This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Swanson, I.
Right arrow Articles by Golovkina, T. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Swanson, I.
Right arrow Articles by Golovkina, T. V.

 Previous Article  |  Next Article 

Journal of Virology, April 2006, p. 3215-3224, Vol. 80, No. 7
0022-538X/06/$08.00+0     doi:10.1128/JVI.80.7.3215-3224.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Sequences within the gag Gene of Mouse Mammary Tumor Virus Needed for Mammary Gland Cell Transformation

Ingrid Swanson, Brooke A. Jude, Annie R. Zhang, Andrew Pucker,{dagger} Zachary E. Smith, and Tatyana V. Golovkina*

The Jackson Laboratory, 600 Main Street, Bar Harbor, ME 04609

Received 4 September 2005/ Accepted 10 January 2006


arrow
ABSTRACT
 
Previously, we identified a group of replication-competent exogenous mouse mammary tumor viruses that failed to induce mammary tumors in susceptible mice. Sequence comparison of tumorigenic and tumor-attenuated virus variants has linked the ability of virus to cause high-frequency mammary tumors to the gag gene. To determine the specific sequences within the gag gene that contribute to tumor induction, we constructed five distinct chimeric viruses that have various amino acid coding sequences of gag derived from a tumor-attenuated virus replaced by those of highly tumorigenic virus and tested these viruses for tumorigenic capacities in virus-susceptible C3H/HeN mice. Comparing the tumorigenic potentials of these viruses has allowed us to map the region responsible for tumorigenesis to a 253-amino-acid region within the CA and NC regions of the Gag protein. Unlike C3H/HeN mice, BALB/cJ mice develop tumors when infected with all viral variants, irrespective of the gag gene sequences. Using genetic crosses between BALB/cJ and C3H/HeN mice, we were able to determine that the mechanism that confers susceptibility to Gag-independent mammary tumors in BALB/cJ mice is inherited as a dominant trait and is controlled by a single gene, called mammary tumor susceptibility (mts), that maps to chromosome 14.


arrow
INTRODUCTION
 
Many oncogenic retroviruses do not carry an oncogene in their genomes. It is presumed that these viruses induce tumors by up-regulating protooncogene expression, which results from provirus insertion near the protooncogene, a process called insertional mutagenesis (40). Since viral integrations are relatively sequence nonspecific (49), multiple rounds of reinfection and reintegration are required for provirus to land next to the cellular protooncogene and thus induce tumors.

Mouse mammary tumor virus (MMTV) is a B-type retrovirus that induces mammary tumors in mice with high efficiency (9, 16). Like all retroviruses, MMTV carries gag, pol, and env, which encode, respectively, the structural proteins of the virion, reverse transcriptase, and the glycosylated proteins of the viral membrane (16). MMTV can be transmitted as a stably integrated, endogenous provirus (Mtv) or as exogenous virus. Most endogenous Mtvs do not produce infectious virus particles due to mutations in the coding or regulatory regions but can recombine with exogenous viruses to generate new viruses with altered properties (9, 20). Exogenous MMTV is transmitted to suckling pups via the milk and first infects antigen-presenting cells, such as B cells, located in the Peyer's patches of the gastrointestinal tract (21, 22). The MMTV superantigen (SAg), encoded within the 3' long terminal repeat (LTR), is presented by major histocompatibility complex class II molecules expressed on antigen-presenting cells and is recognized by the Vß chain of the T-cell receptor expressed on CD4+ T cells. This results in proliferation of SAg-cognate CD4+ T cells, which subsequently trigger the proliferation of B cells (5, 7, 18, 22). SAg is indispensable to the virus life cycle, as SAg-induced proliferation of target cells is required for integration of the provirus into cellular DNA (23, 56). After proliferation, SAg-cognate T cells undergo deletion, which allows identification of infected mice (34). MMTV is transported by infected lymphocytes to the mammary gland, where the virus causes mammary gland tumors (36).

Based on the clonal nature of MMTV-induced tumors, the viral genome has been used as a tag for identifying genes activated by MMTV insertion. int1, now named Wnt1, was the first protooncogene to be cloned following activation by viral insertion in mammary tumors of all C3H/He mice (i.e., C3H/HeN and C3H/HeJ mice) (39). Even though Wnt1 is not normally expressed in adult mammary tissues, insertional activation leads to up-regulation of this protoncogene in more than 70% of mammary tumors of C3H/He mice (27, 37). int2 was the second gene identified using a similar approach (41). int2, now named Fgf3, is a member of the fibroblast growth factor family and, like Wnt1, is not normally expressed in the cells of mammary glands but is insertionally up-regulated in 50% of mammary tumors of BR6 mice (41). int3, now named Notch4, a member of the Notch family (15), is overexpressed in a number of MMTV-induced mammary tumors due to rearrangement caused by provirus insertion (3). The oncogenic properties of Wnt1, Fgf3, and Notch4 hav been proven using transgenic mice; Wnt1, int2/Fgf3, and int3/Notch4 transgenic mice developed mammary tumors when transgenic expression was directed by the MMTV LTR (25, 28, 51, 55).

Thus, many genes and pathways have been discovered using MMTV-induced tumors; however, none can fully explain the high rate of mammary tumors in the MMTV system. Indeed, even though all cells in the mammary glands of Wnt1 transgenic mice express Wnt1, only a few tumors develop per mouse (55). In addition, these mice have relatively delayed onset of tumor development. Furthermore, Wnt1/Fgf3 bitransgenic mice demonstrated only a slight acceleration in tumor development (47), suggesting that cooperation between oncogenes does not provide a convincing explanation for the high rate of tumors in MMTV-infected mice.

The hypothesis that a virus-encoded gag gene may contribute to the tumorigenicity of MMTV originated from studies of a genetically engineered hybrid MMTV provirus (HP) (48), which was used to make transgenic mice on a C3H/HeN background (17). The 5' LTR, gag, and part of the pol gene of HP are derived from endogenous, tumor-attenuated Mtv1 (48). The rest of the pol gene, env, and the 3' LTR come from the exogenous, tumorigenic wild-type virus, designated MMTV(C3H). HP transgenic C3H/HeN mice secreted infectious virus into milk at titers similar to those in mice infected with wild-type MMTV(C3H) (24). However, the HP virus was tumor attenuated, as C3H/He mice infected with HP rarely developed tumors compared to C3H/He mice infected with MMTV(C3H), even though both virus variants were capable of up-regulating cellular protooncogenes (24).

Like HP, another known viral variant, MMTV(HeJ), carried by C3H/HeJ mice, is tumor attenuated in all C3H/He mice (26). By comparing the sequences of MMTV(C3H), HP, and MMTV(HeJ), it was found that both HP and MMTV(HeJ) tumor-attenuated viruses have gag genes derived from endogenous, tumor-attenuated Mtv1 (26). Therefore, our data suggested that the virus-encoded Gag protein is also required in MMTV-induced cellular transformation.

Although Gag plays many roles in the life cycle of the virus, its contribution to mammary tumorigenesis was not known. Thus, the aim of this study was to identify the specific Gag product that participates in tumor induction and to elucidate the mechanism by which Gag promotes mammary tumors.


arrow
MATERIALS AND METHODS
 
Mice. All of the mice used in this study were bred and maintained at the animal facility of The Jackson Laboratory, Bar Harbor, Maine. BALB/cJ and C3H/HeJ mice were obtained from The Jackson Laboratory. C3H/HeN MMTV+ and MMTV mice were originally obtained from the National Cancer Institute, Frederick Cancer Research Facility, Frederick, MD. MMTV HP transgenic mice were made on a C3H/HeN genetic background (17).

MMTV variants. MMTV variants include MMTV(C3H), carried by C3H/HeN MMTV+ mice; MMTV(HeJ), carried by C3H/HeJ MMTV+ mice; HP, produced by C3H/HeN HP transgenic mice; and A, B, C, D, and F chimeric viruses, genetically engineered viruses described below.

Cloning of chimeric viruses. We constructed five different chimeric MMTV proviruses in the context of the previously described plasmid, pHP (48), which produces tumor-attenuated hybrid MMTV (24). The 5' half of this plasmid is derived from endogenous tumor-attenuated Mtv1 and includes the 5' LTR, gag, pro, and part of the pol gene; the 3' half is derived from exogenous tumorigenic MMTV(C3H) and includes the rest of the pol gene, the env gene, and the 3' LTR. We subcloned the 5' EcoRI fragment of pHP (containing the 5' LTR, gag, and a part of the pol gene) in the EcoRI site of the pBlueScript II(+/–) plasmid with an inactivated XbaI site (pBS; the 5' half of HP) (Fig. 1). Derivatives of pHP encoding mutant Gags were constructed by PCR mutagenesis using primers that substitute the Mtv1 gag sequences for sequences in the gag gene of MMTV(C3H). As a template, we used either a plasmid encoding tumor-attenuated Mtv1 Gag or a plasmid encoding tumorigenic MMTV(C3H) Gag (24). After PCR amplification, the resultant DNA sequences were cleaved at the KasI and NcoI, NcoI and XbaI, or KasI and XbaI sites and inserted into the pBS 5' half of HP cleaved with corresponding enzymes (Fig. 1). Plasmids containing inserts were sequenced to confirm mutations. The EcoRI fragments of selected plasmids were used to replace a corresponding fragment in pHP. As a result, a set of five mutants in the context of pHP was generated (Fig. 2). Expression of engineered proviruses was confirmed by transfecting corresponding plasmids into normal murine mammary gland (NMuMG) cells (American Type Culture Collection), followed by staining with anti-Env and anti-Gag monoclonal antibodies (43).


Figure 1
View larger version (25K):
[in this window]
[in a new window]
 
FIG. 1. Strategy for making chimeric viruses. (A) The 5' half of pHP was subcloned into the EcoRI site of pBS (Stratagene) with an inactivated XbaI site. The gag gene coding region is located between the KasI and XbaI sites. This region is shown enlarged below, with the positions for the MA, CA, and NC domains and amino acid differences between MMTV(C3H) and Mtv1/MMTV(HeJ). Primers AF, BR, CF, CR, DF, DR, EF, ER, NcoIF, and NcoIR were used for PCR-directed mutagenesis, as described in Materials and Methods, to replace Mtv1-specific sequences within the gag gene by MMTV(C3H) gag-specific sequences. Either the gag gene of Mtv1 or the gag gene of MMTV(C3H) was used as a template. Primers AF and BR include sites for KasI and XbaI, respectively, whereas primers NcoIF and NcoIR include a site for NcoI. (B) An example of the PCR-directed mutagenesis performed with primers AF, CF, CR, and BR is shown. The KasI-XbaI fragment of the pBS 5' half of the HP plasmid is replaced by the corresponding fragment of the PCR product, resulting in substitution of I to N and G to H. Abbreviations: P, PstI; E, EcoRI; K, KasI, X, XbaI; N, NcoI; nt, nucleotide; aa, amino acids; crossed X, inactive XbaI site; crossed E, inactive EcoRI site.


Figure 2
View larger version (27K):
[in this window]
[in a new window]
 
FIG. 2. Distinct chimeric MMTV variants are equally infectious in both C3H/HeN and BALB/cJ mice. (A) (Left) Amino acid sequence comparison between gene products of different chimeric viruses, gag of Mtv1 and gag of MMTV(C3H). Amino acid differences between gag gene products are indicated with respect to their positions within gag. Conservative amino acid differences are depicted in black and white, and nonconservative amino acid differences are shown in color. Chimeric viruses were engineered by replacing amino acids of Mtv1 (white) with those of MMTV(C3H) (black). (Right) Tumorigenic potentials of chimeric viruses in BALB/cJ and C3H/HeN mice. The mice (some are also shown in panel B) were fostered on the milk of viremic mothers and monitored for mammary gland tumors by weekly palpation. The percentages of mice that had developed mammary gland tumors by 240 days are shown (n > 30 mice per group). (B) Latencies of tumor development in C3H/HeN and BALB/cJ mice infected with MMTV(C3H), virus A, and virus C. (C) Mammary glands of C3H/HeN and BALB/cJ mice are equally susceptible to infection with all chimeric viruses. RNA isolated from lactating mammary glands of infected BALB/cJ or C3H/HeN mice (fostered on G2-infected BALB/cJ females) after the first pregnancy was subjected to RNase T1 protection analysis with the probe specific for the LTR region of MMTV(C3H). The smaller fragments observed with RNAs from infected and uninfected lactating mammary glands of C3H/HeN and BALB/cJ mice correspond to RNAs produced by endogenous Mtv1 and Mtv6 (20, 45). (D) BALB/cJ and C3H/HeN mice infected with different chimeric viruses secret comparable virus titers into milk. Viral particles were pelleted from milk isolated from BALB/cJ or C3H/HeN mice infected with chimeric viruses. Western blot analysis was performed with similar amounts of virion (Vir) proteins using anti-p27 CA monoclonal antibodies (43). Also shown are milk samples from uninfected mice (–) and from mice infected with wild-type MMTV(C3H) (+). The secondary antibody was goat anti-mouse horseradish peroxidase conjugate. B, BALB/cJ; C, C3H/HeN.

The primers used were as follows: AF, 5'AGCTGGCGCCCGAACAGGGACCCTCGG3'; BR, 5'GATACTCCATCTTCTAGAGAGAGG3'; CF, 5'GAAAAGAAAATAGTGAGCATAAGAG3'; CR, 5'CTCTTATGCCTATTTTCTTTTC3'; DF, 5'GGTGGATAAGAAAAAACCTCTGGCACTC3'; DR, 5'GAGTGCCAGAGGTTTTTTCTTATCCACC3'; EF, 5'GGGCTCCTCCTGGGCTTTGTCCC3'; ER, 5'GGGACAAAGCCCAGGAGGAGCCC3'; NcoI F, 5'GGCGGTTAAGACCATGGGACC3'; and NcoI R, 5'GGTCCCATGGTCTTAACCGCC3'.

Southern blot analysis. Mammary gland tumors were excised from the surrounding normal tissue, and DNA was isolated as previously described (20). Twenty micrograms of each DNA sample was digested with the indicated restriction enzymes and electrophoresed on 0.8% agarose gels. After transfer to nylon membranes, the blots were hybridized with a 32P-labeled gag-pol probe (20). The results of the experiments were quantified with a phosphorimager (Bio-Imaging analyzer BAS 1000 MacBas; Fuji Photo Film Co., Ltd.).

RNA isolation and Northern blot analysis. RNA was isolated from mammary gland tumors and from NMuMG cells transfected with plasmids encoding distinct chimeric viruses as described previously (6). Twenty micrograms of total RNA was subjected to electrophoresis on a 1% agarose-formaldehyde gel, transferred to a nylon membrane, and hybridized with an LTR-specific probe (31).

RNase T1 protection analysis. Forty micrograms of RNA isolated from lactating mammary glands was used for RNase T1 protection analysis with a MMTV(C3H) LTR-specific probe as described previously (20). The results were visualized by autoradiography using Kodak BioMax XAR films (Kodak, Rochester, NY).

Western blot analysis. Solidified milk was isolated from the stomachs of 1- to 2-day-old BALB/cJ and C3H/HeN mice suckled on milk containing different chimeric viruses, diluted in 10 volumes of phosphate-buffered saline (PBS) containing 1 mM EDTA, and centrifuged at 2,000 x g for 15 min at 4°C. The skim milk was centrifuged at 95,000 x g for 1 h at 4°C, followed by centrifugation through a 30% sucrose-PBS cushion at 95,000 x g for 1 h at 4°C. Virion pellets were resuspended in PBS and subjected to Western blot analysis. Viral proteins were incubated with monoclonal anti-MMTV p27CA antibodies (43), followed by incubation with goat anti-mouse immunoglobulin G conjugated to horseradish peroxidase (Bio-Rad Laboratories, Hercules, CA). Detection was performed with Western blotting detection reagents (Amersham Pharmacia Biotech, Inc., Piscataway, NJ).

Mammary gland tumorigenesis. The mammary gland tumor incidence was monitored by weekly palpation. Tumor-bearing mice were sacrificed, and the tumor masses were excised from surrounding normal tissues. For C3H/HeN or BALB/cJ mice infected with chimeric viruses, DNA isolated from a portion of each tumor was subjected to a Southern blot analysis that distinguished between integrated exogenous and endogenous MMTVs (20, 48). DNA isolated from the spleens of tumor-bearing and tumor-resistant [(BALB/cJ x C3H/HeN)F1 x C3H/HeN]N2 or (B x C)N2 females was subjected to PCR using MIT markers. "Susceptible mice" refers to mice that developed a mammary gland tumor(s) by 1 year of age, whereas "resistant mice" refers to mice that did not develop tumors by that time.

Fluorescence-activated cell sorter analysis. Peripheral blood lymphocytes were isolated from blood samples by centrifugation through a Ficoll-Hypaque cushion. Leukocytes were stained concurrently with anti-Vß14 T-cell receptor fluorescein isothiocyanate-conjugated monoclonal antibodies (BD Biosciences) and anti-CD4 phycoerythrin-conjugated antibodies (Sigma). Stained lymphocytes were analyzed using a FACScan (Becton Dickinson) flow cytometer and the CELLQuest software program.

A genomewide screen using simple sequence length polymorphisms. High-molecular-weight genomic DNA isolated from the spleens of MMTV(HeJ)-infected tumor-susceptible and tumor-resistant (B x C)N2 mice was resuspended at 50 ng/µl in 2 mM Tris-HCl, pH 8.0, containing 0.01 M EDTA, and 2.5 µl was used for PCR with primers for DNA microsatellite markers polymorphic between BALB/cJ and C3H/HeN strains according to protocols published elsewhere (12). The data were analyzed using Map Manager software version QTb2968k (32).


arrow
RESULTS
 
Mapping of the determinants within Gag involved in attenuation of MMTV-induced mammary tumors. Previous studies have implicated the MMTV(C3H) Gag protein in tumorigenesis (24). The Gag polyprotein is processed into MA, CA, NC, and three smaller proteins of unknown function (p3, p8, and pp21) (8, 35). The Gag protein of the wild-type MMTV(C3H) differs from the Gag protein of endogenous, tumor-attenuated Mtv1 at 14 amino acid positions (24) (Fig. 2A). Nine of these differences are conservative, and five are nonconservative. Three amino acid differences are located in pp21, one in p3, two in p8, five within CA, and three within NC (Fig. 2A). To determine which amino acids are critical for tumorigenesis, chimeric MMTV proviruses containing regions of the MMTV(C3H) gag gene in the context of pHP (48) were constructed (Fig. 2A). pHP encodes a tumor-attenuated Mtv1/MMTV(C3H) hybrid MMTV with the gag gene derived from Mtv1 (24). Using PCR-directed mutagenesis, amino acids of the Mtv1 gag gene product were substituted for those of the MMTV(C3H) gag gene product, thus generating five chimeric proviruses (Fig. 2A). Virus A contains the entire polymorphic region of gag derived from MMTV(C3H) superimposed on pHP. Viruses B and C contain a combination of conservative and nonconservative amino acid substitutions, whereas viruses D and F contain only nonconservative amino acid substitutions (Fig. 2A). Plasmids carrying chimeric viruses were stably transfected into NMuMG cells. Western blot analyses with capsid-specific monoclonal antibodies verified that viral proteins were produced in transfected cells (not shown).

To ensure that chimeric MMTVs were infectious, we infected 3- to 4-week-old susceptible BALB/cJ females with viruses isolated from supernatants of different transfected cells by injecting the viruses directly into the mammary glands, as described previously (19). To determine whether the injected mice were MMTV infected, they were bled (5 weeks after infection), and the percentage of CD4+/Vß14+ T cells among CD4+ T cells was determined by fluorescence-activated cell sorter analysis. All animals showed deletion of SAg-cognate T cells (not shown), indicating that all animals were MMTV infected.

BALB/cJ mice infected with distinct chimeric viruses were bred to produce generation 2 (G2) of infected mouse pedigrees. To compare tumorigenicity of the chimeric MMTVs, C3H/HeN mice and control BALB/cJ mice were foster nursed by infected BALB/cJ mice from G2. To evaluate titers of different viruses, we isolated RNA from lactating mammary glands of infected BALB/cJ C3H/HeN mice and subjected it to RNase protection analysis with a probe specific for the SAg region that is identical among all of the viruses (Fig. 2C) (20). Similarly, virions were purified from milk virus fractions and virion proteins were analyzed by Western blotting using monoclonal antibodies against MMTV proteins (Fig. 2D). These experiments established that all fostered animals produced similar virus titers.

Mice infected with chimeric viruses were bred and monitored for mammary tumors. Whereas BALB/cJ mice were susceptible to mammary tumors induced by all chimeric viruses, only virus C- and virus A-infected C3H/HeN mice developed high-frequency mammary tumors (Fig. 2A and B). To confirm that the tumors were induced by chimeric viruses, the tumor masses were excised from the surrounding normal tissues, and DNA was extracted and subjected to Southern blot analysis that distinguished between integrated exogenous and endogenous viruses (20) (Fig. 3). The results indicated that all tumors were induced by chimeric viruses, as the tumors contained specific fragments characteristic of the chimeric viruses with which the animals were infected (Fig. 3A and B).


Figure 3
View larger version (49K):
[in this window]
[in a new window]
 
FIG. 3. All mammary tumors are induced by exogenous viruses. (A) Map of endogenous Mtvs and exogenous MMTV(C3H) and HP proviruses. Endogenous Mtv1, -8, and -11 from BALB/cJ and C3H/HeN mice show characteristic bands of 3.0 kb and 2.1 kb, whereas Mtv9, inherited by BALB/cJ mice, demonstrates an additional band of 2.7 kb. DNA samples containing integrated exogenous proviruses exhibit an additional band of 2.3 kb. The CA region of MMTV(C3H) gag, but not of Mtv1 gag, contains a PstI site, which results in a 1.5-kb fragment upon digestion. This PstI site is also present in chimeric viruses A and C but is absent in chimeric viruses B, D, and F. (B) DNA was isolated from mammary gland tumors of mice infected with chimeric viruses, digested with BglII and PstI, and subjected to Southern blot analysis using a DNA probe which spans the gag-pol region, as shown in panel A. Also shown are DNA samples from spleens of uninfected BALB/cJ and C3H/HeN mice.

The occurrence of mammary tumors in C3H/HeN mice infected with virus A validated once more our initial hypothesis that the Gag protein is essential for tumorigenicity of wild-type MMTV(C3H) in C3H/HeN mice, since replacement of the Mtv1 gag gene in the tumor-attenuated HP by the gag gene from tumorigenic MMTV(C3H) converted a tumor-attenuated virus (HP) into one capable of causing tumors (virus A) (Fig. 2A). Furthermore, because virus C caused tumors and virus F did not, these results also allowed us to identify sequence within CA and NC that is critical for tumor induction (Fig. 2A).

Chimeric proviruses produce no detectable alternatively spliced RNAs. In addition to nucleotide changes which result in amino acid substitutions, tumorigenic and tumor-attenuated MMTV variants also have nucleotide differences which do not cause amino acid changes (silent mutations) (24). Silent mutations may increase the expression of a downstream oncogene either by generating a cryptic splice site (44) or by inhibiting a repressor of splicing and readthrough (52). However, this event occurs when the provirus and the affected gene are in the same orientation. This is not the case for MMTV, because the vast majority of mammary tumors induced by both highly tumorigenic and tumor-attenuated MMTV variants contain proviruses integrated upstream or downstream of the oncogene in the opposite-to-transcription orientation (42, 47) in both BALB/cJ (33, 47) and C3H/HeN mice (38).

Silent mutations may also generate an alternative splice site, resulting in a new protein, which can ultimately affect viral replication/integration (10). To investigate whether the gag gene from tumorigenic MMTV(C3H) contains alternative splice site(s), viral RNA transcripts produced by NMuMG cells stably transfected with either wild-type MMTV(C3H) or chimeric viruses were analyzed by Northern blotting using an LTR-specific probe (Fig. 4). These experiments did not identify any dissimilarities in splicing or levels of major viral transcripts (Fig. 4). Reverse transcription-PCR analysis did not detect any minor alternatively spliced forms generated from integrated chimeric viruses compared to MMTV(C3H) (not shown). Therefore, it is unlikely that silent mutations account for phenotypic differences between distinct MMTV variants.


Figure 4
View larger version (61K):
[in this window]
[in a new window]
 
FIG. 4. Chimeric viruses contain no alternative or cryptic splice sites. RNA isolated from NMuMG cells transfected with chimeric viruses or infected with MMTV(C3H) (left), as well as RNA isolated from mammary gland tumors (MGT) of C3H/HeN mice infected with chimeric viruses or MMTV(C3H) (right), was subjected to Northern blot analysis using a probe specific for the viral LTR. The sizes of RNA transcripts corresponding to genomic, subgenomic, and fully spliced viral RNAs are indicated. The blots were exposed for 2 h, or for 20 min for the light exposure shown on the left. Expression of endogenous Mtvs (right) is not seen due to a short exposure. The ethidium bromide agarose gel was photographed to verify the integrity of the RNA (bottom). 18S and 28S, ribosomal subunits.

The cellular mechanism that confers susceptibility to tumors induced by tumor-attenuated MMTV variants in BALB/cJ mice is dominant and is controlled by a single gene. As described above, BALB/cJ mice develop tumors when infected with all MMTV variants. In contrast, C3H/HeN mice developed tumors only when infected with MMTV(C3H) or chimeric virus A or C (Fig. 2A). These findings imply that certain host-derived genes facilitate Gag-dependent mammary gland tumors in C3H/HeN mice and that these genes have polymorphic differences in BALB/cJ and C3H/HeN mice. To determine whether the susceptibility to mammary tumors in BALB/cJ mice induced by attenuated viruses is inherited as a dominant or a recessive trait, BALB/cJ females were crossed with C3H/HeN males, and the resultant F1 generation females were infected with tumor-attenuated MMTV(HeJ) or HP via foster nursing and screened for mammary tumors. These mice proved to be as susceptible to tumors induced by MMTV(HeJ) as the parental BALB/cJ mice (Fig. 5), indicating that the mechanism that confers susceptibility to tumors induced by tumor-attenuated MMTVs on BALB/cJ mice is inherited as a dominant trait.


Figure 5
View larger version (16K):
[in this window]
[in a new window]
 
FIG. 5. Mammary gland tumor incidence in BALB/cJ, C3H/HeN, and (B x C)F1 females infected with MMTV(C3H), MMTV(HeJ), or HP. The mice were fostered on the milk of viremic mothers and monitored for mammary gland tumors by weekly palpation.

Viremic F1 females were then backcrossed to resistant C3H/HeN males to determine whether the tumor susceptibility is inherited according to Mendelian law. The resultant N2 females were monitored for mammary tumors. Whereas 161/350 females (46%) developed mammary gland tumors within 365 days, 189/350 (54%) did not. This ratio indicates that the mechanism that confers susceptibility to tumors induced by tumor-attenuated viruses on BALB/cJ mice is under the control of a single gene, here called mammary tumor susceptibility, or mts.

Phenotyping was followed by a genomewide screen using simple sequence length polymorphism analysis to find an association between the susceptible phenotype and a BALB/cJ-derived chromosome (50). Flanking sequence information was obtained from the MIT database (50) and from the Mouse Genome Database. To map the location of mts, a genomewide screen was performed on 100 susceptible and 100 resistant N2 mice with polymorphic markers separated by 10 to 35 Mb. Strong evidence of linkage was found on chromosome 14. mts maps to a 33-Mb region between D14Mit2 and D14Mit5, as the percentages of resistant N2 mice (that failed to develop tumors by 365 days) homozygous for C3H/HeN within the indicated interval and the percentage of susceptible N2 mice (that developed tumors by 365 days) heterozygous for C3H/HeN and BALB/cJ within the same interval (not shown) peaked between these two markers (Fig. 6).


Figure 6
View larger version (16K):
[in this window]
[in a new window]
 
FIG. 6. Haplotype map of (B x C)N2 resistant mice. DNA was isolated from the spleens of resistant (B x C)N2 mice and subjected to a genomewide scan with MIT markers spaced at 15- to 35-Mb intervals throughout the genome. The columns of boxes show genotypes of N2 animals. The number under each column signifies the number of N2 mice analyzed that had the genotype indicated by the column. Each row of boxes represents the mouse genotype at the indicated location on chromosome 14. The corresponding MIT marker used for genotyping is shown for each location. Black box, heterozygous for BALB/cJ and C3H/HeN; open box, homozygous for C3H/HeN. The percentages on the left are the results of the following equation: a/b x 100%, where a is the number of mice homozygous for C3H/HeN between the markers shown and b is the total number of mice. These percentages identify the hypothetical locations of the mts gene. "Resistant" mice with the BALB/cJ-derived chromosome 14 could be explained by a phenotype that is not fully penetrant, since ~20% of susceptible F1 mice do not develop mammary tumors within 300 days (Fig. 5). The linkage was confirmed by genotyping more (B x C)N2 susceptible mice (n > 200; not shown).


arrow
DISCUSSION
 
It is widely assumed that MMTV induces tumors by acting as an insertional mutagen that activates the expression of cellular protooncogenes. However, the median latency of mammary tumor formation in female mice transgenic for the Wnt1 oncogene was 5 months of age, with >80% of mice developing tumors by 7 months (55). In addition, transgenic females rarely developed >1 tumor per mouse and never developed >3 tumors per mouse (55). This relatively long latency to tumor development and the stochastic nature of mammary tumors in Wnt1 transgenic mice argues that Wnt1 contributes to, but is not sufficient for, tumorigenesis in these mice. Therefore, events in addition to oncogene expression are necessary for mammary tumor development. These experiments demonstrate unequivocally that the region of the MMTV Gag protein that differs between MMTV(C3H) and Mtv1 is involved in mammary tumorigenesis, since replacing the polymorphic region in Mtv1 Gag with that from MMTV(C3H) Gag was sufficient to convert the tumor-attenuated hybrid MMTV into a virus with high tumorigenic potential (Fig. 2A).

Whereas virus A has most of its sequences derived from tumorigenic MMTV(C3H) gag, including pp21, p3, p8, CA, and part of NC (CA/NC), virus C and virus B have CA/NC and pp21, p3, and p8 MMTV(C3H) gag sequences, respectively (Fig. 2A). Unlike virus A, which induces mammary tumors in 64% of infected C3H/HeN females by 250 days [similar to wild-type MMTV(C3H)], virus C induces tumors in only 31% of infected C3H/HeN females, and less than 10% of the mice succumbed to tumors when infected with virus B within the same period of time. Even though virus C does not induce mammary tumors with the same frequency as virus A [or MMTV(C3H)], the latency of virus C-induced tumors appears to be similar to the latencies of tumors induced by virus A and MMTV(C3H) (Fig. 2B). Two conclusions can be drawn from these results. First, the determinants of the tumorigenic capacity of the virus lie within the CA/NC sequences. Second, the pp21, p3, and p8 sequences are not required for tumor induction. However, it remains possible that the pp21, p3, and p8 sequences, together with CA/NC sequences, might accelerate gag-dependent tumorigenicity.

How can we explain the low frequency of mammary tumors in C3H/HeN mice infected with tumor-attenuated viruses B, D, and HP (Fig. 2A)? Our working hypothesis suggests that Gag accelerates mammary tumor development by cooperating with cellular protooncogenes, as tumors with low incidence arise in MMTV-free transgenic mice constitutively expressing protooncogenes in the mammary glands (55). Therefore, spontaneous mutations that activate the pathways affected by Gag could result in the low incidence of tumor development in mice infected with tumor-attenuated viruses.

Using genetic crosses between susceptible and resistant mice, we established that a single gene, mts, mapped to chromosome 14, determines the susceptibility of BALB/cJ mice to tumors induced by tumor-attenuated viruses.

Based on our preliminary data, we propose two models that could explain Gag/MTS cooperation in mammary tumor development. According to the first model (Fig. 7A), Gag binds directly to MTS, and this results in a signal transduction that cooperates with protooncogenes in mammary tumorigenesis. Due to allelic variance, BALB/cJ MTS can bind to either Mtv1 or MMTV(C3H) Gag, whereas C3H/HeN MTS can bind only to MMTV(C3H) Gag, and not to Mtv1 Gag (Fig. 7).


Figure 7
View larger version (18K):
[in this window]
[in a new window]
 
FIG. 7. Model of how MTS may contribute to the induction of mammary tumors. MTS may contribute directly (A) or indirectly (B) to the induction of tumors by MMTV. MTS of the BALB/cJ origin may interact with both Gags in a similar fashion, whereas MTS of the C3H/HeN origin interacts only with MMTV(C3H) Gag (C). Since susceptibility to mammary tumors is a dominant trait, one BALB/cJ allele of the mts gene is necessary and sufficient to confer susceptibility of (B x C)F1 mice to mammary tumors.

According to the second model (Fig. 7B), Gag binds to an unknown protein (factor X), and this binding activates MTS (most likely at the protein level). In this scenario, activation of C3H/HeN MTS requires a "stronger signal" (for example, high-affinity interaction) than does activation of BALB/cJ MTS. Engagement of factor X with MMTV(C3H) Gag, but not with Gag of Mtv1, fulfills this requirement in C3H/HeN mice. Because of the allelic difference, activation of BALB/cJ MTS does not require the same threshold of Gag/factor X interaction and thus could be induced in response to the Gag protein of Mtv1, as well as to the Gag protein of MMTV(C3H). However, we acknowledge that the situation may be more complex than the one described in Fig. 7. Since BALB/cJ mice are susceptible to tumors induced by all MMTV variants and C3H/HeN mice develop tumors only when infected with MMTV-encoding tumorigenic Gag [like MMTV(C3H)], one may infer that BALB/cJ MTS cooperates with both tumorigenic and tumor-attenuated Gags, whereas MTS of C3H/HeN origin is sufficiently activated only by a tumorigenic Gag (Fig. 7C). The induction of tumors by MMTV is not required for virus transmission and is a by-product of viral replication, indicating that the interplay between Gag and MTS may have some primary functions in the viral life cycle.

The primary function of Gag in all retroviruses is to produce all internal structural proteins. In addition, the MA protein of Gag demonstrates a nuclear export activity important for transporting unspliced viral RNA to the plasma membrane (13). Finally, Gag proteins are the central players in the process of virion assembly (53).

The complex and diverse activities of the Gag protein raise the possibility that Gag might interact with distinct cellular factors. The first evidence for interaction between Gag and host proteins was provided by studies of FV1, a dominant genetic host protein that limits the efficiency of integration of certain strains of murine leukemia viruses (46). Viral sensitivity to this restriction is determined by sequences coding for CA (11). A cellular factor that interacts with the Gag protein of murine leukemia virus has recently been cloned (2). The gene contains a single intronless open reading frame with sequence similarity to the gag gene of the ERV-L family of mouse and human endogenous retroviruses. Even though it remains unknown how FV1 blocks virus infection, one possibility is that the incoming virus is trapped by FV1 in a cytosol and is thus prevented from being transported into the nucleus. The human immunodeficiency virus CA protein was shown to interact with members of the cyclophilin family (30). Mutations in the CA domain that abolish interaction with cyclophilin disrupt its incorporation into virions and preclude viral replication (29). In mice, the activities of Gag are necessary and sufficient to induce immune system abnormalities in a syndrome designated mouse AIDS (1, 4). The Pr60gag protein of the defective component of the mouse AIDS complex promotes the proliferation of infected target B cells and is responsible for inducing a severe immunodeficiency disease. Using the yeast two-hybrid system, the SH3 domain of the ABL1 oncogene product was identified as interacting with the proline-rich p12 domain of Pr60gag (14). Overexpression of Pr60gag in these cells led to a detectable increase in the levels of ABL1 protein and to its translocation to the cell membrane. These results suggest that this viral Gag serves as a docking site for signaling molecules and that Abl1 may be involved in the proliferation of infected B cells. Gag proteins of Mason-Pfizer monkey virus, simian immunodeficiency virus, and human immunodeficiency virus type 1 have been found in association with a cellular motor protein, KIF4 (54). It was suggested that KIF4 might be involved in the transport of Gag proteins in retrovirus-infected cells. Therefore, it is clear that diverse Gag-orchestrated retrovirus functions have the potential to interfere with numerous cellular pathways.

Retrovirus-induced tumors recapitulate pathways involved in the induction of tumors of other etiologies and thus provide a valuable model for the study of tumor induction in general. As already mentioned, cellular oncogenes, such as members of the Wnt and Fgf families, as well as ras, abl, erbB, and myc, were originally identified in retrovirus-infected systems. Up-regulation of these oncogenes undoubtedly plays an important role in retrovirus-induced tumorigenesis. However, the induction of tumors, both spontaneous and of viral origin, always requires multiple steps. Our data suggest that the MMTV-encoded Gag protein plays a critical role in the induction of tumors by MMTV. The discovery that retrovirus-encoded proteins contribute to virus-induced tumors is also pertinent to other retroviruses, as recent findings involving Jaagsiekte sheep retrovirus implicate Env of Jaagsiekte sheep retrovirus in the induction of lung cancer in sheep (57). Determination of the mechanisms by which retrovirus-encoded proteins contribute to tumor induction will help to identify cellular pathways that are involved in tumorigenesis in general.


arrow
ACKNOWLEDGMENTS
 
We are thankful to members of the laboratory, to Alexander Chervonsky for helpful discussion, and to Sara Williams for the graphics work.

This work was supported in part by Public Health Service grant CA100383 from the National Cancer Institute to T.V.G. The work was also supported by a grant (CA34196) from the National Cancer Institute to The Jackson Laboratory.


arrow
FOOTNOTES
 
* Corresponding author. Present address: Department of Microbiology, University of Chicago, 920 E. 58th Street, Chicago, IL 60637. Phone: (773) 834-7988. Fax: (773) 834-8150. E-mail: tgolovki{at}bsd.uchicago.edu. Back

{dagger} Present address: Department of Microbiology, University of Chicago, 920 E. 58th Street, Chicago, IL 60637. Back


arrow
REFERENCES
 
    1
  1. Aziz, D. C., Z. Hanna, and P. Jolicoeur. 1989. Severe immunodeficiency disease induced by a defective murine leukaemia virus. Nature 338:505-508.[CrossRef][Medline]
  2. 2
  3. Best, S., P. Le Tissier, G. Towers, and J. P. Stoye. 1996. Positional cloning of the mouse retrovirus restriction gene Fv1. Nature 382:826-829.[CrossRef][Medline]
  4. 3
  5. Callahan, R., and G. H. Smith. 2000. MMTV-induced mammary tumorigenesis: gene discovery, progression to malignancy and cellular pathways. Oncogene 19:992-1001.[CrossRef][Medline]
  6. 4
  7. Chattopadhyay, S. K., H. C. D. Morse, M. Makino, S. K. Ruscetti, and J. W. Hartley. 1989. Defective virus is associated with induction of murine retrovirus-induced immunodeficiency syndrome. Proc. Natl. Acad. Sci. USA 86:3862-3866.[Abstract/Free Full Text]
  8. 5
  9. Chervonsky, A. V., J. Xu, A. K. Barlow, M. Khery, R. A. Flavell, and C. Janeway, Jr. 1995. Direct physical interaction involving CD40 ligand on T cells and CD40 on B cells is required to propagate MMTV. Immunity 3:139-146.[CrossRef][Medline]
  10. 6
  11. Chirgwin, J. M., A. E. Prxybyla, R. J. MacDonald, and W. J. Rutter. 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18:5294-5299.[CrossRef][Medline]
  12. 7
  13. Choi, Y., J. W. Kappler, and P. Marrack. 1991. A superantigen encoded in the open reading frame of the 3' long terminal repeat of the mouse mammary tumor virus. Nature 350:203-207.[CrossRef][Medline]
  14. 8
  15. Coffin, J. M., S. H. Hughes, and H. E. Varmus (ed.). 1997. Retroviruses. Cold Spring Harbor Press, Cold Spring Harbor, N. Y.
  16. 9
  17. Coffin, J. M. 1996. Retroviridae: the viruses and their replication, p. 763-844. In B. N. Fields, P. M. Howley, and D. M. Knipe (ed.), Fundamental virology, 3rd ed. Raven Press, New York, N.Y.
  18. 10
  19. Dejardin, J., G. Bompard-Marechal, M. Audit, T. J. Hope, M. Sitbon, and M. Mougel. 2000. A novel subgenomic murine leukemia virus RNA transcript results from alternative splicing. J. Virol. 74:3709-3714.[Abstract/Free Full Text]
  20. 11
  21. DesGroseillers, L., and P. Jolicoeur. 1983. Physical mapping of the Fv-1 tropism host range determinant of BALB/c murine leukemia viruses. J. Virol. 48:685-696.[Abstract/Free Full Text]
  22. 12
  23. Dietrich, W., H. Katz, S. E. Lincoln, H. S. Shin, J. Friedman, N. C. Dracopoli, and E. S. Lander. 1992. A genetic map of the mouse suitable for typing intraspecific crosses. Genetics 131:423-447.[Abstract]
  24. 13
  25. Dupont, S., N. Sharova, C. DeHoratius, C. M. Virbasius, X. Zhu, A. G. Bukrinskaya, M. Stevenson, and M. R. Green. 1999. A novel nuclear export activity in HIV-1 matrix protein required for viral replication. Nature 402:681-685.[CrossRef][Medline]
  26. 14
  27. Dupraz, P., N. Rebai, S. J. Klein, N. Beaulieu, and P. Jolicoeur. 1997. The murine AIDS virus Gag precursor protein binds to the SH3 domain of c-Abl. J. Virol. 71:2615-2620.[Abstract]
  28. 15
  29. Gallahan, D., C. Kozak, and R. Callahan. 1987. A new common integration region (int-3) for mouse mammary tumor virus on mouse chromosome 17. J. Virol. 61:218-220.[Abstract/Free Full Text]
  30. 16
  31. Goff, S. P. 2001. Retroviruses and thier replication, p. 843-912. In D. M. Knipe and P. M. Howley (ed.), Fundamental virology, 4th ed. Lippincott Williams & Wilkins, Philadelphia, Pa.
  32. 17
  33. Golovkina, T. V., A. Chervonsky, J. C. Prescott, C. A. Janeway, and S. R. Ross. 1994. The mouse mammary tumor virus envelope gene product is required for superantigen presentation to T cells. J. Exp. Med. 179:439-446.[Abstract/Free Full Text]
  34. 18
  35. Golovkina, T. V., A. V. Chervonsky, J. P. Dudley, and S. R. Ross. 1992. Transgenic mouse mammary tumor virus superantigen expression prevents viral infection. Cell 69:637-645.[CrossRef][Medline]
  36. 19
  37. Golovkina, T. V., J. P. Dudley, and S. R. Ross. 1998. B and T cells are required for mouse mammary tumor virus spread within the mammary gland. J. Immunol. 161:2375-2382.[Abstract/Free Full Text]
  38. 20
  39. Golovkina, T. V., A. Jaffe, and S. R. Ross. 1994. Coexpression of exogenous and endogenous mouse mammary tumor virus RNA in vivo results in viral recombination and broadens the virus host range. J. Virol. 68:5019-5026.[Abstract/Free Full Text]
  40. 21
  41. Golovkina, T. V., M. Shlomchik, L. Hannum, and A. Chervonsky. 1999. Organogenic role of B lymphocytes in mucosal immunity. Science 286:1965-1968.[Abstract/Free Full Text]
  42. 22
  43. Held, H., A. N. Shakhov, S. Izui, G. A. Waanders, L. Scarpellino, H. R. MacDonald, and H. Acha-Orbea. 1993. Superantigen-reactive CD4+ T cells are required to stimulate B cells after infection with mouse mammary tumor virus. J. Exp. Med. 177:359-366.[Abstract/Free Full Text]
  44. 23
  45. Held, W., G. Waanders, A. N. Shakhov, L. Scarpellino, H. Acha-Orbea, and H. R. MacDonald. 1993. Superantigen-induced immune stimulation amplifies mouse mammary tumor virus infection and allows virus transmission. Cell 74:529-540.[CrossRef][Medline]
  46. 24
  47. Hook, L. M., Y. Agafonova, S. R. Ross, S. J. Turner, and T. V. Golovkina. 2000. Genetics of mouse mammary tumor virus-induced mammary tumors: linkage of tumor induction to the gag gene. J. Virol. 74:8876-8883.[Abstract/Free Full Text]
  48. 25
  49. Jhappan, C., D. Gallahan, C. Stahle, E. Chu, G. H. Smith, G. Merlino, and R. Callahan. 1992. Expression of an activated Notch-related int-3 transgene interferes with cell differentiation and induces neoplastic transformation in mammary and salivary glands. Genes Dev. 6:345-355.[Abstract/Free Full Text]
  50. 26
  51. Jude, B. A., Y. Pobezinskaya, J. Bishop, S. Parke, R. M. Medzhitov, A. V. Chervonsky, and T. V. Golovkina. 2003. Subversion of the innate immune system by a retrovirus. Nat. Immunol. 4:573-578.[CrossRef][Medline]
  52. 27
  53. Katoh, M. 2002. WNT and FGF gene clusters. Int. J. Oncol. 21:1269-1273.[Medline]
  54. 28
  55. Lee, F. S., T. F. Lane, A. Kuo, G. M. Shackleford, and P. Leder. 1995. Insertional mutagenesis identifies a member of the Wnt gene family as a candidate oncogene in the mammary epithelium of int-2/Fgf-3 transgenic mice. Proc. Natl. Acad. Sci. USA 92:2268-2272.[Abstract/Free Full Text]
  56. 29
  57. Luban, J. 1996. Absconding with the chaperone: essential cyclophilin-Gag interaction in HIV-1 virions. Cell 87:1157-1159.[CrossRef][Medline]
  58. 30
  59. Luban, J., K. L. Bossolt, E. K. Franke, G. V. Kalpana, and S. P. Goff. 1993. Human immunodeficiency virus type 1 Gag protein binds to cyclophilins A and B. Cell 73:1067-1078.[CrossRef][Medline]
  60. 31
  61. Majors, J. E., and H. E. Varmus. 1983. Nucleotide sequencing of an apparent proviral copy of env mRNA defines determinants of expression of the mouse mammary tumor virus env gene. J. Virol. 47:495-504.[Abstract/Free Full Text]
  62. 32
  63. Manly, K. F. 1993. A Macintosh program for storage and analysis of experimental genetic mapping data. Mamm. Genome 4:303-313.[CrossRef][Medline]
  64. 33
  65. Marchetti, A., J. Robbins, G. Campbell, F. Buttitta, F. Squartini, M. Bistocchi, and R. Callahan. 1991. Host genetic background effect on the frequency of mouse mammary tumor virus-induced rearrangements of the int-1 and int-2 loci in mouse mammary tumors. J. Virol. 65:4550-4554.[Abstract/Free Full Text]
  66. 34
  67. Marrack, P., E. Kushnir, and J. Kappler. 1991. A maternally inherited superantigen encoded by mammary tumor virus. Nature 349:524-526.[CrossRef][Medline]
  68. 35
  69. Moore, R., M. Dixon, R. Smith, G. Peters, and C. Dickson. 1987. Complete nucleotide sequence of a milk-transmitted mouse mammary tumor virus: two frameshift suppression events are required for translation of gag and pol. J. Virol. 61:480-490.[Abstract/Free Full Text]
  70. 36
  71. Nandi, S., and C. M. McGrath. 1973. Mammary neoplasia in mice. Adv. Cancer Res. 17:353-414.
  72. 37
  73. Nusse, R. 1988. The int genes in mammary tumorigenesis and in normal development. Trends Genet. 4:291-295.[CrossRef][Medline]
  74. 38
  75. Nusse, R., A. van Ooyen, D. Cox, Y. K. Fung, and H. Varmus. 1984. Mode of proviral activation of a putative mammary oncogene (int-1) on mouse chromosome 15. Nature 307:131-136.[CrossRef][Medline]
  76. 39
  77. Nusse, R., and H. Varmus. 1982. Mammary tumors induced by the mouse mammary tumor virus contain a provirus integrated in the same region of the host genome. Cell 31:99-109.[CrossRef][Medline]
  78. 40
  79. Peters, G., and C. Dickson. 1987. On the mechanism of carcinogenesis by mouse mammary tumor virus, p. 307-319. In D. Medina, W. Kidwell, G. Heppner, and E. Anderson (ed.), Cellular and molecular biology of breast cancer. Plenum Publishing Corp., New York, N.Y.
  80. 41
  81. Peters, G., A. E. Lee, and C. Dickson. 1984. Activation of cellular gene by mouse mammary tumour virus may occur early in mammary tumour development. Nature 309:273-275.[CrossRef][Medline]
  82. 42
  83. Peters, G., A. E. Lee, and C. Dickson. 1986. Concerted activation of two potential proto-oncogenes in carcinomas induced by mouse mammary tumour virus. Nature 320:628-631.[CrossRef][Medline]
  84. 43
  85. Purdy, A., L. Case, M. Duvall, M. Overstrom-Coleman, N. Monnier, A. Chervonsky, and T. Golovkina. 2003. Unique resistance of I/LnJ mice to a retrovirus is due to sustained interferon gamma-dependent production of virus-neutralizing antibodies. J. Exp. Med. 197:233-243.[Abstract/Free Full Text]
  86. 44
  87. Ramirez, J. M., L. Houzet, R. Koller, J. Bies, L. Wolff, and M. Mougel. 2004. Activation of c-myb by 5' retrovirus promoter insertion in myeloid neoplasms is dependent upon an intact alternative splice donor site (SD') in gag. Virology 330:398-407.[CrossRef][Medline]
  88. 45
  89. Ross, S. R., and T. V. Golovkina. 1997. The role of endogenous Mtv loci in resistance to MMTV-induced mammary tumors, p. 89-99. In K. Tomonari (ed.), Viral superantigens. CRC press, Boca Raton, Fla.
  90. 46
  91. Rowe, W. P., J. B. Humphrey, and F. Lilly. 1973. A major genetic locus affecting resistance to infection with murine leukemia viruses. 3. Assignment of the Fv-1 locus to linkage group 8 of the mouse. J. Exp. Med. 137:850-853.[Abstract]
  92. 47
  93. Shackleford, G. M., C. A. MacArthur, H. C. Kwan, and H. E. Varmus. 1993. Mouse mammary tumor virus infection accelerates mammary carcinogenesis in Wnt-1 transgenic mice by insertional activation of int-2/Fgf-3 and hst/Fgf-4. Proc. Natl. Acad. Sci. USA 90:740-744.[Abstract/Free Full Text]
  94. 48
  95. Shackleford, G. M., and H. E. Varmus. 1988. Construction of a clonable, infectious and tumorigenic mouse mammary tumor virus provirus and a derivative genetic vector. Proc. Natl. Acad. Sci. USA 85:9655-9659.[Abstract/Free Full Text]
  96. 49
  97. Shih, C. C., J. P. Stoye, and J. M. Coffin. 1988. Highly preferred targets for retrovirus integration. Cell 53:531-537.[CrossRef][Medline]
  98. 50
  99. Silver, L. M. 1995. Mouse genetics. Concepts and applications. Oxford University Press, New York, N.Y.
  100. 51
  101. Smith, G. H., D. Gallahan, F. Diella, C. Jhappan, G. Merlino, and R. Callahan. 1995. Constitutive expression of a truncated INT3 gene in mouse mammary epithelium impairs differentiation and functional development. Cell Growth Differ. 6:563-577.[Abstract]
  102. 52
  103. Smith, M. R., R. E. Smith, I. Dunkel, V. Hou, K. L. Beemon, and W. S. Hayward. 1997. Genetic determinant of rapid-onset B-cell lymphoma by avian leukosis virus. J. Virol. 71:6534-6540.[Abstract]
  104. 53
  105. Swanstrom, R., and J. W. Wills. 1997. Synthesis, assembly, and processing of viral proteins, p. 263-334. In J. M. Coffin, S. H. Hughes, and H. E. Varmus (ed.), Retroviruses. Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
  106. 54
  107. Tang, Y., U. Winkler, E. O. Freed, T. A. Torrey, W. Kim, H. Li, S. P. Goff, and H. C. Morse III. 1999. Cellular motor protein KIF-4 associates with retroviral Gag. J. Virol. 73:10508-10513.[Abstract/Free Full Text]
  108. 55
  109. Tsukamoto, A. S., R. Grosschedl, R. C. Guzman, T. Parslow, and H. E. Varmus. 1988. Expression of the int-1 gene in transgenic mice is associated with mammary gland hyperplasia and adenocarcinomas in male and female mice. Cell 55:619-625.[CrossRef][Medline]
  110. 56
  111. Varmus, H. E., T. Padgett, S. Heasley, G. Simon, and J. M. Bishop. 1977. Cellular functions are required for the synthesis and integration of avian sarcoma virus-specific DNA. Cell 11:307-319.[CrossRef][Medline]
  112. 57
  113. Wootton, S. K., C. L. Halbert, and A. D. Miller. 2005. Sheep retrovirus structural protein induces lung tumours. Nature 434:904-907.[CrossRef][Medline]


Journal of Virology, April 2006, p. 3215-3224, Vol. 80, No. 7
0022-538X/06/$08.00+0     doi:10.1128/JVI.80.7.3215-3224.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Swanson, I.
Right arrow Articles by Golovkina, T. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Swanson, I.
Right arrow Articles by Golovkina, T. V.