Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Winters, M. A. Articles by Holodniy, M. Search for Related Content PubMed PubMed Citation Articles by Winters, M. A. Articles by Holodniy, M.

 Previous Article  |  Next Article 

Journal of Virology, April 2006, p. 4196-4199, Vol. 80, No. 8
0022-538X/06/$08.00+0     doi:10.1128/JVI.80.8.4196-4199.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Hepatitis C Virus Protease Gene Diversity in Patients Coinfected with Human Immunodeficiency Virus

Mark A. Winters,¹ Seth L. Welles,² and Mark Holodniy^1,3*

Division of Infectious Diseases and Geographic Medicine, Stanford University, Stanford, California,¹ Department of Epidemiology, Boston University School of Public Health, Boston, Massachusetts,² AIDS Research Center, VA Palo Alto Health Care System, Palo Alto, California³

Received 7 October 2005/ Accepted 1 February 2006

Top Abstract Text References

 
The clonal variability of the hepatitis C virus (HCV) protease gene in 24 individuals with HCV genotypes 1a, 1b, 2b, and 3a who were coinfected with the human immunodeficiency virus was evaluated. Within-genotype variability at the nucleotide and amino acid levels ranged from 6.5 to 8.6% and 2.2 to 3.8%, respectively. After adjustments were made for correlation of intrapatient clonal variation, mixed-model analysis indicated that nucleotide and amino acid variability among patients with different genotypes did not differ significantly. However, within individual patients, clonal variability differed by up to 5.3% and 5.8% at the nucleotide and amino acid levels, respectively, and genotype 1a had significantly greater nucleotide variability than other genotypes (P = 0.01). Significant variability exists within HCV protease gene variants at the patient level and could affect the effectiveness of HCV protease inhibitors.

Top Abstract Text References

 
The hepatitis C virus (HCV) nonstructural (NS) 3 region codes for a serine protease and an RNA helicase. Several HCV protease inhibitors (PI) have been developed and are in early human clinical trials (6, 10). The development of HCV PIs has focused on genotype 1, and results indicate varying PI susceptibilities for non-genotype 1 HCV strains (18). Recent reports have described codon and structural changes within the HCV protease gene that correlate with reduced PI susceptibility in vitro (11, 13).

Several reports have described NS3 diversity using bulk sequencing; no significant difference in diversity between groups with HCV monoinfection or with human immunodeficiency virus (HIV) coinfection has been demonstrated (1, 3, 9, 12). However, the levels of complexity and diversity of HCV protease gene variants and the resultant impact on HIV coinfection are unknown. Understanding this diversity and the impact of naturally occurring polymorphisms, which could result in reduced susceptibility, is crucial for studies of PI development. We performed a clonal analysis of HCV protease sequence diversity across subtypes in 24 chronically infected patients with HIV coinfection.

The Stanford University Institutional Review Board approved this study. HCV genotyping was performed using an INNO-LiPA HCV II assay (Bayer Diagnostics, Tarrytown, NY). Quantification of HIV and of HCV RNA was performed using an Amplicor HIV-1 Monitor v1.5 and HCV v2.0, respectively (Roche Diagnostics, Branchburg, NY).

RNA was extracted from 200 µl of patient sera using TRIzol (Invitrogen, Carlsbad, CA), resuspended in water, and reverse transcribed using Superscript II (Invitrogen) according to the manufacturer's instructions. The resulting cDNA was amplified by PCR using genotype-specific primers (Operon Technologies, Alameda, CA) and PlatinumTaq DNA polymerase (Invitrogen), generating fragments of approximately 1,000 bp. Primers for PCR amplification were as follows: for genotype 1a, G and J (9) or 1a-3258 (CCAGTCGTCTTCTCCCAAATG) and 1a-4150R (TTGGACATGTAAGCACCAAAGC); for genotype 1b, 1b-3145 (AAATGGCTCTCATGAAGCTGG) and 1b-4031R (AGCGTGTAGATGGGCCACTT); for genotype 2b, 2b-3107f (GCTACGAGTGTGTACCCTGGTG) and 2b-4109r (GAGTACTTTATACCCCTGACTGGCATA); and for genotype 3a, 3a-3290f (CCATGGAAATCAAGGTCATCAC) and 3a-4298r (ATAATCACATCATATGCCCCCC).

Amplified NS3 fragments were cloned using a TOPO TA cloning kit (Invitrogen) according to the manufacturer's instructions. This amplification and cloning approach was used previously to study HCV envelope gene diversity (3). Clones were sequenced with M13 primers using ABI PRISM (Applied Biosystems, Foster City, CA) sequencing technology (Macrogen, Seoul, Korea). Nucleotide sequences were assembled and aligned using AutoAssembler (Applied Biosystems). Individual patient consensus sequences were prepared by alignment of individual clones using Sequence Navigator (Applied Biosystems). Genetic distances between consensus or individual clone nucleic acid or amino acid sequences were determined using codon-aligned multiple sequence alignments and distance matrices. Sequences were submitted to GenBank.

Statistical analyses included Kruskal-Wallis rank sum tests to evaluate differences in the distribution of demographics, virologic and immunologic indicators of the stage of HIV infection, and nucleotide and amino acid diversity (genetic distances, calculated using GCG software [Madison, WI]) expressed as median values and the associated 25% to 75% interquartile ranges (IQR) for each group. Fixed- and random-effect mixed models were used to evaluate the contributions of HCV genotype and within-patient clustering of HCV clone nucleotide or amino acid sequences to observed nucleotide or amino acid differences by pairwise comparisons among clones from a given patient. Mixed models (SAS, version 8; Cary, NC) were constructed to include effects of genotype (fixed) and within-patient effects (random) as dependent variables, with nucleotide or amino acid differences as the independent variable. Mixed models (Y = ßX + Z + ) were a variation of a general linear model, where the dependent variable Y (the percent difference in nucleotide or amino acid sequence among clones from a given patient) is a function of HCV genotype (ß, the fixed effect) or clustering within patients (, the random effect); is the error term. Therefore, there are two levels of clustering, with HCV clones being clustered within patients and patients being clustered within HCV genotypes.

Since up to 10 virus clones were sequenced per patient, mixed models permitted adjustments for potential within-patient clustering (correlation) of percent nucleotide and amino acid differences derived from individual HCV clone sequence data. Because dependent variables (nucleotide and amino acid differences) were initially non-normally distributed, they were log transformed prior to inclusion in mixed models. Least square means were used to ascertain nucleotide and amino acid differences by specific genotype by using pairwise comparisons.

Patient demographics, laboratory data, and treatment history are presented in Table 1. The distribution of HCV genotypes presented is representative of the population seen at our institution (5). HCV viral loads were significantly greater in the patients with genotype 1a and 2b than in those with genotypes 1b and 3a (Table 1). Mean CD4 count and percentage were significantly lower for genotype 1a than for other genotypes. Patient consensus sequences created from each individual's clone sequences demonstrated that between-genotype variability ranged from 24% (1a versus 1b) to 51% (2b versus 3a) at the nucleotide level and from 10% (1a versus 1b) to 40% (2b versus 3a) at the amino acid level. These results are similar to those found in another study of HCV NS3 diversity that used bulk sequencing (3, 9), and the inter- and intragenotype diversity is similar to interclade and interpatient differences in HIV strains (15, 17).

View this table: [in this window] [in a new window]

TABLE 1. Patient characteristics by HCV genotypea

Crude analysis showed that there were no significant differences in the overall genetic variability among patients within a particular genotype. When the median percent nucleotide differences (derived from consensus sequences) among patients were considered as measures of clonal diversity, the between-genotype differences were not significant (P = 0.76). Similarly, the median percent amino acid differences among patients did not differ significantly (P = 0.54).

Individual clone sequences for each individual (Table 2) showed an overall median percent nucleotide difference of 0.74% (IQR, 0.65 to 1.49%). However, individual clones had nucleotide differences as high as 5.34% compared to other clones for the same patient. When data from all clones across patients were combined, genotype 1a had a higher nucleotide variability between clones than the other genotypes evaluated (P = 0.01). At the amino acid level, there was a median percent amino acid difference of 0.55% (IQR, 0 to 1.11%) between clones within individuals. However, some clones were as much as 5.75% different in their amino acid sequences compared to other clones from the same patient (Table 2). Genotype 1b clones were significantly less variable than those of the other genotypes (P = 0.007).

View this table: [in this window] [in a new window]

TABLE 2. Nucleotide and amino acid differences between NS3 protease clones

Results from mixed model analysis suggested that intergenotype variability was due to clustering of percent differences of nucleotide or amino acid sequence among clones within patients: when intergenotype fixed effects and within-patient random effects of clustering of clones were accounted for in models, both nucleotide and amino acid differences did not significantly vary among genotypes (P = 0.61 and P = 0.60, respectively). Rather, significant differences of nucleotide and amino acid sequences among within-patient clones were observed, in contrast to the expectation of no differences in sequences among within-person clones under the null hypothesis (Table 2). While P values for tests comparing nucleotide or amino acid differences between genotypes reflected truly nonsignificant test results, some caution should be exercised in the interpretation of findings, since a lack of statistical significance could be explained by the limited sample size.

The total numbers of positions with at least one amino acid change (compared to other patients' consensus sequences in the same genotype) were as follows: genotype 1a, 14 residues; 1b, 11 residues; 2a, 11 residues; and 3a, 9 residues. Two clones had amino acid changes at active site residues, a genotype 1a with S139L and 3a with H57N. There were also two clones (from the same genotype 1a patient), C97R and H149R, that had mutations at metal binding positions. There were no specific amino acid mutations that were found to confer reduced susceptibility to HCV PIs (A156T, R155Q, D168V/Y/A) (11, 13, 19). However, one 3a clone had a R155T mutation, one 1a clone had a D168E mutation, and all 3a clones had a D168Q substitution.

Other reports have described NS3 protease sequence variability using bulk sequencing (3, 9, 12). Our clonal analysis provides a more detailed evaluation of sequence variability by detecting minority variants and establishing linkage as demonstrated in studies of HIV diversity (7, 14). While there are significant differences in nucleic and amino acid sequences and enzymatic parameters (K_i, K_m, etc.) (4) between genotypes, the lack of significant nucleotide and amino acid sequence variability within each genotype in our findings does not provide a basis for a genotype-dependent response to current PIs in development, as has been suggested (18).

While it is possible that bias due to differences in viral load could influence measures of diversity, the likelihood of sample bias or founder effects in this study is low, as the minimum virus load of all patients was 205,000 HCV RNA copies/ml, and only a single round of PCR was employed. Indeed, no significant correlation between HCV viral load and genetic diversity was observed. Overall, changes in important protease positions were rare, and some may have been introduced during Taq-mediated amplification. Thus, further analysis of these variants may be warranted to evaluate their prevalence in other patient groups and their effect on enzyme function.

Resistance to HCV PIs will be an important factor in managing the long-term use of these agents, similar to that seen with HIV protease gene resistance after HIV PI use (8). None of the mutations definitively associated with resistance to HCV PIs was seen in our untreated patients. However, amino acid substitutions at some of those positions were found, suggesting that genotype 1a may develop resistant strains early during PI therapy. Observations with HIV PI resistance suggest that multiple amino acid variants at known drug resistance positions will affect susceptibility (16).

The additional impact of HIV infection or treatment on NS3 diversity is largely unknown, as we did not analyze patients with HCV monoinfection. Previously, we have shown that HIV treatment significantly increases HCV E2 gene diversity and complexity in patients coinfected with HIV and HCV (2). Longitudinal studies will be required to determine whether the evolution of NS3 genetic diversity is related to virologic, immunologic, or clinical progression and HIV and/or HCV treatment responses.

Nucleotide sequence accession numbers. Sequences reported in this paper have been submitted to GenBank under accession numbers DQ355522 to DQ355749.

 
* Corresponding author. Mailing address: AIDS Research Center, VA Palo Alto Health Care System, 3801 Miranda Ave. (132), Palo Alto, CA 94304. Phone: (650) 852-3408. Fax: (650) 858-3978. E-mail: holodniy{at}stanford.edu.

Top Abstract Text References

 

1
1. Argentini, C., S. Dettori, U. Villano, M. Angelico, and M. Rapicetta. 2003. Different levels of variability in subtypes 1b and 4a of hepatitis C viruses. J. Biol. Regul. Homeost. Agents 17:147-152.[Medline]
2
2. Babik, J. M., and M. Holodniy. 2003. Impact of highly active antiretroviral therapy and immunologic status on hepatitis C virus quasispecies diversity in human immunodeficiency virus/hepatitis C virus-coinfected patients. J. Virol. 77:1940-1950.[Abstract/Free Full Text]
3
3. Bagaglio, S., R. Bruno, S. Lodrini, M. S. De Mitri, P. Andreone, E. Loggi, L. Galli, A. Lazzarin, and G. Morsica. 2003. Genetic heterogeneity of hepatitis C virus (HCV) in clinical strains of HIV positive and HIV negative patients chronically infected with HCV genotype 3a. J. Biol. Regul. Homeost. Agents 17:153-161.[Medline]
4
4. Beyer, B. M., R. Zhang, Z. Hong, V. Madison, and B. A. Malcolm. 2001. Effect of naturally occurring active site mutations on hepatitis C virus NS3 protease specificity. Proteins 43:82-88.[CrossRef][Medline]
5
5. Cheung, R. C. 2000. Epidemiology of hepatitis C virus infection in American veterans. Am. J. Gastroenterol. 95:740-747.[CrossRef][Medline]
6
6. Fischmann, T. O., and P. C. Weber. 2002. Peptidic inhibitors of the hepatitis C virus serine protease within non-structural protein 3. Curr. Pharm. Des. 8:2533-2540.[Medline]
7
7. Gunthard, H. F., J. K. Wong, C. C. Ignacio, D. V. Havlir, and D. D. Richman. 1998. Comparative performance of high-density oligonucleotide sequencing and dideoxynucleotide sequencing of HIV type 1 pol from clinical samples. AIDS Res. Hum. Retrovir. 14:869-876.[Medline]
8
8. Hirsch, M. S., F. Brun-Vezinet, B. Clotet, B. Conway, D. R. Kuritzkes, R. T. D'Aquila, L. M. Demeter, S. M. Hammer, V. A. Johnson, C. Loveday, J. W. Mellors, D. M. Jacobsen, and D. D. Richman. 2003. Antiretroviral drug resistance testing in adults infected with human immunodeficiency virus type 1: 2003 recommendations of an International AIDS Society-USA Panel. Clin. Infect. Dis. 37:113-128.[CrossRef][Medline]
9
9. Holland-Staley, C. A., L. C. Kovari, E. M. Golenberg, K. J. Pobursky, and D. L. Mayers. 2002. Genetic diversity and response to IFN of the NS3 protease gene from clinical strains of the hepatitis C virus. Arch. Virol. 147:1385-1406.[CrossRef][Medline]
10
10. Lamarre, D., P. C. Anderson, M. Bailey, P. Beaulieu, G. Bolger, P. Bonneau, M. Bos, D. R. Cameron, M. Cartier, M. G. Cordingley, A. M. Faucher, N. Goudreau, S. H. Kawai, G. Kukolj, L. Lagace, S. R. LaPlante, H. Narjes, M. A. Poupart, J. Rancourt, R. E. Sentjens, R. St George, B. Simoneau, G. Steinmann, D. Thibeault, Y. S. Tsantrizos, S. M. Weldon, C. L. Yong, and M. Llinas-Brunet. 2003. An NS3 protease inhibitor with antiviral effects in humans infected with hepatitis C virus. Nature 426:186-189.[CrossRef][Medline]
11
11. Lin, C., K. Lin, Y. P. Luong, B. G. Rao, Y. Y. Wei, D. L. Brennan, J. R. Fulghum, H. M. Hsiao, S. Ma, J. P. Maxwell, K. M. Cottrell, R. B. Perni, C. A. Gates, and A. D. Kwong. 2004. In vitro resistance studies of hepatitis C virus serine protease inhibitors, VX-950 and BILN 2061: structural analysis indicates different resistance mechanisms. J. Biol. Chem. 279:17508-17514.[Abstract/Free Full Text]
12
12. Lodrini, S., S. Bagaglio, F. Canducci, M. S. De Mitri, P. Andreone, E. Loggi, A. Lazzarin, M. Clementi, and G. Morsica. 2003. Sequence analysis of NS3 protease gene in clinical strains of hepatitis C virus. J. Biol. Regul. Homeost. Agents 17:198-204.[Medline]
13
13. Lu, L., T. J. Pilot-Matias, K. D. Stewart, J. T. Randolph, R. Pithawalla, W. He, P. P. Huang, L. L. Klein, H. Mo, and A. Molla. 2004. Mutations conferring resistance to a potent hepatitis C virus serine protease inhibitor in vitro. Antimicrob. Agents Chemother. 48:2260-2266.[Abstract/Free Full Text]
14
14. Palmer, S., M. Kearney, F. Maldarelli, E. K. Halvas, C. J. Bixby, H. Bazmi, D. Rock, J. Falloon, R. T. Davey, Jr., R. L. Dewar, J. A. Metcalf, S. Hammer, J. W. Mellors, and J. M. Coffin. 2005. Multiple, linked human immunodeficiency virus type 1 drug resistance mutations in treatment-experienced patients are missed by standard genotype analysis. J. Clin. Microbiol. 43:406-413.[Abstract/Free Full Text]
15
15. Peeters, M., and P. M. Sharp. 2000. Genetic diversity of HIV-1: the moving target. AIDS 14(Suppl. 3):S129-S140.
16
16. Shafer, R. W. 2002. Genotypic testing for human immunodeficiency virus type 1 drug resistance. Clin. Microbiol. Rev. 15:247-277.[Abstract/Free Full Text]
17
17. Spira, S., M. A. Wainberg, H. Loemba, D. Turner, and B. G. Brenner. 2003. Impact of clade diversity on HIV-1 virulence, antiretroviral drug sensitivity and drug resistance. J. Antimicrob. Chemother. 51:229-240.[Abstract/Free Full Text]
18
18. Thibeault, D., C. Bousquet, R. Gingras, L. Lagace, R. Maurice, P. W. White, and D. Lamarre. 2004. Sensitivity of NS3 serine proteases from hepatitis C virus genotypes 2 and 3 to the inhibitor BILN 2061. J. Virol. 78:7352-7359.[Abstract/Free Full Text]
19
19. Trozzi, C., L. Bartholomew, A. Ceccacci, G. Biasiol, L. Pacini, S. Altamura, F. Narjes, E. Muraglia, G. Paonessa, U. Koch, R. De Francesco, C. Steinkuhler, and G. Migliaccio. 2003. In vitro selection and characterization of hepatitis C virus serine protease variants resistant to an active-site peptide inhibitor. J. Virol. 77:3669-3679.[Abstract/Free Full Text]

---

Journal of Virology, April 2006, p. 4196-4199, Vol. 80, No. 8
0022-538X/06/$08.00+0     doi:10.1128/JVI.80.8.4196-4199.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Pauwels, F., Mostmans, W., Quirynen, L. M. M., van der Helm, L., Boutton, C. W., Rueff, A.-S., Cleiren, E., Raboisson, P., Surleraux, D., Nyanguile, O., Simmen, K. A. (2007). Binding-Site Identification and Genotypic Profiling of Hepatitis C Virus Polymerase Inhibitors. J. Virol. 81: 6909-6919 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Winters, M. A. Articles by Holodniy, M. Search for Related Content PubMed PubMed Citation Articles by Winters, M. A. Articles by Holodniy, M.