64-67Nef variant (examples shown in Fig. 7A). In contrast, all intact nef alleles derived from these animals efficiently modulated surface expression of CD3, MHC-I, MHC-II, and Ii. For quantitative fluorescence-activated cell sorting analysis, we divided the mean fluorescence intensity obtained on Jurkat or HeLa CIITA cells transiently transfected with the different nef alleles by the mean fluorescence obtained for cells transfected with a nef-defective control construct as described previously (13, 53). As shown in Fig. 7B, all nef alleles selected in vivo showed little if any activity in downmodulating CD4 and CD28. They were functionally active, however, in modulating the remaining surface receptors investigated, albeit with different efficiencies.


Figure 7
View larger version (60K):
[in this window]
[in a new window]
 
FIG. 7. Functional activity of nef alleles derived from SIVmac239 {Delta}64-67Nef-infected macaques. (A) Jurkat T (rows A to D) or HeLa-CIITA (rows E and F) cells were transfected with bicistronic vectors coexpressing the indicated nef alleles and GFP and assayed for surface expression of CD4, CD3, CD28, MHC-I, MHC-II, and Ii. (B) Quantitative analysis of the functional activity of individual nef alleles. Ranges for green fluorescence on cells defined as expressing no (N), low (L), medium (M), or high (H) levels of GFP are indicated in panel A. X-fold down- or upmodulation was calculated as described in Materials and Methods. (C) Average activities ± the standard deviations of nef alleles derived from macaques with relatively high (H) or low (L) virus loads. Values are shown relative to the activity, calculated as the X-fold modulation of the respective receptors at high expression levels, of the SIVmac 239wt Nef protein (100%). {Delta}, Activity of the original {Delta}64-67Nef. The effect of several Nef proteins on CD3 was saturated at medium expression levels. Therefore, CD3 downmodulation was calculated for both medium and high levels of GFP expression.

Finally, we evaluated whether more subtle differences in Nef function are associated with the development of relatively high or low load viral loads in vivo. We compared the average activities of seven nef alleles derived from the three Mm-M animals with high viral loads (Mm9024, Mm10026, and Mm10027) at 24 or 40 wpi with those derived from the remaining Mm-L macaques. At these time points, the virals loads differed by 2 to 3 orders of magnitude between the two groups of animals (Table 1). Quantitative analysis revealed some minor restoration of CD4 but not CD28 or CXCR4 downmodulation in animals with high viral loads (Fig. 7C and data not shown). In contrast, the functional activity in CD3 downregulation was reduced at high levels of Nef expression. Notably, most nef alleles selected in vivo showed enhanced activity in Ii upregulation compared to the {Delta}64-67Nef (Fig. 7C). Finally, both groups of animal-derived nef alleles and the {Delta}64-67Nef showed similar activities in modulating MHC-I and MHC-II surface expression. Thus, the differences in viral loads in the animals that received the {Delta}64-67Nef mutant did not correlate with efficient restoration of CD4 and CD28 downmodulation. However, nef alleles derived from animals with low or high viral loads showed some subtle differences in their abilities to downregulate CD4 and CD3 surface expression.

To evaluate whether the changes selected in macaques infected with the {Delta}64-67Nef variants restored the ability of Nef to stimulate SIV replication, we introduced the animal-derived nef alleles obtained at 24 wpi into the 239wt provirus and assayed the effects of these nef variants on the replicative capacity of SIVmac 239 in 221-89 cells. In the absence of exogenous IL-2, only the parental 239wt virus replicated efficiently (Fig. 8A), demonstrating that none of the changes selected in vivo fully restored this Nef function. In the presence of IL-2, however, several nef alleles were more active in enhancing SIV replication than the original {Delta}64-67Nef (Fig. 8B). Those derived from Mm9024 and Mm10027 showed the highest activity and resulted in levels of replication intermediate between 239wt and the {Delta}64-67Nef variant. In comparison, SIVmac239 containing the 9044-k9 and 10026-k20 nef alleles replicated only slightly better than the original {Delta}64-67Nef mutant virus. Finally, introduction of the 9051-k11 and 10028-k30 nef alleles resulted in inefficient replication in 221-89 cells. In addition to the changes in nef, the G-A mutations in the polypurine tract of sequences derived from Mm9044 and Mm10028 described above might also affect the efficiency of viral replication. Furthermore, the Mm10028 nef alleles contained changes of TTTTAT to TTCTAT (24 wpi) and TTGTAT or TTGAAT in the T-rich region just upstream the polypurine tract, which is known to be important for efficient replication of SIVmac239 (32). On average, the reverse transcriptase production in 221-89 cells infected with SIVmac239 carrying nef alleles derived from the three animals with high viral loads was intermediate (78.3 ± 24.4, n = 12) between 239wt (100%) and {Delta}64-67Nef (47.2 ± 1.4, n = 3) infection (Fig. 8C). In contrast, intact nef alleles derived from animals with low viral loads did not enhance viral replication (44.1 ± 18.6, n = 9).


Figure 8
View larger version (19K):
[in this window]
[in a new window]
 
FIG. 8. Activity of nef alleles derived from SIVmac239 {Delta}64-67Nef-infected animals at 24 wpi in enhancing viral replication. Replication of the indicated SIVmac239 nef variants in 221-89 cells in the absence (A) or presence (B) of exogenous IL-2. The reverse transcriptase activity was determined by using a phosphorimager. PSL, photon-stimulated light emission. Similar results were obtained in three independent experiments. (C) Virus production by 221-89 cells infected in the presence of IL-2 with SIVmac239 variants expressing the 239wt and {Delta}64-67 Nefs or nef alleles derived from the three animals with moderate (Mm-M, Mm9024, Mm10026, and Mm10027) or low (Mm-L, Mm9044, Mm9051, and Mm10028) viral loads. For each virus variant, we determined the total reverse transcriptase activity in the culture supernatants over the 18-day period. The reverse transcriptase values obtained for 239wt were considered 100%. Means and SEMs derived from three experiments are shown.

Finally, we examined the ability of nef variants to enhance the infectivity of SIVmac. To avoid a possible bias due to changes in overlapping env or LTR sequences, we expressed Nef in trans in the virus producer 293T cells. The 239wt Nef enhanced viral infectivity in TZM-bl cells ~20-fold (Fig. 9A). The {Delta}64-67Nef showed ~2-fold reduced activity (50.2% ± 8.8%, n = 9; numbers give mean infectivity ± the SEM as a percentage of that obtained for 239wt Nef). Unexpectedly, nef alleles derived from six animals infected with the 239{Delta}64-67Nef variant differed considerably in their ability to promote viral infectivity (Fig. 9A). These differences were highly reproducible and confirmed in two different indicator cell lines (Fig. 9B). Importantly, nef alleles derived from the three animals with relatively high viral loads were usually more active (59.4% ± 7.3%, n = 45) than those derived from macaques showing more attenuated levels of viral replication (24.3% ± 2.5%, n = 36; P < 0.0001) (Fig. 9A). Taken together, our results show that the second-site mutations in Nef selected in animals with moderate to high viral loads slightly increased the ability of the {Delta}64-67Nef to downmodulate CD4 and had more significant effects on its ability to enhance viral replication and infectivity in vitro.


Figure 9
View larger version (26K):
[in this window]
[in a new window]
 
FIG. 9. Activity of nef alleles derived from SIVmac239 {Delta}64-67Nef-infected animals in enhancing viral infectivity. (A) TZM-bl cells were infected with virus stocks produced in 293T cells expressing no Nef (nef*) or the indicated SIVmac239 nef alleles. The infectivities are shown relative to those obtained using 239wt Nef (100%). Average values (± the SEM) derived from triplicate infections (each) with three independent virus stocks are given. (B) Correlation between the infectivities of viral stocks quantified in TZM-bl or P4-CCR5 cells.


arrow
DISCUSSION
 
Disrupting the N-distal AP-2 binding element in SIV Nef eliminates downregulation of CD4, CD28, and CXCR4 (32, 42, 63). We demonstrate that this mutation attenuates viral replication both in vitro and in vivo in infected rhesus macaques. Attenuation was clearly less severe, however, than that achieved by large deletions that disrupt all aspects of Nef function. Therefore, some or all of the functions that were not disrupted by the {Delta}64-67 deletion, such as downmodulation of class I MHC and CD3, upregulation of Ii cell surface expression, or the increased virion infectivity also contribute to viral replication in vivo. These findings are consistent with the accumulating evidence suggesting that a combination of multiple separable Nef functions enables both SIV and HIV to replicate efficiently and to persist at high levels in the infected host (11, 22, 34, 47-49, 54, 61).

Early in infection the {Delta}64-67Nef variant replicated with significantly higher efficiency than the 239(EDR)Nef mutant analyzed in our previous study (34). Both mutant nef alleles were defective in downmodulating CD4, CD28, and CXCR4 and in stimulating viral replication. The major functional difference between them is that the {Delta}64-67Nef shows only moderately reduced activity in enhancing virion infectivity (Fig. 2), whereas the 239(EDR)Nef is entirely inactive (34). Although we compared their functional activity in nine in vitro assays (CD4, MHC-I, CD3, CD28, CXCR4, MHC-II, Ii, infectivity, and replication), the possibility that both nef alleles also differ in other functional aspects cannot be dismissed. Nonetheless, our findings suggest that Nef-mediated infectivity enhancement, while insufficient for efficient stimulation of SIV replication in PBMC and in 221-89 cell cultures, may accelerate viral replication in infected macaques at early stages of infection. Moreover, our finding that nef alleles derived from macaques with progressing disease were significantly more active in enhancing viral infectivity than those obtained from macaques showing a more strongly attenuated course of infection suggests that this Nef function also contributes to viral spread and pathogenicity during later stages of infection.

Altogether, the SIVmac239 {Delta}64-67Nef variant showed pathogenic properties intermediate between 239wt and grossly nef-deleted SIVmac infection. The efficiencies of viral replication and the clinical course of infection differed among the six {Delta}64-67Nef-infected animals. Half of the animals showed only moderately reduced viral loads compared to pathogenic 239wt infection and progressed slowly to immunodeficiency, whereas the remaining macaques remained asymptomatic and resembled grossly nef-deleted infection. Nef sequence analysis revealed that the deletion was not repaired in any of these animals during the course of infection. Furthermore, in contrast to the results obtained using the 239(EDR)Nef variant (34), the disrupted Nef functions were not efficiently restored in {Delta}64-67Nef-infected macaques. However, some second-site mutations in Nef were consistently selected in animals that developed relatively high viral loads. Functional analysis revealed that these changes had some minor restorative effects on CD4 downmodulation and moderately enhanced the ability of the {Delta}64-67Nef to enhance viral replication and infectivity in vitro. The fact that these alterations were only observed in animals developing relatively high viral loads and showing signs of disease progression suggests that the alterations contributed to efficient viral replication and pathogenesis in infected animals. However, given that Nef function was not fully restored, it is quite possible that changes elsewhere in the viral genomes contributed to this phenotype.

The {Delta}64-67Nef is impaired in two functions interfering with T-cell activation: the downmodulation of CD4 and CD28. However, it was even more active than 239wt Nef in downregulating CD3 from the cell surface. This function might be advantageous for the virus because it interferes with TCR-mediated T-cell activation by antigen-presenting cells and hence likely weakens the antiviral immune response. However, efficient CD3 downregulation is not sufficient to enhance SIV replication in infected macaques (48). We found that nef alleles derived from the two {Delta}64-67Nef-infected animals with the highest viral loads, Mm9024 and Mm10027, were less active than {Delta}64-67Nef in downmodulating CD3 cell surface expression. While the relevance of these subtle functional differences for viral replication in vivo remains elusive one could speculate that the reduced functional activity in CD3 downmodulation could lead to increased activation of infected T cells and hence increased virus production.

All nef alleles derived from {Delta}64-67Nef-infected macaques with relatively high viral loads predicted full-length reading frames and, as discussed above, contained amino acid changes that enhanced viral fitness. In contrast, nef ORFs were disrupted more frequently in animals with low viral loads, although fewer nucleotide changes were selected (Table 1). At 24 wpi, changes of AAAAGAAAAGGGGGG to AAAAAAAAAGGGGGG were consistently detected in Mm9044 and Mm10028, which both showed low viral loads. Unaltered polypurine tract sequences were detected later in Mm9044 infection. In Mm10028, however, additional changes in the PPT and the critical upstream T-rich region (35, TTTTATAAAAGAAAAGGGGGG to TTGAATAAAAAAAAAGGGGGG were also present at 40 wpi. Furthermore, the majority of nef genes were prematurely truncated (Table 1). Thus, it seems that in Mm10028 less fit viral variants predominated later during infection. Consistent with this, the viral RNA load in Mm10028 dropped by 2 orders of magnitude between 20 and 40 wpi, and no infectious cells could be detected after 36 wpi (Fig. 4). Less-fit viral variants have also been detected in some nonprogressors or slow progressors of HIV-1 infection (12, 45, 65).

It has been shown that Nef-mediated downregulation of class I MHC complexes from the cell surfaces protects infected cells from detection and lysis by cytotoxic T lymphocytes (CTL) (16). In agreement with an important role of this Nef function in vivo it has been demonstrated that MHC-I downmodulation is associated with a strong selective advantage (47, 61). It is thought that the emerging antiviral CTL response plays a key role in the control of viral replication after the acute phase of infection. Deletion of residues 64 to 67 did not reduce the ability of 239-Nef to downregulate surface expression of class I MHC complexes. Thus, it was unexpected that the cell-associated viral loads dropped as dramatically in the six animals that received the {Delta}64-67Nefs variant as in macaques infected with grossly nef-deleted {Delta}NU virus (Fig. 4B). Remarkably, the viral RNA levels in the plasma of {Delta}64-67Nef-infected animals dropped less strongly (Fig. 4A). Thus, cells infected with the {Delta}64-67Nef variant might produce more virus than those infected with the {Delta}NU virus. It is also possible, however, that our measurement of viral loads in the peripheral blood of the 239wt, {Delta}NU, and {Delta}64-67Nef-infected macaques may not accurately reflect the number of infected cells and virus production in lymphatic organs, the major site of HIV-1 and SIV replication. Nonetheless, our data show that efficient class I MHC downregulation is not sufficient to maintain high viral loads after the onset of the antiviral CTL response. However, the observations that the viral RNA load was intermediate and that the cell-associated viral load increased faster than in {Delta}NU infection provides some evidence that class I MHC downmodulation contributes to the development of high viral loads in vivo in infected rhesus macaques. Apparently a variety of complementary Nef activities allows the virus to replicate at high levels in the great majority of infected hosts.

Both the {Delta}64-67Nef and the previously analyzed 239(EDR)Nef (34) are defective in at least four activities: downmodulation of CD4, CD28, and CXCR4 and stimulation of viral replication. Thus, it is not possible to discern the relative contributions of these functions to the attenuating effect of these mutations. Ideally, mutations that are both selective for one specific in vitro Nef function and difficult to revert should be analyzed. However, although SIV Nef mutants that are apparently exclusively impaired in class I MHC downregulation have been described and analyzed in the SIV/macaque model (47, 60, 61), it is a difficult task to selectively disrupt other Nef functions. In each case, the analysis of Nef mutants that are impaired in multiple related functions also provides related information on viral pathogenicity. Since these functions are mediated by similar Nef surfaces, they will usually be selected for in a linked manner in the infected host. Furthermore, therapeutic agents that disrupt one of these activities will most likely also affect the others. However, it seems that only agents that disrupt molecular interactions of Nef that are critical for all of these in vitro functions will effectively attenuate viral replication.


arrow
ACKNOWLEDGMENTS
 
We thank Thomas Mertens and Nicola Bailer for constant support and encouragement, Daniela Krnavek for excellent technical assistance, and Ingrid Bennett for critical reading of the manuscript.

This study was supported by grants from the Deutsche Forschungsgemeinschaft, the Wilhelm-Sander-Stiftung, and the Landesstiftung BW and by PHS grant AI-42561 to J.S.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Virology, Universitätsklinikum, Albert-Einstein-Allee 11, 89081 Ulm, Germany. Phone: 49-731-50023344. Fax: 49-731-50023337. E-mail: frank.kirchhoff{at}medizin.uni-ulm.de. Back

{dagger} M.B. and J.M. contributed equally to this study. Back


arrow
REFERENCES
 
    1
  1. Aiken, C., J. Konner, N. R. Landau, M. E. Lenburg, and D. Trono. 1994. Nef induces CD4 endocytosis: requirement for a critical dileucine motif in the membrane-proximal CD4 cytoplasmic domain. Cell 76:853-864.[CrossRef][Medline]
  2. 2
  3. Akari, H., S. Arold, T. Fukumori, T. Okazaki, K. Strebel, and A. Adachi. 2000. Nef-induced major histocompatibility complex class I down-regulation is functionally dissociated from its virion incorporation, enhancement of viral infectivity, and CD4 down-regulation. J. Virol. 74:2907-2912.[Abstract/Free Full Text]
  4. 3
  5. Alexander, L., Z. Du, M. Rosenzweig, J. J. Jung, and R. C. Desrosiers. 1997. A role for natural SIV and HIV-1 nef alleles in lymphocyte activation. J. Virol. 71:6094-6099.[Abstract]
  6. 4
  7. Alexander, L., P. O. Illyinskii, S. M. Lang, R. E. Means, J. Lifson, K. Mansfield, and R. C. Desrosiers. 2003. Determinants of increased replicative capacity of serially passaged simian immunodeficiency virus with nef deleted in rhesus monkeys. J. Virol. 77:6823-6835.[Abstract/Free Full Text]
  8. 5
  9. Anderson, S., D. C. Shugars, R. Swanstrom, and J. V. Garcia. 1993. Nef from primary isolates of human immunodeficiency virus type 1 suppresses surface CD4 expression in human and mouse T cells. J. Virol. 67:4923-4931.[Abstract/Free Full Text]
  10. 6
  11. Argañaraz, E. R., M. Schindler, F. Kirchhoff, and J. Lama. 2004. Enhanced CD4 down-modulation by late-stage HIV-1 nef alleles is associated with increased Env incorporation and viral replication. J. Biol. Chem. 278:33912-33919.
  12. 7
  13. Bell, I., C. Ashman, J. Maughan, E. Hooker, F. Cook, and T. A. Reinhart. 1998. Association of SIV Nef with the T-cell receptor (TCR) zeta chain leads to TCR down modulation. J. Gen. Virol. 79:2717-2727.[Abstract]
  14. 8
  15. Bell, I., T. M. Schaefer, R. P. Trible, A. Amedee, and T. A. Reinhart. 2001. Down-modulation of the costimulatory molecule, CD28, is a conserved activity of multiple SIV Nefs and is dependent on histidine 196 of Nef. Virology 283:148-158.[CrossRef][Medline]
  16. 9
  17. Benson, R. E., A. Sanfridson, J. S. Ottinger, C. Doyle, and B. R. Cullen. 1993. Downregulation of cell-surface CD4 expression by SIV Nef prevents viral superinfection. J. Exp. Med. 177:1561-1566.[Abstract/Free Full Text]
  18. 10
  19. Bresnahan, P. A., W. Yonemoto, and W. C. Greene. 1999. Cutting edge: SIV Nef protein utilizes both leucine- and tyrosine-based protein sorting pathways for downregulation of CD4. J. Immunol. 163:2977-2981.[Abstract/Free Full Text]
  20. 11
  21. Carl, S., A. J. Iafrate, C. Stahl-Hennig, J. Skowronski, and F. Kirchhoff. 1999. Effect of the attenuating deletion and of sequence alterations evolving in vivo on simian immunodeficiency virus C8-Nef function. J. Virol. 73:2790-2797.[Abstract/Free Full Text]
  22. 12
  23. Carl, S., R. Daniels, A. J. Iafrate, P. Easterbrook, T. C. Greenough, J. Skowronski, and F. Kirchhoff. 2000. Partial "repair" of defective NEF genes in a long-term nonprogressor with human immunodeficiency virus type 1 infection. J. Infect. Dis. 181:132-140.[CrossRef][Medline]
  24. 13
  25. Carl, S., T. C. Greenough, M. Krumbiegel, M. Greenberg, J. Skowronski, J. L. Sullivan, and F. Kirchhoff. 2001. Modulation of different human immunodeficiency virus type 1 Nef functions during progression to AIDS. J. Virol. 75:3657-3665.[Abstract/Free Full Text]
  26. 14
  27. Chowers, M. Y., C. A. Spina, T. J. Kwoh, N. J. Fitch, D. D. Richman, and J. C. Guatelli. 1994. Optimal infectivity in vitro of HIV-1 requires an intact nef gene. J. Virol. 68:2906-2914.[Abstract/Free Full Text]
  28. 15
  29. Coleman, S. H., J. R. Day, and J. Guatelli. 2001. The HIV-1 Nef protein as a target for antiretroviral therapy. Emerg. Ther. Targets 5:1-22.[CrossRef]
  30. 16
  31. Collins, K. L., B. K. Chen, S. A. Kalams, B. D. Walker, and D. Baltimore. 1998. HIV-1 Nef protein protects infected primary cells against killing by cytotoxic T lymphocytes. Nature 391:397-401.[CrossRef][Medline]
  32. 17
  33. Cortes, M. J., F. Wong-Staal, and J. Lama. 2002. Cell surface CD4 interferes with the infectivity of HIV-1 particles released from T cells. J. Biol. Chem. 277:1770-1779.[Abstract/Free Full Text]
  34. 18
  35. Craig, H. M., M. W. Pandori, and J. C. Guatelli. 1998. Interaction of HIV 1 Nef with the cellular dileucine based sorting pathway is required for CD4 down regulation and optimal viral infectivity. Proc. Natl. Acad. Sci. USA 95:11229-11234.[Abstract/Free Full Text]
  36. 19
  37. Cullen, B. R. 1987. Use of eukaryotic expression technology in the functional analysis of cloned genes. Methods Enzymol. 152:684-703.[Medline]
  38. 20
  39. Deacon, N. J., A. Tsykin, A. Solomon, K. Smith, M. Ludford-Menting, D. J. Hooker, D. A. McPhee, A. L. Greenway, A. Ellett, and C. Chatfield. 1995. Genomic structure of an attenuated quasi species of HIV-1 from a blood transfusion donor and recipients. Science 270:988-991.[Abstract/Free Full Text]
  40. 21
  41. Doms, R. D., and D. Trono. 2000. The plasma membrane as a combat zone in the HIV battlefield. Genes Dev. 14:2677-2688.[Free Full Text]
  42. 22
  43. Du, Z., S. M. Lang, V. G. Sasseville, A. A. Lackner, P. O. Ilyinskii, M. D. Daniel, J. U. Jung, and R. C. Desrosiers. 1995. Identification of a nef allele that causes lymphocyte activation and acute disease in macaque monkeys. Cell 82:665-674.[CrossRef][Medline]
  44. 23
  45. Faure, J., R. Stalder, C. Borel, K. Sobo, V. Piguet, N. Demaurex, J. Gruenberg, and D. Trono. 2004. ARF1 regulates Nef-induced CD4 degradation. Curr. Biol. 14:1056-1064.[CrossRef][Medline]
  46. 24
  47. Garcia, J. V., and A. D. Miller. 1991. Serine phosphorylation-independent downregulation of cell-surface CD4 by nef. Nature 350:508-511.[CrossRef][Medline]
  48. 25
  49. Geleziunas, R., S. Bour, and M. A. Wainberg. 1994. Cell surface down-modulation of CD4 after infection by HIV-1. FASEB J. 8:593-600.[Abstract]
  50. 26
  51. Glushakova, S., J.-C. Grivel, K. Suryanarayana, P. Meylan, J. D. Lifson, R. Desrosiers, and L. Margolis. 1999. Nef enhances HIV replication and responsiveness to interleukin-2 in human lymphoid tissue ex vivo. J. Virol. 73:3968-3974.[Abstract/Free Full Text]
  52. 27
  53. Glushakova, S., J. Munch, S. Carl, T. C. Greenough, J. L. Sullivan, L. Margolis, and F. Kirchhoff. 2001. CD4 down-modulation by human immunodeficiency virus type 1 Nef correlates with the efficiency of viral replication and with CD4+ T-cell depletion in human lymphoid tissue ex vivo. J. Virol. 75:10113-10117.[Abstract/Free Full Text]
  54. 28
  55. Goldsmith, M. A., M. T. Warmerdam, R. E. Atchison, M. D. Miller, and W. C. Greene. 1995. Dissociation of the CD4 downregulation and viral infectivity enhancement functions of human immunodeficiency virus type 1 Nef. J. Virol. 69:4112-4121.[Abstract]
  56. 29
  57. Greenberg, M. E., S. Bronson, M. Lock, M. Neumann, G. N. Pavlakis, and J. Skowronski. 1997. Colocalization of HIV-1 Nef with the AP-2 adaptor protein complex correlates with Nef-induced CD4 down-regulation. EMBO J. 16:6964-6976.[CrossRef][Medline]
  58. 30
  59. Greenberg, M. E., A. J. Iafrate, and J. Skowronski. 1998. The SH3 domain-binding surface and an acidic motif in HIV-1 Nef regulate trafficking of class I MHC complexes. EMBO J. 17:2777-2789.[CrossRef][Medline]
  60. 31
  61. Howe, A. Y., J. U. Jung, and R. C. Desrosiers. 1998. Zeta chain of the T-cell receptor interacts with nef of SIV and HIV-2. J. Virol. 72:9827 9834.[Abstract/Free Full Text]
  62. 32
  63. Hrecka, K., T. Swigut, M. Schindler, F. Kirchhoff, and J. Skowronski. 2005. Nef proteins from diverse groups of primate lentiviruses downmodulate CXCR4 to inhibit migration to SDF-1 chemokine. J. Virol. 79:10650-10659.[Abstract/Free Full Text]
  64. 33
  65. Iafrate, A. J., S. Bronson, and J. Skowronski. 1997. Separable functions of Nef disrupt two aspects of T-cell receptor machinery: CD4 expression and CD3 signaling. EMBO J. 16:673-684.[CrossRef][Medline]
  66. 34
  67. Iafrate, A. J., S. Carl, S. Bronson, C. Stahl-Hennig, T. Swigut, J. Skowronski, and F. Kirchhoff. 2000. Disrupting surfaces of Nef required for down-regulation of CD4 and for enhancement of virion infectivity attenuates simian immunodeficiency virus replication in vivo. J. Virol. 74:9836-9844.[Abstract/Free Full Text]
  68. 35
  69. Ilyinskii, P. O., and R. C. Desrosiers. 1998. Identification of a sequence element immediately upstream of the polypurine tract that is essential for replication of simian immunodeficiency virus. EMBO J. 17:3766-3774.[CrossRef][Medline]
  70. 36
  71. Kestler, H. W., D. J. Ringler, K. Mori, D. L. Panicali, P. K. Sehgal, M. D. Daniel, and R. C. Desrosiers. 1991. Importance of the nef gene for maintenance of high virus loads and for development of AIDS. Cell 65:651-662.[CrossRef][Medline]
  72. 37
  73. Kirchhoff, F., T. C. Greenough, D. B. Brettler, J. L. Sullivan, and R. C. Desrosiers. 1995. Absence of intact nef sequences in a long-term, nonprogressing survivor of HIV-1 infection. N. Engl. J. Med. 332:228-232.[Free Full Text]
  74. 38
  75. Lama, J., A. Mangasarian, and D. Trono. 1999. Cell surface expression of CD4 reduces HIV 1 infectivity by blocking env incorporation in a nef and vpu inhibitable manner. Curr. Biol. 17:622-631.
  76. 39
  77. Lama, J. 2003. The physiological relevance of CD4 receptor down-modulation during HIV infection. Curr. HIV Res. 1:167-184.[CrossRef][Medline]
  78. 40
  79. Lang, S. M., A. J. Iafrate, C. Stahl-Hennig, E. M. Kuhn, T. Nißlein, M. Haupt, G. Hunsmann, J. Skowronski, and F. Kirchhoff. 1997. Association of simian immunodeficiency virus Nef with cellular serine/threonine kinases is dispensable for the development of AIDS in rhesus macaques. Nat. Med. 3:860-865.[CrossRef][Medline]
  80. 41
  81. Le Gall, S., M. C. Prevost, J. M. Heard, and O. Schwartz. 1997. HIV-1 Nef independently affects virion incorporation of major histocompatibility complex class I molecules and virus infectivity. Virology 229:295-301.[CrossRef][Medline]
  82. 42
  83. Lock, M., M. E. Greenberg, A. J. Iafrate, T. Swigut, J. Münch, F. Kirchhoff, N. Shohdy, and J. Skowronski. 1999. Two elements target SIV Nef to the AP-2 clathrin adaptor complex, but only one is required for the induction of CD4 endocytosis. EMBO J. 18:2722-2733.[CrossRef][Medline]
  84. 43
  85. Lundquist, C. A., M. Tobiume, J. Zhou, D. Unutmaz, and C. Aiken. 2002. Nef mediated downregulation of CD4 enhances HIV-1 replication in primary T lymphocytes. J. Virol. 76:4625-4633.[Abstract/Free Full Text]
  86. 44
  87. Mangasarian, A., V. Piguet, J. K. Wang, Y. L. Chen, and D. Trono. 1999. Nef-induced CD4 and major histocompatibility complex class I (MHC-I) down-regulation are governed by distinct determinants: N-terminal alpha helix and proline repeat of Nef selectively regulate MHC-I trafficking. J. Virol. 73:1964-1973.[Abstract/Free Full Text]
  88. 45
  89. Mariani, R., F. Kirchhoff, T. C. Greenough, J. L. Sullivan, R. C. Desrosiers, and J. Skowronski. 1996. High frequency of defective nef-alleles in a long-term survivor with nonprogressive HIV-1 infection. J. Virol. 70:7752-7764.[Abstract]
  90. 46
  91. Miller, M. D., M. T. Warmerdam, I. Gaston, W. C. Greene, and M. B. Feinberg. 1994. The human immunodeficiency virus-1 nef gene product: a positive factor for viral infection and replication in primary lymphocytes and macrophages. J. Exp. Med. 179:101-114.[Abstract/Free Full Text]
  92. 47
  93. Münch, J., N. Stolte, D. Fuchs, C. Stahl-Hennig, and F. Kirchhoff. 2001. Efficient class I MHC down-regulation by simian immunodeficiency virus Nef is associated with a strong selective advantage in infected rhesus macaques. J. Virol. 75:10532-10536.[Abstract/Free Full Text]
  94. 48
  95. Münch, J., A. Janardhan, N. Stolte, C. Stahl-Hennig, P. Ten Haaft, J. L. Heeney, T. Swigut, F. Kirchhoff, and J. Skowronski. 2002. T-cell receptor:CD3 down-regulation is a selected in vivo function of simian immunodeficiency virus Nef but is not sufficient for effective viral replication in rhesus macaques. J. Virol. 76:12360-12364.[Abstract/Free Full Text]
  96. 49
  97. Münch, J., M. Schindler, S. Wildum, E. Rücker, N. Bailer, V. Knoop, F. J. Novembre, and F. Kirchhoff. 2005. Primary SIVsm and HIV-2 Nef alleles modulate cell surface expression of various human receptors and enhance viral infectivity and replication. J. Virol. 79:10547-10560.[Abstract/Free Full Text]
  98. 50
  99. Piguet, V., Y. L. Chen, A. Mangasarian, M. Foti, J. L. Carpentier, and D. Trono. 1998. Mechanism of Nef-induced CD4 endocytosis: Nef connects CD4 with the mu chain of adaptor complexes. EMBO J. 17:2472-2481.[CrossRef][Medline]
  100. 51
  101. Potts, B. J. 1990. "Mini" reverse transcriptase (RT) assay, p. 103-106. In A. Aldovini and B. D. Walker (ed.), Techniques in HIV research. Stockton, New York, N.Y.
  102. 52
  103. Ross, T. M., A. E. Oran, and B. R. Cullen. 1999. Inhibition of HIV 1 progeny virion release by cell surface CD4 is relieved by expression of the viral nef protein. Curr. Biol. 17:613-621.
  104. 53
  105. Schindler, M., S. Wurerfl, P. Benaroch, T. C. Greenough, R. Daniels, P. Easterbrook, M. Brenner, J. Münch, and F. Kirchhoff. 2003. Down-modulation of mature MHC class II and up-regulation of invariant chain cell surface expression are well conserved functions of human and simian immunodeficiency virus nef alleles. J. Virol. 77:10548-10556.[Abstract/Free Full Text]
  106. 54
  107. Schindler, M., J. Münch, C. Stahl-Hennig, J. Skowronski, and F. Kirchhoff. 2004. Comprehensive analysis of Nef functions selected in simian immunodeficiency virus-infected macaques. J. Virol. 78:10588-10597.[Abstract/Free Full Text]
  108. 55
  109. Schwartz, O., V. Marechal, S. Le Gall, F. Lemonnier, and J. M. Heard. 1996. Endocytosis of major histocompatibility complex class I molecules is induced by the HIV-1 Nef protein. Nat. Med. 2:338-342.[CrossRef][Medline]
  110. 56
  111. Spina, C. A., T. J. Kwoh, M. Y. Chowers, J. C. Guatelli, and D. D. Richman. 1994. The importance of nef in the induction of human immunodeficiency virus type 1 replication from primary quiescent CD4 lymphocytes. J. Exp. Med. 179:115-123.[Abstract/Free Full Text]
  112. 57
  113. Stahl-Hennig, C., O. Herchenröder, S. Nick, M. Evers, M. Stille-Siegener, K.-D. Jentsch, F. Kirchhoff, T. Tolle, T. J. Gatesmann, W. Lüke, and G. Hunsmann. 1990. Experimental infection of macaques with HIV-2BEN a novel HIV-2 isolate. AIDS 4:611-617.[Medline]
  114. 58
  115. Stahl-Hennig, C., G. Voss, S. Nick, H. Petry, D. Fuchs, H. Wachter, C. Coulibaly, W. Lüke, and G. Hunsmann. 1992. Immunization with Tween-ether-treated SIV adsorbed onto aluminium hydoxide protects monkeys against experimental SIV infection. Virology 186:588-596.[CrossRef][Medline]
  116. 59
  117. Stumptner-Cuvelette, P., S. Morchoisne, M. Dugast, S. Le Gall, G. Raposo, O. Schwartz, and P. Benaroch. 2001. HIV-1 Nef impairs MHC class II antigen presentation and surface expression. Proc. Natl. Acad. Sci. USA 98:12144-12149.[Abstract/Free Full Text]
  118. 60
  119. Swigut, T., A. J. Iafrate, J. Münch, F. Kirchhoff, and J. Skowronski. 2000. Simian and human immunodeficiency virus Nef proteins use different surfaces to down-regulate class I major histocompatibility antigen expression. J. Virol. 74:5691-5701.[Abstract/Free Full Text]
  120. 61
  121. Swigut, T., L. Alexander, J. Morgan, J. Lifson, K. G. Mansfield, S. Lang, R. P. Johnson, J. Skowronski, and R. C. Desrosiers. 2004. Impact of Nef-mediated downregulation of major histocompatibility complex class I on immune response to simian immunodeficiency virus. J. Virol. 78:13335-13344.[Abstract/Free Full Text]
  122. 62
  123. Swigut, T., M. Greenberg, and J. Skowronski. 2003. Cooperative interactions of simian immunodeficiency virus Nef, AP-2, and CD3-zeta mediate the selective induction of T-cell receptor-CD3 endocytosis. J. Virol. 77:8116-8126.[Abstract/Free Full Text]
  124. 63
  125. Swigut, T., N. Shody, and J. Skowronski. 2001. Mechanism for down-regulation of CD28 by Nef. EMBO J. 20:1593-1604.[CrossRef][Medline]
  126. 64
  127. Ten Haaft, P., B. Verstrepen, K. Überla, B. Rosenwirth, and J. Heeney. 1998. A pathogenic threshold of virus load defined in SIV or SHIV infected macaques. J. Virol. 72:10281-10285.[Abstract/Free Full Text]
  128. 65
  129. Tobiume, M., M. Takahoko, T. Yamada, M. Tatsumi, A. Iwamoto, and M. Matsuda. 2002. Inefficient enhancement of viral infectivity and CD4 downregulation by human immunodeficiency virus type 1 Nef from Japanese long-term nonprogressors. J. Virol. 76:5959-5965.[Abstract/Free Full Text]
  130. 66
  131. Wei, B. L., V. K. Arora, J. L. Foster, D. L. Sodora, and J. V. Garcia. 2003. In vivo analysis of Nef function. Curr. HIV Res. 1:41-50.[CrossRef][Medline]
  132. 67
  133. Whatmore, A. M., N. Cook, G. A. Hall, S. Sharpe, E. W. Rud, and M. P. Cranage. 1995. Repair and evolution of nef in vivo modulates SIV virulence. J. Virol. 69:5117-5123.[Abstract]


Journal of Virology, May 2006, p. 4469-4481, Vol. 80, No. 9
0022-538X/06/$08.00+0     doi:10.1128/JVI.80.9.4469-4481.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Munch, J., Rajan, D., Schindler, M., Specht, A., Rucker, E., Novembre, F. J., Nerrienet, E., Muller-Trutwin, M. C., Peeters, M., Hahn, B. H., Kirchhoff, F. (2007). Nef-Mediated Enhancement of Virion Infectivity and Stimulation of Viral Replication Are Fundamental Properties of Primate Lentiviruses. J. Virol. 81: 13852-13864 [Abstract] [Full Text]  
  • Schindler, M., Rajan, D., Specht, A., Ritter, C., Pulkkinen, K., Saksela, K., Kirchhoff, F. (2007). Association of Nef with p21-Activated Kinase 2 Is Dispensable for Efficient Human Immunodeficiency Virus Type 1 Replication and Cytopathicity in Ex Vivo-Infected Human Lymphoid Tissue. J. Virol. 81: 13005-13014 [Abstract] [Full Text]  
  • Wildum, S., Schindler, M., Munch, J., Kirchhoff, F. (2006). Contribution of vpu, env, and nef to CD4 down-modulation and resistance of human immunodeficiency virus type 1-infected T cells to superinfection.. J. Virol. 80: 8047-8059 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brenner, M.
Right arrow Articles by Kirchhoff, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brenner, M.
Right arrow Articles by Kirchhoff, F.