Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Eren, R. Articles by Dagan, S. Search for Related Content PubMed PubMed Citation Articles by Eren, R. Articles by Dagan, S.

 Previous Article  |  Next Article 

Journal of Virology, March 2006, p. 2654-2664, Vol. 80, No. 6
0022-538X/06/$08.00+0     doi:10.1128/JVI.80.6.2654-2664.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Preclinical Evaluation of Two Neutralizing Human Monoclonal Antibodies against Hepatitis C Virus (HCV): a Potential Treatment To Prevent HCV Reinfection in Liver Transplant Patients

Rachel Eren,¹ Dorit Landstein,¹ Dov Terkieltaub,¹ Ofer Nussbaum,¹ Arie Zauberman,¹ Judith Ben-Porath,¹ Judith Gopher,¹ Rachel Buchnick,¹ Riva Kovjazin,¹ Ziva Rosenthal-Galili,¹ Sigal Aviel,¹ Ehud Ilan,¹ Yariv Shoshany,¹ Lewis Neville,¹ Tal Waisman,¹ Ofer Ben-Moshe,¹ Alberto Kischitsky,¹ Steven K. H. Foung,² Zhen-Yong Keck,² Orit Pappo,³ Ahmed Eid,⁴ Oded Jurim,⁴ Gidi Zamir,⁴ Eithan Galun,⁵ and Shlomo Dagan^1*

XTL Biopharmaceuticals Ltd., Rehovot, Israel,¹ Department of Pathology, Stanford University School of Medicine, Stanford, California,² Department of Pathology, Hadassah University Medical Center, The Hebrew University of Jerusalem, Jerusalem, Israel,³ Department of Surgery, Hadassah University Medical Center, The Hebrew University of Jerusalem, Jerusalem, Israel,⁴ Goldyne Savad Institute of Gene Therapy, Hadassah University Hospital, Jerusalem, Israel⁵

Received 15 September 2005/ Accepted 2 December 2005

Top Abstract Introduction Materials and Methods Results Discussion References

 
Passive immunotherapy is potentially effective in preventing reinfection of liver grafts in hepatitis C virus (HCV)-associated liver transplant patients. A combination of monoclonal antibodies directed against different epitopes may be advantageous against a highly mutating virus such as HCV. Two human monoclonal antibodies (HumAbs) against the E2 envelope protein of HCV were developed and tested for the ability to neutralize the virus and prevent human liver infection. These antibodies, designated HCV-AB 68 and HCV-AB 65, recognize different conformational epitopes on E2. They were characterized in vitro biochemically and functionally. Both HumAbs are immunoglobulin G1 and have affinity constants to recombinant E2 constructs in the range of 10^–10 M. They are able to immunoprecipitate HCV particles from infected patients' sera from diverse genotypes and to stain HCV-infected human liver tissue. Both antibodies can fix complement and form immune complexes, but they do not activate complement-dependent or antibody-dependent cytotoxicity. Upon complement fixation, the monoclonal antibodies induce phagocytosis of the immune complexes by neutrophils, suggesting that the mechanism of viral clearance includes endocytosis. In vivo, in the HCV-Trimera model, both HumAbs were capable of inhibiting HCV infection of human liver fragments and of reducing the mean viral load in HCV-positive animals. The demonstrated neutralizing activities of HCV-AB 68 and HCV-AB 65 suggest that they have the potential to prevent reinfection in liver transplant patients and to serve as prophylactic treatment in postexposure events.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Hepatitis C virus (HCV) is a major public health problem, with 1 to 3% of the world's population chronically infected by the virus (7, 45). HCV infection causes cirrhosis and increases the risk of hepatocellular carcinoma, both leading indications for liver transplantation (1, 11). Infection of liver grafts occurs within days after transplantation, and persistent infection leads to graft hepatitis and in some cases to failure (23).

Currently there is no available therapy to prevent reinfection of the liver graft in the early phase after transplantation. Treatment with pegylated alpha interferon and ribavirin, the current standard of care for chronic HCV patients (48), can be initiated only at later stages, at which viral load is already established (8).

Passive immunotherapy with neutralizing antibodies against HCV could be considered in particular for preventing reinfection of liver transplant patients associated with HCV infection. This approach is well established and is proven to be safe and effective in the case of patients undergoing liver transplantation for chronic hepatitis B virus (HBV) disease (41). Preclinical studies of chimpanzees indicated the ability of polyclonal antibodies derived from plasma of HCV-infected patients to prevent or delay HCV infection. The antibodies were shown to delay the onset of acute hepatitis C when given before or soon after inoculation of the chimpanzees with the virus (19, 21, 31, 49).

HCV envelope proteins elicit humoral responses in infected patients (21); however, this response does not appear to be protective against disease progression (18, 33). Clinical studies using polyclonal anti-HCV preparations derived from human plasma (HCIG) for prevention of reinfection in liver transplant patients were conducted (15, 47), but the level of neutralizing antibodies in the polyclonal preparations is not known and likely to be low.

The high mutation rate in the HCV genome (10) may lead to rapid development of drug resistance and to emergence of escape mutants due to selective pressure in the case of monotherapy. Our approach was to develop neutralizing human monoclonal antibodies (HumAbs) with high affinity against the HCV envelope protein E2. A combination of two such HumAbs, each directed to a different epitope on E2 may reduce the probability of acquired resistance.

Two HumAbs, HCV-AB 68 and HCV-AB 65, were selected from a panel of several antibodies generated against E2 based on the ability to recognize different epitopes on E2 and on their biological activity in our in vitro and in vivo systems. Their ability to prevent infection in a mouse model for HCV infection renders them suitable candidates for clinical development as an indication for preventing reinfection of liver grafts in liver transplant patients.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Generation of HumAbs. HumAb HCV-AB 68 was generated from peripheral blood mononuclear cells obtained from a donor who tested positive for HCV in a third-generation enzyme-linked immunosorbent assay (ELISA) (Ortho Diagnostic Systems, Germany) and was confirmed by a RIBA test (Ortho or Matrix; Abbott). The HCV genotype of this donor is unknown. B cells from this donor were transformed with Epstein-Barr virus (42). The supernatants of the resulting lymphoblastoid clones were screened by ELISA with an extract of cells infected with a recombinant vaccinia virus, RMPA95, expressing the envelope proteins E1 and E2 of an HCV genotype 1a (H) strain. Positive clones were fused with the heteromyeloma line K6H6/B5 (14).

HumAb HCV-AB 65 was generated from peripheral blood mononuclear cells obtained from a donor with asymptomatic HCV infection and a high serum neutralization-of-binding titer. The genotype of the virus of this donor is 1b. Epstein-Barr virus-transformed B cells were selected based on immunofluorescence assay reactivity and electrofused to the heteromyeloma cell line H73C11, as described previously (37). Clones were screened by immunofluorescence assay with fixed Sf9 cells expressing recombinant E2 protein (24). The resulting hybridoma clones from were further subcloned by limiting dilution and finally expanded for antibody production.

E2 constructs. Several recombinant E2 proteins with and without hypervariable region 1 (HVR1) were generated. Constructs His-EK-E2 (291 amino acids [aa]) and His-EK-E2-without HVR1 (260 aa) are sequences based on HCV genotype 1b. The 5' end harbors an enterokinase cleavage site (EK), a six-histidine tag domain (His), and a complementary stretch to E2. The 3' region ends at aa 661, followed by two stop codons. This results in the generation of a truncated E2 protein that is 291 aa in length (50 kDa by Western blot analysis). In the His-EK-E2-without HVR1 construct, the first 31 aa of the E2 sequence were deleted.

E2-MCS and E2-MCS without HVR1 comprise of an average sequence of the most commonly occurring amino acids from more than 40 different HCV strains. The constructs were built by recursive PCR using panels of overlapping 100-mer oligonucleotides. The HVR1 region was replaced by an HVR1 surrogate peptide, mimotope R9 (38). In the E2-MCS without HVR1 construct, the last 27 aa of the R9 sequence were deleted, such that this construct contains 4 aa at the 3' end of HVR1 which are considered to be relatively conserved. All four constructs were expressed as secreted proteins in a baculovirus expression system (BEVS) and purified using nickel agarose chromatography.

E2-CHO is a commercially available mammalian recombinant HCV genotype 1b protein (Austral Biologicals, CA). It is a truncated protein, comprising 331 aa, and electrophoreses as a band of 60 kDa on Western blots (12).

Western blot analysis. All protein gel analyses were performed using ready-made 4% to 12% Novex NuPage Bis-Tris gels (Invitrogen, Carlsbad, CA). Protein transfer to nitrocellulose was performed using an Xcell II minicell (Invitrogen, Carlsbad, CA) according the manufacturer's recommendations.

For nonreduced gels, 200 ng of each antigen was mixed with a sample buffer devoid of reducing agent and incubated for 5 min at 37°C or 100°C prior to loading. For reducing gels, 200 ng of each antigen was mixed with a sample buffer containing either ß-mercaptoethanol (360 mM) or dithiothreitol (50 mM) and processed in a manner identical to that for nonreduced gels.

Following transfer, blots were incubated overnight in blocking buffer (phosphate-buffered saline [PBS]-milk-0.04% Tween 20) and thereafter incubated with 0.5 µg/ml of each HumAb for 3 h in blocking buffer. Following three separate washes with PBS-Tween buffer, membranes were incubated with a 1:20,000 dilution of peroxidase-conjugated goat-anti human immunoglobulin G (IgG) (Zymed Laboratories Inc., San Francisco, CA) in blocking buffer for 60 min. Following three 5-min washes of the membrane with PBS-0.04% Tween 20, blots were developed using enhanced chemiluminescence (Biological Industries, Beit Haemek, Israel) and X-ray film.

Determination of IgG subclass. The human IgG subclass was determined by the Human IgG Subclass Profile ELISA Kit (Zymed Laboratories Inc., San Francisco, CA), according to the manufacturer's instructions.

Determination of affinity constants to E2 constructs. Affinity constants (K_d) of HCV-AB 68 and HCV-AB 65 were determined using the Biacore 3000 instrument (Biacore AB, Uppsala, Sweden) according to the manufacturer's instructions. Biacore sensor chips, CM5, coated by dextran matrix were bound by amine coupling with different E2 constructs. Affinity constants were calculated using the BIAevaluation 3.1 software provided by the manufacturer.

Competition analysis between the two HumAbs. The abilities of HCV-AB 68 and HCV-AB 65 to bind the same or a distinct epitope on E2 molecules were analyzed by the Biacore 3000 instrument (Biacore AB, Uppsala, Sweden) using the Pair Wise Binding method. Biacore sensor chips, CM5, coated by dextran matrix were bound by amine coupling with different E2 constructs, and then the first antibody was injected several times over the coated sensor chip until all specific binding sites were saturated. The second antibody was then injected, and activity changes, measured as resonance units (RU), were monitored.

Immunohistostaining of HCV-infected liver. Liver tissues from HCV-infected patients were fixed in 4% neutral buffered formaldehyde for 24 h and then embedded in paraffin by routine procedures. Slices of 4-µm thickness were cut from paraffin blocks and mounted on polylysine-coated slides. After deparaffinization, the DAKO Envision system + HRP Kit (DAKO Corporation, Carpinteria, CA) was used for peroxidase quenching and blocking. Staining was performed with 100 µl of 500-µg/ml purified HCV-AB 68 or HCV-AB 65, followed by horseradish peroxidase (HRP)-conjugated goat anti-human IgG (H+L) (Zymed Laboratories Inc., San Francisco, CA) and the kit's HRP substrate. Liver tissues from HBV-infected patients who were negative for all HCV markers served as a negative control.

Immunoprecipitation of HCV from human infected sera. To determine the abilities of HCV-AB 68 and HCV-AB 65 to bind HCV particles, an immunomagnetic separation assay was developed. In this assay, HCV particles from infected patients' sera with titers ranging between 1 x 10⁶ and 5 x 10⁶ copies/ml are captured by magnetic beads coated with a specific antibody. Following magnetic separation of bound and nonbound fractions, HCV RNA is detected by reverse transcription-PCR (RT-PCR).

Protein A magnetic beads (Dynal Biotek ASA, Oslo, Norway) were coated with HCV-AB 68 or HCV-AB 65 (4 µg) according to the manufacturer's instructions. HBV-AB 17, a monoclonal antibody raised against HBV (17), served as a negative control. Antibody-coated beads were washed three times in 0.1 M NaP buffer (pH 8.1), blocked for 30 min in 1% bovine serum albumin (BSA), and washed again in PBS before resuspension in PBS containing 0.1% BSA. In parallel, tested serum from an infected individual was pretreated with protein A-Sepharose (Amersham Pharmacia Biotech AB, Uppsala, Sweden) to eliminate serum antibodies. This was achieved by incubating 10 µl serum with 10 µl protein A-Sepharose for 30 min with shaking, followed by a centrifugation step. The antibody-depleted serum was then incubated with shaking for 2 h with the antibody-coated magnetic beads. PBS containing 0.1% BSA was used to complete the final volume to 200 µl. The bound fraction, magnetically separated from the nonbound fraction, was washed five times with 1 ml of PBS before final resuspension in 200 µl of PBS.

Evaluation of virus amounts in the bound fraction was performed by RT-PCR analysis using primers from a conserved region in the 5' untranslated region (these primers can detect genotypes 1a/1b, 2a/2c, and 3a). Viral RNA was extracted using Tri-Reagent BD (Sigma, St. Louis, MO) according to the manufacturer's instructions. The RT reaction mixture (20 µl final volume) contained 4 µl RT buffer, 1 mM deoxynucleoside triphosphates, 10 mM DTT, 100 U of Moloney murine leukemia virus RT (Promega, Madison, WI), 2.7 U of avian myeloblastosis virus RT (Promega Madison, WI), and 2.5 pM HCV antisense primer 5'ATGRTGCTCGGTCTA3' (nucleotides [nt] 329 to 344). Reaction conditions were set to ramping from 37°C to 42°C with a 1°C increment every 20 min. The reaction was completed by a 10-minute incubation step at 94°C. Five microliters of RT reaction mixture was used as a template for a PCR (50 µl, final volume). PCR mixtures contained 5 µl PCR buffer, 2.5 mM MgCl₂, 0.2 mM deoxynucleoside triphosphates, 0.25 U Taq polymerase (Promega, Madison, WI), 0.25 pM sense primer 5'CACTCCACCATRGATCACTCCC3' (nt 23 to 45), and antisense primer 5'ACTCGCAAGCACCCTATCAGG3' (nt 313 to 239). Thirty-three amplification cycles of 1 min at 94°C, 1 min at 58°C, and 1.5 min at 72°C were performed, with a final 5-minute elongation step at 72°C. PCR products were separated on a 2% agarose gel, visualized, and quantified following ethidium bromide staining on an EagleEye II device (Stratagene, La Jolla, CA).

Sequence analysis. Total RNA was purified from cells expressing HCV-AB 68 or HCV-AB 65 using the RNeasy Midi-Prep Kit (QIAGEN GmbH, Germany). RNA was then treated with DNase I (Roche Diagnostics GmbH, Mannheim, Germany), to remove all traces of genomic DNA. Total RNA was used as a template for standard RT-PCR, with oligo(dT) as the RT primer, followed by PCR with specific primers. PCR products for heavy and light chains were excised from the gel and purified with the MinElute gel extraction kit (QIAGEN GmbH, Germany). Purified DNA fragments were sequenced with specific primers.

Sequences were analyzed by comparison to GenBank and by alignment to Kabat sequences (27).

Complement fixation. Complement fixation by either HCV-AB 68 or HCV-AB 65 in sera of HCV-infected patients (or control HBV-infected serum, as detailed in Table 1) was performed according to the following procedure. Sheep red blood cells were sensitized by incubation with anti-sheep red blood stroma, IgG fraction (Sigma, St. Louis, MO), diluted 1:200 in PBS (37°C for 30 min). Patients' sera, diluted 1:2 (vol/vol) with potassium borate buffer, were incubated with 50 µg/ml HCV-AB 68 or HCV-AB 65 for 2 h at 37°C. The serum was diluted again to 1:12.5 with barbital buffer (Sigma, St. Louis, MO) containing Ca⁺⁺, Mg⁺⁺, and 0.02% gelatin. One volume of sensitized sheep red blood cells was added to 1.5 volumes of diluted patients' sera. After incubation at 37°C for 1 h, test tubes were centrifuged and the optical density at 541 nm (OD₅₄₁) was measured. Maximum lysis was obtained by using water. The percent free complement was calculated as follows: percent free complement = [OD₅₄₁ (sample) x 100]/[OD₅₄₁ (maximum lysis)]. The percent increase in complement fixation was calculated as follows: percent increase in complement fixation = {100 – [percent free complement (with HumAb) x 100]/[percent free complement (without HumAb)]}.

View this table: [in this window] [in a new window]

TABLE 1. Sera used in complement fixation experiments

IC formation. Formation of IgG immune complexes (IC) in HCV-infected patients' sera by HCV-AB 68 or HCV AB 65 was tested by ELISA (13). Microtiter plates (F96 Maxisorp; Nunc-Immuno Plate, Nunc, Denmark) were coated with 0.05-µg/well human complement component C1q (Sigma, St. Louis, MO). HCV-infected patients' sera (or control HBV-infected serum, as detailed in Table 2) were inactivated at 56°C for 30 min. After being cooled to room temperature, antibodies at 50 µg/ml were added for 2 h of incubation at 37°C. The HumAb-containing sera were then diluted 1:2 with 0.2 M EDTA, further incubated for 30 min at 37°C, and placed on ice. After an additional 1:200 dilution in PBS-BSA, 50 µl was added to the coated wells for a 1-h incubation at 37°C, followed by 30 min at 4°C. Plates were then washed, and 50 µl of goat anti-human IgG peroxidase conjugate (Zymed Laboratories Inc., San Francisco, CA) was added to each well. One hour after incubation at 37°C and washings, substrate solution (TMB; Sigma, St. Louis, MO) was added. Absorbance was determined using an ELISA reader at 450 nm. Percent IgG IC was calculated as follows: percent IgG IC = {[OD₄₅₀ (sample) x 100]/[OD₄₅₀ (no HumAb)] – 100}.

View this table: [in this window] [in a new window]

TABLE 2. Sera used in formation of IC experiments

Complement-dependent phagocytosis of IC. Complement dependent phagocytosis was tested in sera of HCV-infected patients as follows: HCV-AB 68 or HCV-AB 65 was labeled with NHS-Fluorescein (Pierce, Rockford, IL) according to the manufacturer's instructions. Sera from HCV-infected patients were heat inactivated (56°C for 30 min) in order to inactivate complement and diluted 1:2 (vol/vol) with potassium borate buffer. The treated sera were incubated with fluorescein-labeled antibody at a final concentration of 500 µg/ml for 2 h at 37°C with or without 20 µl of guinea pig complement (Sigma, St. Louis, MO). Human neutrophils obtained from peripheral blood lymphocytes after Ficoll separation (5 x 10⁶ cells) were added, and the mixture was further incubated at 37°C for 1.5 h. The cells were washed twice with PBS and spotted onto a slide using VECTASHIELD mounting medium with DAPI (4',6'-diamidino-2-phenylindole) (Vector Laboratories, Inc., Burlingame, CA). The slides were visualized with a fluorescence microscope. DAPI stains cell nuclei blue, whereas IC are stained green with fluorescein. Specificity was confirmed by using a fluorescein-labeled isotype control antibody and by using normal human serum.

HCV-Trimera mouse system. The HCV-Trimera mouse system was described previously (25). Briefly, CB6F1 mice (Harlan Laboratories, Weizmann Institute Animal Breeding Center) were exposed to lethal split-dose total body irradiation (4 Gy followed 1 day later by 11 Gy) from a gamma beam 150-A ⁶⁰Co source (Atomic Energy of Canada). After irradiation, mice were radioprotected by reconstitution with 5 x 10⁶ SCID mouse bone marrow cells injected intravenously and then transplanted with ex vivo HCV-infected human liver fragments either behind the ear pinna or under the kidney capsule. Total RNA was extracted from the sera of Trimera mice. Specific HCV RNA, from free and immune-complexed virus, was quantitated by RT-PCR (25). Regression analysis was used for the construction of standard curves for the quantitative evaluation of HCV RNA.

Statistical analysis was performed with the StatView II software program (Abacus Concepts). Differences in viral load in control groups and treatment groups of mice (group pairs) were compared by the nonparametric Mann-Whitney U test (MWUT).

All studies involving mice were performed in accordance with U.S. National Institutes of Health guidelines and were approved by the Israel Council for Experiments on Animals, Ministry of Health, under the Israel animal protection law.

Neutralization of HCVpp. HCV pseudoparticles (HCVpp) (genotype 1b) were produced and purified as described previously (4). Briefly, concentrated HCVpp were obtained by processing 30 ml of supernatant containing HCVpp through a 20% sucrose cushion by ultracentrifugation, followed by sucrose density-equilibrium gradient centrifugation in 20 to 60% sucrose at 36,000 rpm for 18 h at 4°C. After ultracentrifugation, 250-µl fractions were collected from top to bottom of the gradient. Fractions were pooled as purified HCVpp based on HCVpp infectivity.

The HCVpp neutralization assay was performed as described previously (4, 28). Briefly, Huh-7 cells were seeded at 8 x 10³ cells per well in a white, nontransparent 96-well plate 24 h before infection. The cells were grown in Dulbecco's modified minimal essential medium (Invitrogen, Carlsbad, CA) supplemented with 10% fetal calf serum (Gemini Bioproducts Inc., Calabasas, CA) and 2 mM glutamine. Concentrated HCVpp were added to Huh-7 cells as the infection medium. For the neutralization assay, the infection medium was incubated with HumAbs at 20 µg/ml for 1 h at 37°C. An isotype-matched HumAb, HBV-AB 17, was used as a control. The cell culture plate was centrifuged at 1,000 x g for 2 h at room temperature before being placed in a humidified cell culture chamber containing 5% CO₂ at 37°C. Following 15 h of incubation, the HCVpp medium was replaced with fresh medium and incubated for 72 h. After addition of 100 µl of reconstituted Bright-Glo (Promega, Madison, WI) to each well, followed by 2 min of mixing, luciferase activity was measured by a Veritas Microplate Luminometer (Turner Biosystems, Sunnyvale, CA). Virus neutralization activity of an antibody was determined by the percent reduction of luciferase activity compared with the infection medium containing PBS.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Characterization of anti-E2 HumAbs. Aiming to develop HumAbs that could neutralize HCV, we have generated and screened several clones secreting antibodies that could bind recombinant E2. HCV-AB 68 and HCV-AB 65 were purified by protein A affinity chromatography and characterized by isotype and sequence analyses. Both antibodies are IgG1, consist of a light chain, and bind to different E2 constructs expressed in a baculovirus expression system (BEVS) and in a mammalian expression system (CHO cells). Both HumAbs have high affinities to different E2 constructs in the range of 10^–10 M, as determined by Biacore analysis.

(i) Sequence analysis. The genes encoding the variable regions of HCV-AB 68 and HCV-AB 65 were isolated and sequenced. Subgroups and complementarity-determining regions were determined. Amino acid sequences are shown in Fig. 1. HCV-AB 68 subgroups were found to be V_H3 J_H4 VK₁ JK₁. HCV-AB 65 subgroups were found to be V_H1 J_H4 VK₁ JK₁. The DNA and protein sequences of HCV-AB 68 and of HCV-AB 65 correspond to human antibody IgG1 sequences. The IgG1 isotype was further confirmed by ELISA.

View larger version (15K): [in this window] [in a new window]

FIG. 1. Sequence analysis of the variable domains of HCV-AB 68 and HCV-AB 65. RNA was amplified by RT-PCR, cloned, and sequenced as described in Materials and Methods. (A) VL (light chain) amino acid sequences of HCV-AB 68 and HCV-AB 65. (B) VH (heavy chain) amino acid sequences of HCV-AB 68 and HCV-AB 65. Complementarity-determining regions are in boldface type.

(ii) Determination of affinity constants. Affinity constants (K_d) of HCV-AB 68 and HCV-AB 65 to the different E2 constructs were determined using the Biacore 3000. Both HumAbs have high affinities to E2 constructs, ranging from 1.2 x 10^–10 to 1.2 x 10^–11 (Table 3).

View this table: [in this window] [in a new window]

TABLE 3. Affinity constants of HCV-AB 68 and HCV-AB 65 to E2 constructs

(iii) Binding to recombinant E2 proteins. In order to find out whether the two HumAbs recognize the same or different epitopes on the E2 protein, competition analysis was performed using the pair-wise binding method in the Biacore 3000. Different E2 constructs were coupled to a sensor chip and then loaded sequentially with each of the HumAbs. A change in the binding activity means that each antibody binds a distinct epitope, whereas no change in binding activity means that both antibodies bind the same epitope. Figure 2 shows an experiment performed using E2-CHO as the ligand. The magnitude of binding of HCV-AB 68 to E2 (665 RU; Fig. 2A) does not change significantly when HCV-AB 65 is already bound (557 RU; Fig. 2B). Similarly, the binding of HCV-AB 65 to E2 (231 RU; Fig. 2B) is not affected by the binding of HCV-AB 68 (228 RU; Fig. 2A). Hence, HCV AB-68 and HCV-AB 65 bind to distinct epitopes on the E2 protein. The difference in the magnitude of binding between the two HumAbs may imply multiple copies of the HCV-AB 68 epitope on the E2 molecule or different conformational flexibilities of the epitopes. Similar results were obtained when the other E2 constructs were used.

View larger version (11K): [in this window] [in a new window]

FIG. 2. Competition analysis between HCV-AB 68 and HCV-AB 65 by the Pair Wise Binding method. BiaCore sensor chip CM5 coated by dextran matrix was bound by amine coupling with E2-CHO, and then the first antibody was injected several times over the coated sensor chip to saturate specific binding sites. The second antibody was then injected, and activity changes measured as resonance units (RU) were monitored. Injections of the antibodies are marked by arrows.

Experiments employing sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) under reduced and nonreduced conditions demonstrated that both HumAbs recognize conformational epitopes (Fig. 3). They bind to E2 constructs containing the complete HVR1 sequence (27 aa, from aa 384 to 410) but do not bind a construct in which 31 aa (from aa 384 to 414) were deleted (Fig. 3A and B, lane 2). Deletion of the HVR1 region (27 aa; Fig. 3A and B, lane 4) conserved the binding to the antibodies, indicating that 4 aa at the C-terminal end of HVR1 are necessary to maintain the conformation of the epitopes to which the HumAbs bind (29).

View larger version (74K): [in this window] [in a new window]

FIG. 3. Reactivity of HCV-AB 68 and HCV-AB 65 to E2 constructs by Western blot analysis. SDS-PAGE of different E2 constructs under nonreducing and reducing conditions was performed as described in Materials and Methods. (A) Samples prepared at 37°C. (B) Samples prepared at 100°C. Lanes: 1, His-EK-E2; 2, His-EK-E2-without HVR1; 3, E2 MCS; 4, E2 MCS without HVR1; 5, E2-CHO.

The antibodies could bind four of five constructs only under nonreduced conditions, both at 37°C (Fig. 3A) and at 100°C (Fig. 3B). They did not recognize any of the E2 constructs under reduced (Fig. 3A) or denatured conditions (Fig. 3B), indicating binding to epitopes whose structures within the protein are maintained by disulfide bonds.

(iv) Recognition of virus particles. The ability of the HumAbs to recognize not only recombinant E2 but also intact virus was demonstrated in a series of experiments, including immunohistostaining of infected liver tissue and immunoprecipitation of virus particles from HCV-infected sera.

Immunohistostaining of human liver tissue with HCV-AB 68 and with HCV-AB 65 was performed on liver fragments from HCV-infected patients. Human liver tissues from HBV-infected patients who were negative for all HCV markers were used as a negative control. Both HCV-AB 68 and HCV-AB 65 stain specifically the cytoplasm of hepatocytes from HCV-infected liver tissue (Fig. 4A and C) and not from HBV-infected liver (Fig. 4B and D). This specific staining indicates that the HumAbs recognize viral antigen in the infected cells and not only recombinant protein.

View larger version (148K): [in this window] [in a new window]

FIG. 4. Immunohistostaining of HCV-infected liver with HCV-AB 68 and HCV-AB 65. Immunohistostaining of human liver tissue with HCV-AB 68 and with HCV-AB 65 was performed on liver fragments from HCV-infected patients as described in Materials and Methods. Liver tissues from HBV-infected patients who were negative for all HCV markers served as a negative control. (A) HCV-AB 68 with HCV-infected liver (magnification, x40). (B) HCV-AB 68 with HBV-infected liver (magnification, x40). (C) HCV-AB 65 with HCV-infected liver (magnification, x40). (D) HCV-AB 65 with HBV-infected liver (magnification, x40).

(v) Immunoprecipitation of HCV from human infected sera. The ability of the HumAbs to bind HCV particles from sera of infected patients was assessed by immunoprecipitation using an immunomagnetic separation assay. A total of 43 different sera from 31 patients infected with genotype 1a/1b, 4 patients infected with genotype 2a/2c, and 8 patients infected with genotype 3a were analyzed.

HCV-AB 68 and HCV-AB 65 were able to precipitate virus particles from infected patients' sera over the background obtained by a nonrelevant antibody (HBV-AB 17), which was used as a negative control. Figure 5 shows representative experiments demonstrating RT-PCR products of 391 bp from the 5' untranslated region of HCV RNA obtained after precipitation of virus particles from genotypes 1b, 2a/2c, and 3a.

View larger version (25K): [in this window] [in a new window]

FIG. 5. Immunoprecipitation of virus particles from HCV-infected sera from different genotypes by HCV-AB 68 and HCV-AB 65. HCV particles from infected patients' sera from genotypes 1b, 2a/2c, and 3a were captured by magnetic beads coated with a specific antibody, as described in Materials and Methods. Following magnetic separation, HCV RNA was detected in the bound fraction by RT-PCR. (A) Immunoprecipitation by HCV-AB 68 (in quadruplicates) and HBV-AB 17 as an isotype control (in duplicates). (B) Immunoprecipitation by HCV-AB 65 (in triplicates) and HBV-AB 17 as an isotype control (in triplicates).

Effector functions. (i) Complement fixation. Complement fixation was measured by the decrease in free complement in sera from HCV patients upon addition of HCV-AB 68 or HCV-AB 65. Complement fixation by both HumAbs was observed in most of the HCV-infected sera tested (sera 2 to 9; Table 1) but not in the control HBV-infected serum (serum 1; Table 1) (Fig. 6).

View larger version (41K): [in this window] [in a new window]

FIG. 6. Complement fixation by HCV-AB 68 and HCV-AB 65 in HCV-infected sera. Complement fixation in HCV-infected patients' sera by HCV-AB 68 and HCV AB 65 was tested as described in Materials and Methods. Serum 1, HBV-infected control; sera 2 to 9, HCV infected. The percent increase in complement fixation was calculated as follows: percent increase in complement fixation = {100 – [percent free complement (with HumAb) x 100]/[percent free complement (without HumAb)]}.

(ii) Formation of IC. Formation of IgG IC in HCV-infected patients' sera by HCV-AB 68 or by HCV-AB 65 was tested by ELISA for C1q. IC formation by addition of either HumAb to HCV-infected sera was observed in most of the HCV-infected sera tested (sera 2 to 7; Table 2) with different efficacies but not in the control HBV-infected serum (serum 1; Table 2) (Fig. 7). A nonrelevant HumAb did not show any effect on IC formation.

View larger version (19K): [in this window] [in a new window]

FIG. 7. Immune complex (IC) formation by HCV-AB 68 and HCV-AB 65 in HCV-infected sera. Formation of IgG IC in HCV-infected patients' sera by HCV-AB 68 and HCV AB 65 was tested as described in Materials and Methods. Serum 1, HBV-infected control; sera 2 to 7, HCV infected. Percent IgG IC was calculated as follows: percent IgG IC = {[OD450 (sample) x 100]/[OD450 (no HumAb)] – 100}.

(iii) Complement-dependent phagocytosis. The ability of HCV-AB 68 and HCV-AB 65 to induce complement-dependent phagocytosis of IC formed in HCV-infected sera was evaluated as a potential mechanism of viral clearance. Both HumAbs were found to induce phagocytosis of IC by neutrophils when added to HCV-infected serum (Fig. 8A and B, panel 1). No phagocytosis was observed when complement was inactivated (Fig. 8A and B, panel 2) or when normal human serum was used (Fig. 8A and B, panel 3). The presence of neutrophils is evidenced by the blue staining of the nuclei by DAPI in all of the experimental groups. No phagocytosis of IC was obtained when a nonrelevant antibody was used.

View larger version (48K): [in this window] [in a new window]

FIG. 8. Complement-dependent phagocytosis of HCV IC formed by HCV-AB 68 and HCV-AB 65. Complement-dependent phagocytosis of IC by neutrophils was tested using fluorescein-labeled HCV-AB 68 or HCV-AB 65 and sera of HCV-infected patients, as described in Materials and Methods. DAPI stains cell nuclei blue, whereas IC are stained green with fluorescein. (A) HCV-AB 68. (B) HCV-AB 65. Panels 1, HCV-infected serum with complement; panels 2, HCV-infected serum with no complement; panels 3: normal human serum.

Neutralizing activities of HumAbs in vivo and in vitro. (i) The HCV-Trimera model. The HCV-Trimera mouse model was described as an effective tool to evaluate the efficacy of potential anti-HCV agents (25). Normal human liver tissue fragments infected ex vivo by incubation with high-titer HCV-positive human serum were transplanted in mice that were lethally irradiated and protected by reconstitution with SCID mouse bone marrow cells. The appearance of HCV viremia was determined by measuring the levels of HCV RNA in mouse sera. HCV RNA was clearly detected 12 days after liver transplantation, and the infection rate attained its peak at around day 18. We have used this model to select HumAbs with potential neutralizing activity. Using this model we have tested the ability of antibodies to reduce viral load from infected mice as well as their ability to inhibit infection of human liver fragments.

(ii) Treatment of HCV-Trimera mice. To test reduction of viral load in HCV-positive mice, two intraperitoneal injections of either HCV-AB 68 or HCV-AB 65 were administered to Trimera mice with established HCV viremia on two consecutive days, days 16 and 17 post-transplantation (20 µg/mouse/day; a total of 40 µg of antibody per mouse). HCV RNA was measured in mouse sera sampled 1 and 5 days after treatment completion.

Figure 9 demonstrates that 1 day after treatment, HCV-AB 68 was able to reduce the mean viral load from 3.1 x 10⁴ to 5 x 10³ HCV RNA copies/ml (P < 0.05 [MWUT]); HCV-AB 65 reduced the mean viral load to 7 x 10³ HCV RNA copies/ml (P < 0.05 [MWUT]). Reduction of the mean viral load was still evident 5 days after cessation of treatment even though a rebound in viremia started to develop.

View larger version (18K): [in this window] [in a new window]

FIG. 9. Treatment of HCV-infected Trimera mice by HCV-AB 68 and HCV-AB 65. Two intraperitoneal injections of either HCV-AB 68 or HCV-AB 65 were administered to Trimera mice (n = 17/group) with established HCV viremia on days 16 and 17 post-transplantation (20 µg/mouse/day; a total of 40 µg of antibody per mouse). HCV RNA was measured in mouse sera sampled 1 and 5 days after treatment completion (days 18 and 22). The solid line indicates the limit of detection of the assay, which is 5 x 103 RNA copies/ml.

(iii) Inhibition of infection. To test the ability of HCV-AB 68 and HCV-AB 65 to inhibit HCV infection of liver fragments, samples of human serum containing 7.5 x 10⁵ HCV RNA copies/ml were preincubated for 2 h at 37°C with 100 to 400 µg/ml of a 1:1 (mg/mg) mixture of the HumAbs and subsequently used to infect normal human liver fragments ex vivo. Following infection, the liver fragments were transplanted in mice, and HCV RNA was determined in mouse sera 19 days later.

The effect of the HumAb mixture in inhibiting infection of liver fragments was dose dependent (Fig. 10). The lowest dose, 100 µg/ml, did not reduce the viral load significantly. The intermediate dose, 200 µg/ml. reduced the viral load from 3 x 10⁴ to 1.1 x 10⁴ HCV RNA copies/ml of serum (P < 0.05 [MWUT]). The highest dose, 400 µg/ml, exhibited the strongest effect, causing a 1-log reduction of the viral load from 3 x 10⁴ to 3 x 10³ HCV RNA copies/ml (P < 0.05 [MWUT]). Extrapolation of the effective doses to humans (assuming 2.5 liters of serum) translates into approximately 500 to 1,000 mg as a total dose that would be required to neutralize the virus in the peripheral circulation of a patient.

View larger version (11K): [in this window] [in a new window]

FIG. 10. Inhibition of HCV infection in the HCV Trimera model by a 1:1 (mg/mg) mixture of HCV-AB 68 and HCV-AB 65. Samples of human serum containing 7.5 x 105 HCV RNA copies/ml were preincubated with 100 to 400 µg/ml of a 1:1 (mg/mg) mixture of HCV-AB 68 and HCV-AB 65 and subsequently used to infect normal human liver fragments ex vivo. Following infection, the liver fragments were transplanted in mice (n = 17/group), and HCV RNA was measured in mouse sera 19 days later. The solid line indicates the limit of detection of the assay, which is 5 x 103 RNA copies/ml.

(iv) Neutralization of HCVpp. The neutralizing activity of the two HumAbs was further confirmed in vitro in an assay for neutralization of HCVpp in Huh-7 cells. Figure 11 shows that incubation of HCVpp-containing medium with either HCV-AB 68 or HCV-AB 65 prior to infection of Huh-7 cells resulted in reduction of luciferase activity by 60% and 70%, respectively, indicating their neutralization potential. The isotype control antibody, HBV-AB 17, did not have a neutralizing effect. This observation is similar to what we have observed in vivo when HCV-positive serum is preincubated with the HumAbs prior to infection of human liver fragments. Thus, the data obtained in vivo and in vitro independently support the virus neutralization potential of these HumAbs.

View larger version (12K): [in this window] [in a new window]

FIG. 11. Neutralization of HCVpp genotype 1b infection of Huh-7 cells by HCV-AB 68 and HCV-AB 65. Infection medium containing concentrated HCVpp was preincubated with 20 µg/ml of either HCV-AB 68, HCV-AB 65, or HBV-AB 17 as an isotype control prior to addition to Huh-7 cells as described in Materials and Methods. The virus neutralization activity of an antibody was determined by the percent reduction of luciferase activity compared with the infection medium containing PBS. Experiments were performed in triplicate.

Top Abstract Introduction Materials and Methods Results Discussion References

 
In the present report, we describe two HumAbs, HCV-AB 68 and HCV-AB 65, directed against the envelope protein of HCV. Initial screening and selection of these monoclonal antibodies was performed by binding to recombinant E2 proteins.

The relevance of the recombinant constructs to native viral E2 was demonstrated by the fact that antibodies present in chronic HCV patients' sera could recognize all recombinant E2 constructs except His-EK-E2-without HVR1, indicating that these proteins harbor epitopes similar to those exposed on the virus (data not shown).

Recognition of native viral E2 by the HumAbs was demonstrated in a series of experiments employing different systems, such as an immunoprecipitation assay system, immunohistostaining of infected liver tissue, complement fixation and formation of IC in sera of infected patients, and induction of phagocytosis of these IC. In these experiments we have used HCV-infected sera from a variety of patients infected mainly with genotypes 1, 2a/2c, and 3a. We have shown that each of these two HumAbs was active in all of these experimental systems, indicating broad reactivity against a variety of HCV strains.

In order to select neutralizing antibodies with therapeutic potential, there is a need to develop in vitro assays and in vivo systems for detecting functional antibodies. There are few in vitro systems to study the potential efficacy of anti-HCV agents. The replicon system used for HCV replication (2) is not suitable to test the ability of antibodies to prevent HCV infection. More relevant systems are based on generation of HCV-like particles and their interactions with susceptible cells (46), such as noninfectious HCV-like particles (6, 44) and infectious HCVpp (4, 5). These systems have shown that antibodies against the E1 and E2 glycoproteins could prevent entry of HCV-like particles into cells (3, 30, 43, 49). Using the HCVpp system, we have demonstrated that HCV-AB 68 and HCV-AB 65 were able to neutralize HCVpp genotype 1 infection of Huh-7 cells by 60 to 70%. Since these in vitro systems do not use native virus and thus do not support a complete viral life cycle, we have developed a cell culture system in which human hepatoma cell lines can be infected with native virus originating from HCV-infected sera. In this cell culture system for HCV infection, we have shown that HCV-AB 68 and HCV-AB 65 were able to inhibit HCV infection when preincubated with the infectious sera. Similar to our findings with the HCVpp system, the two HumAbs were able to reduce HCV RNA by 80% in treated cultures compared to untreated cultures (S. Aviel, unpublished data). The neutralizing activity of the HumAbs in vitro was also observed in vivo in our mouse model for HCV infection (25). For in vivo evaluation of potential drugs, a limited number of animal model systems to study HCV infection have been reported. These include chimpanzees, transgenic mice, and Trimera mice (9, 32, 34, 35, 40). To test the neutralizing ability of monoclonal antibodies, we have used the Trimera mouse model (26), a practical small animal system which has been shown to be indicative of the efficacy of anti-HBV monoclonal antibodies in clinical studies (16, 22). One of the advantages of the Trimera model is that it can be experimentally designed to mimic different clinical situations, such as prevention of infection in liver transplant patients, chronic infection, and prophylaxis.

The possibility of testing several experimental groups, each containing a large number of mice, in a single experiment allows significant analysis of the effect of potential anti-HCV therapeutics. A limitation of this model system is that the viremia in the HCV-infected Trimera mice persists only for about 1 month. After this period of time, the viremia recedes because of fibrosis and necrosis of the human liver graft. Nonetheless, this 1-month period allows a therapeutic window that is sufficient for evaluating the ability of antibodies to reduce viral load. Using this mouse model, we have demonstrated the neutralizing activity of HCV-AB 68 and HCV-AB 65 in two different modes, reduction of viral load from the blood circulation and inhibition of infection of human liver tissue. These modes represent two different mechanisms of action by which the HumAbs could be effective in humans, clearance of circulating virus and prevention of cell infection.

Reduction of viral load in HCV-infected Trimera mice is probably a result of binding and removal of circulating viruses from the blood. Another potential mechanism for virus removal and neutralization is implied from the ability of the HumAbs to form immune complexes and induce phagocytosis of these immune complexes by human phagocytes. Neutralizing antibodies exert their function also by inducing complement (CDC) or antibody-mediated cytotoxicity (ADCC). The role of antibody cytotoxic functions in HCV infection is still unclear. It was shown recently that serum antibodies against E2 from all stages of HCV infection could mediate ADCC (36). In our experiments designed to measure ADCC or CDC activity of HCV-AB 68 and HCV-AB 65, we could not observe any of these cytotoxic activities. The fact that the HumAbs can fix complement and induce complement-dependent phagocytosis but are devoid of ADCC or CDC activity implies that the neutralization mechanism does not involve hepatocellular damage. The lack of cytotoxicity suggests a good safety profile when using the antibodies therapeutically to prevent HCV infection of liver cells.

The impact of immunosuppressive drugs on this proposed mechanism of action should be further investigated in the post-transplant setting.

Passive immunotherapy of HBV-associated liver transplant patients with human-derived immunoglobulins was effective in preventing reinfection of liver grafts (39). A similar approach using human plasma enriched with anti-HCV antibodies (HCIG) to treat HCV-associated liver transplant patients was recently reported (15). HCIG was generally safe and well tolerated in this group of patients; however, it did not suppress serum HCV RNA. The lack of significant viral suppression by HCIG could be a result of either an insufficient dose or a very low level of neutralizing antibodies in the polyclonal preparation.

The amount of neutralizing antibodies can be predicted using the HCV Trimera model. This model indicates that sera from HCV-infected patients are able to infect human liver tissue regardless of the presence of endogenous anti-E2 antibodies in these sera. Since HCV-AB 68 and HCV-AB 65 were able to inhibit infection of liver fragments when added to the infectious sera, we propose that these are neutralizing antibodies, different from the existing endogenous ones. Inhibition of infection in the HCV Trimera model was achieved using 200 µg of the HumAbs in 1 ml of high-titer HCV serum. This suggests that a dose of at least 500 mg of neutralizing antibodies would be needed to inhibit a similar viral titer in humans.

The high mutation rate in the HCV genome causes genetic heterogeneity, leading to evolution of quasispecies and the emergence of drug-resistant mutants (20). Although each one of the described HumAbs could be considered for monotherapeutic prevention of HCV infection, the outcome could be the emergence of escape mutants due to selective pressure. The combination of two high-affinity HumAbs, each directed to a different epitope on the E2 of HCV, could potentially have broad reactivity in binding quasispecies, thus decreasing the probability of viral escape mutants and reducing the likelihood of viral resistance with prolonged therapy. Although the HCV Trimera system allows testing of drug efficacy, it does not provide a tool to monitor the development of drug-resistant mutants. The rationale of using a mixture of the two HumAbs to prevent or delay emergence of escape mutants will be tested in clinical studies.

In summary, the preclinical characteristics of two fully human monoclonal antibodies against HCV E2 were described. Our findings, both in vitro and in vivo, represent a proof of principle for their anti-HCV neutralizing activity. These HumAbs could be developed into potential antiviral therapeutics, and their clinical relevance, including dose regimens and mode of administration, should be assessed in HCV-infected patients.

 
This work was supported in part by Public Health Service grants AI047355 and HL079381 to S.K.H.F.

 
* Corresponding author. Mailing address: XTL Biopharmaceuticals Ltd., Rehovot, Israel. Phone: 972-89304443. Fax: 972-89304445. E-mail: sdagan{at}xtlbio.com.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Alter, M. J., E. E. Mast, L. A. Moyer, and H. S. Margolis. 1998. Hepatitis C. Infect. Dis. Clin. N. Am. 12:13-26.[CrossRef][Medline]
2
2. Bartenschlager, R., and V. Lohmann. 2000. Replication of hepatitis C virus. J. Gen. Virol. 81:1631-1648.[Free Full Text]
3
3. Bartosch, B., J. Bukh, J. C. Meunier, C. Granier, R. E. Engle, W. C. Blackwelder, S. U. Emerson, F. L. Cosset, and R. H. Purcell. 2003. In vitro assay for neutralizing antibody to hepatitis C virus: evidence for broadly conserved neutralization epitopes. Proc. Natl. Acad. Sci. USA 100:14199-14204.[Abstract/Free Full Text]
4
4. Bartosch, B., J. Dubuisson, and F. L. Cosset. 2003. Infectious hepatitis C virus pseudo-particles containing functional E1-E2 envelope protein complexes. J. Exp. Med. 197:633-642.[Abstract/Free Full Text]
5
5. Bartosch, B., A. Vitelli, C. Granier, C. Goujon, J. Dubuisson, S. Pascale, E. Scarselli, R. Cortese, A. Nicosia, and F. L. Cosset. 2003. Cell entry of hepatitis C virus requires a set of co-receptors that include the CD81 tetraspanin and the SR-B1 scavenger receptor. J. Biol. Chem. 278:41624-41630.[Abstract/Free Full Text]
6
6. Baumert, T. F., S. Ito, D. T. Wong, and T. J. Liang. 1998. Hepatitis C virus structural proteins assemble into viruslike particles in insect cells. J. Virol. 72:3827-3836.[Abstract/Free Full Text]
7
7. Bendinelli, M., M. L. Vatteroni, F. Maggi, and M. Pistello. 1999. Hepatitis C viruses: biology, pathogenesis, epidemiology, clinical description, and diagnosis, p. 65-127. In S. Specter (ed.), Viral hepatitis: diagnosis, therapy, and prevention. Humana Press, Inc., Totowa, N.J.
8
8. Brown, R. S. 2005. Hepatitis C and liver transplantation. Nature 436:973-978.[CrossRef][Medline]
9
9. Bukh, J. 2004. A critical role for the chimpanzee model in the study of hepatitis C. Hepatology 39:1469-1475.[CrossRef][Medline]
10
10. Bukh, J., R. H. Miller, and R. H. Purcell. 1995. Genetic heterogeneity of hepatitis C virus: quasispecies and genotypes. Semin. Liver Dis. 15:41-63.[Medline]
11
11. Charlton, M. 2003. Natural history of hepatitis C and outcomes following liver transplantation. Clin. Liver Dis. 7:585-602.[CrossRef][Medline]
12
12. Choo, Q. L., K. H. Richman, J. H. Han, K. Berger, C. Lee, C. Dong, C. Gallegos, D. Coit, R. Medina-Selby, P. J. Barr, et al. 1991. Genetic organization and diversity of the hepatitis C virus. Proc. Natl. Acad. Sci. USA 88:2451-2455.[Abstract/Free Full Text]
13
13. Clynes, R., C. Dumitru, and J. V. Ravetch. 1998. Uncoupling of immune complex formation and kidney damage in autoimmune glomerulonephritis. Science 279:1052-1054.[Abstract/Free Full Text]
14
14. da Silva Cardoso, M., K. Siemoneit, D. Sturm, C. Krone, D. Moradpour, and B. Kubanek. 1998. Isolation and characterization of human monoclonal antibodies against hepatitis C virus envelope glycoproteins. J. Med. Virol. 55:28-34.[CrossRef][Medline]
15
15. Davis, G. L., D. R. Nelson, N. Terrault, T. L. Pruett, T. D. Schiano, C. V. Fletcher, C. V. Sapan, L. N. Riser, Y. Li, R. J. Whitley, and J. W. Gnann, Jr. 2005. A randomized, open-label study to evaluate the safety and pharmacokinetics of human hepatitis C immune globulin (Civacir) in liver transplant recipients. Liver Transpl. 11:941-949.[CrossRef][Medline]
16
16. Eren, R., E. Ilan, O. Nussbaum, I. Lubin, D. Terkieltaub, Y. Arazi, O. Ben-Moshe, A. Kitchinzky, S. Berr, J. Gopher, A. Zauberman, E. Galun, D. Shouval, N. Daudi, A. Eid, O. Jurim, L. O. Magnius, B. Hammas, Y. Reisner, and S. Dagan. 2000. Preclinical evaluation of two human anti-hepatitis B virus (HBV) monoclonal antibodies in the HBV-Trimera mouse model and in HBV chronic carrier chimpanzees. Hepatology 32:588-596.[CrossRef][Medline]
17
17. Eren, R., I. Lubin, D. Terkieltaub, O. Ben-Moshe, A. Zauberman, R. Uhlmann, T. Tzahor, S. Moss, E. Ilan, D. Shouval, E. Galun, N. Daudi, H. Marcus, Y. Reisner, and S. Dagan. 1998. Human monoclonal antibodies specific to hepatitis B virus generated in a human/mouse radiation chimera: the Trimera system. Immunology 93:154-161.[CrossRef][Medline]
18
18. Farci, P., H. J. Alter, S. Govindarajan, D. C. Wong, R. Engle, R. R. Lesniewski, I. K. Mushahwar, S. M. Desai, R. H. Miller, N. Ogata, et al. 1992. Lack of protective immunity against reinfection with hepatitis C virus. Science 258:135-140.[Abstract/Free Full Text]
19
19. Farci, P., H. J. Alter, D. C. Wong, R. H. Miller, S. Govindarajan, R. Engle, M. Shapiro, and R. H. Purcell. 1994. Prevention of hepatitis C virus infection in chimpanzees after antibody-mediated in vitro neutralization. Proc. Natl. Acad. Sci. USA 91:7792-7796.[Abstract/Free Full Text]
20
20. Farci, P., A. Shimoda, A. Coiana, G. Diaz, G. Peddis, J. C. Melpolder, A. Strazzera, D. Y. Chien, S. J. Munoz, A. Balestrieri, R. H. Purcell, and H. J. Alter. 2000. The outcome of acute hepatitis C predicted by the evolution of the viral quasispecies. Science 288:339-344.[Abstract/Free Full Text]
21
21. Farci, P., A. Shimoda, D. Wong, T. Cabezon, D. De Gioannis, A. Strazzera, Y. Shimizu, M. Shapiro, H. J. Alter, and R. H. Purcell. 1996. Prevention of hepatitis C virus infection in chimpanzees by hyperimmune serum against the hypervariable region 1 of the envelope 2 protein. Proc. Natl. Acad. Sci. USA 93:15394-15399.[Abstract/Free Full Text]
22
22. Galun, E., R. Eren, R. Safadi, Y. Ashour, N. Terrault, E. B. Keeffe, E. Matot, S. Mizrachi, D. Terkieltaub, M. Zohar, I. Lubin, J. Gopher, D. Shouval, and S. Dagan. 2002. Clinical evaluation (phase I) of a combination of two human monoclonal antibodies to HBV: safety and antiviral properties. Hepatology 35:673-679.[CrossRef][Medline]
23
23. Garcia-Retortillo, M., X. Forns, A. Feliu, E. Moitinho, J. Costa, M. Navasa, A. Rimola, and J. Rodes. 2002. Hepatitis C virus kinetics during and immediately after liver transplantation. Hepatology 35:680-687.[CrossRef][Medline]
24
24. Hadlock, K. G., R. E. Lanford, S. Perkins, J. Rowe, Q. Yang, S. Levy, P. Pileri, S. Abrignani, and S. K. Foung. 2000. Human monoclonal antibodies that inhibit binding of hepatitis C virus E2 protein to CD81 and recognize conserved conformational epitopes. J. Virol. 74:10407-10416.[Abstract/Free Full Text]
25
25. Ilan, E., J. Arazi, O. Nussbaum, A. Zauberman, R. Eren, I. Lubin, L. Neville, O. Ben-Moshe, A. Kischitzky, A. Litchi, I. Margalit, J. Gopher, S. Mounir, W. Cai, N. Daudi, A. Eid, O. Jurim, A. Czerniak, E. Galun, and S. Dagan. 2002. The hepatitis C virus (HCV)-Trimera mouse: a model for evaluation of agents against HCV. J. Infect. Dis. 185:153-161.[CrossRef][Medline]
26
26. Ilan, E., R. Eren, I. Lubin, O. Nussbaum, A. Zauberman, and S. Dagan. 2002. The Trimera mouse: a system for generating human monoclonal antibodies and modeling human diseases. Curr. Opin. Mol. Ther. 4:102-109.[Medline]
27
27. Kabat, E. A., et al. 1991. Sequences of proteins of immunological interest, 5th ed. U.S. Department of Health and Human Services, National Institutes of Health, Bethesda, Md.
28
28. Keck, Z. Y., T. K. Li, J. Xia, B. Bartosch, F. L. Cosset, J. Dubuisson, and S. K. Foung. 2005. Analysis of a highly flexible conformational immunogenic domain in hepatitis C virus E2. J. Virol. 79:13199-13208.[Abstract/Free Full Text]
29
29. Keck, Z. Y., A. Op De Beeck, K. G. Hadlock, J. Xia, T. K. Li, J. Dubuisson, and S. K. Foung. 2004. Hepatitis C virus E2 has three immunogenic domains containing conformational epitopes with distinct properties and biological functions. J. Virol. 78:9224-9232.[Abstract/Free Full Text]
30
30. Keck, Z. Y., V. M. Sung, S. Perkins, J. Rowe, S. Paul, T. J. Liang, M. M. Lai, and S. K. Foung. 2004. Human monoclonal antibody to hepatitis C virus E1 glycoprotein that blocks virus attachment and viral infectivity. J. Virol. 78:7257-7263.[Abstract/Free Full Text]
31
31. Krawczynski, K., M. J. Alter, D. L. Tankersley, M. Beach, B. H. Robertson, S. Lambert, G. Kuo, J. E. Spelbring, E. Meeks, S. Sinha, and D. A. Carson. 1996. Effect of immune globulin on the prevention of experimental hepatitis C virus infection. J. Infect. Dis. 173:822-828.[Medline]
32
32. Lanford, R. E., and C. Bigger. 2002. Advances in model systems for hepatitis C virus research. Virology 293:1-9.[CrossRef][Medline]
33
33. Logvinoff, C., M. E. Major, D. Oldach, S. Heyward, A. Talal, P. Balfe, S. M. Feinstone, H. Alter, C. M. Rice, and J. A. McKeating. 2004. Neutralizing antibody response during acute and chronic hepatitis C virus infection. Proc. Natl. Acad. Sci. USA 101:10149-10154.[Abstract/Free Full Text]
34
34. Major, M. E., H. Dahari, K. Mihalik, M. Puig, C. M. Rice, A. U. Neumann, and S. M. Feinstone. 2004. Hepatitis C virus kinetics and host responses associated with disease and outcome of infection in chimpanzees. Hepatology 39:1709-1720.[CrossRef][Medline]
35
35. Mercer, D. F., D. E. Schiller, J. F. Elliott, D. N. Douglas, C. Hao, A. Rinfret, W. R. Addison, K. P. Fischer, T. A. Churchill, J. R. Lakey, D. L. Tyrrell, and N. M. Kneteman. 2001. Hepatitis C virus replication in mice with chimeric human livers. Nat. Med. 7:927-933.[CrossRef][Medline]
36
36. Nattermann, J., A. M. Schneiders, L. Leifeld, B. Langhans, M. Schulz, G. Inchauspe, B. Matz, H. H. Brackmann, M. Houghton, T. Sauerbruch, and U. Spengler. 2005. Serum antibodies against the hepatitis C virus E2 protein mediate antibody-dependent cellular cytotoxicity (ADCC). J. Hepatol. 42:499-504.[CrossRef][Medline]
37
37. Perkins, S., and S. K. Foung. 1995. Stabilizing antibody secretion of human Epstein Barr virus-activated B-lymphocytes with hybridoma formation by electrofusion. Methods Mol. Biol. 48:295-307.[Medline]
38
38. Puntoriero, G., A. Meola, A. Lahm, S. Zucchelli, B. B. Ercole, R. Tafi, M. Pezzanera, M. U. Mondelli, R. Cortese, A. Tramontano, G. Galfre, and A. Nicosia. 1998. Towards a solution for hepatitis C virus hypervariability: mimotopes of the hypervariable region 1 can induce antibodies cross-reacting with a large number of viral variants. EMBO J. 17:3521-3533.[CrossRef][Medline]
39
39. Samuel, D., R. Muller, G. Alexander, L. Fassati, B. Ducot, J. P. Benhamou, and H. Bismuth. 1993. Liver transplantation in European patients with the hepatitis B surface antigen. N. Engl. J. Med. 329:1842-1847.[Abstract/Free Full Text]
40
40. Schinazi, R. F., E. Ilan, P. L. Black, X. Yao, and S. Dagan. 1999. Cell-based and animal models for hepatitis B and C viruses. Antivir. Chem. Chemother. 10:99-114.[Medline]
41
41. Shouval, D., and D. Samuel. 2000. Hepatitis B immune globulin to prevent hepatitis B virus graft reinfection following liver transplantation: a concise review. Hepatology 32:1189-1195.[CrossRef][Medline]
42
42. Siemoneit, K., M. da Silva Cardoso, A. Wolpl, K. Koerner, and B. Kubanek. 1994. Isolation and epitope characterization of human monoclonal antibodies to hepatitis C virus core antigen. Hybridoma 13:9-13.[Medline]
43
43. Steinmann, D., H. Barth, B. Gissler, P. Schurmann, M. I. Adah, J. T. Gerlach, G. R. Pape, E. Depla, D. Jacobs, G. Maertens, A. H. Patel, G. Inchauspe, T. J. Liang, H. E. Blum, and T. F. Baumert. 2004. Inhibition of hepatitis C virus-like particle binding to target cells by antiviral antibodies in acute and chronic hepatitis C. J. Virol. 78:9030-9040.[Abstract/Free Full Text]
44
44. Triyatni, M., B. Saunier, P. Maruvada, A. R. Davis, L. Ulianich, T. Heller, A. Patel, L. D. Kohn, and T. J. Liang. 2002. Interaction of hepatitis C virus-like particles and cells: a model system for studying viral binding and entry. J. Virol. 76:9335-9344.[Abstract/Free Full Text]
45
45. Wasley, A., and M. J. Alter. 2000. Epidemiology of hepatitis C: geographic differences and temporal trends. Semin. Liver Dis. 20:1-16.[CrossRef][Medline]
46
46. Wellnitz, S., B. Klumpp, H. Barth, S. Ito, E. Depla, J. Dubuisson, H. E. Blum, and T. F. Baumert. 2002. Binding of hepatitis C virus-like particles derived from infectious clone H77C to defined human cell lines. J. Virol. 76:1181-1193.[Abstract/Free Full Text]
47
47. Willems, B. E. M., P. Marotta, W. Wall, P. Greig, L. Lilly, N. Kneteman, W. Wong, A. Roy, D. Marleau, C. Scudamore, E. Yoshida, and A. Rinfret. 2002. Anti-HCV human immunoglobulins for the prevention of graft infection in HCV-related liver transplantation, a pilot study. J. Hepatol. 36:S32.
48
48. Wong, W., and N. Terrault. 2005. Update on chronic hepatitis C. Clin. Gastroenterol. Hepatol. 3:507-520.[CrossRef][Medline]
49
49. Yu, M. Y., B. Bartosch, P. Zhang, Z. P. Guo, P. M. Renzi, L. M. Shen, C. Granier, S. M. Feinstone, F. L. Cosset, and R. H. Purcell. 2004. Neutralizing antibodies to hepatitis C virus (HCV) in immune globulins derived from anti-HCV-positive plasma. Proc. Natl. Acad. Sci. USA 101:7705-7710.[Abstract/Free Full Text]

---

Journal of Virology, March 2006, p. 2654-2664, Vol. 80, No. 6
0022-538X/06/$08.00+0     doi:10.1128/JVI.80.6.2654-2664.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Brezillon, N., Kremsdorf, D., Weiss, M. C. (2008). Cell therapy for the diseased liver: from stem cell biology to novel models for hepatotropic human pathogens. DMM 1: 113-130 [Abstract] [Full Text]  
• Owsianka, A. M., Tarr, A. W., Keck, Z.-Y., Li, T.-K., Witteveldt, J., Adair, R., Foung, S. K. H., Ball, J. K., Patel, A. H. (2008). Broadly neutralizing human monoclonal antibodies to the hepatitis C virus E2 glycoprotein. J. Gen. Virol. 89: 653-659 [Abstract] [Full Text]  
• Gros, L., Pelegrin, M., Michaud, H.-A., Bianco, S., Hernandez, J., Jacquet, C., Piechaczyk, M. (2008). Endogenous Cytotoxic T-Cell Response Contributes to the Long-Term Antiretroviral Protection Induced by a Short Period of Antibody-Based Immunotherapy of Neonatally Infected Mice. J. Virol. 82: 1339-1349 [Abstract] [Full Text]  
• Meunier, J.-C., Russell, R. S., Goossens, V., Priem, S., Walter, H., Depla, E., Union, A., Faulk, K. N., Bukh, J., Emerson, S. U., Purcell, R. H. (2008). Isolation and Characterization of Broadly Neutralizing Human Monoclonal Antibodies to the E1 Glycoprotein of Hepatitis C Virus. J. Virol. 82: 966-973 [Abstract] [Full Text]  
• Perotti, M., Mancini, N., Diotti, R. A., Tarr, A. W., Ball, J. K., Owsianka, A., Adair, R., Patel, A. H., Clementi, M., Burioni, R. (2008). Identification of a Broadly Cross-Reacting and Neutralizing Human Monoclonal Antibody Directed against the Hepatitis C Virus E2 Protein. J. Virol. 82: 1047-1052 [Abstract] [Full Text]  
• Tellinghuisen, T. L., Evans, M. J., von Hahn, T., You, S., Rice, C. M. (2007). Studying Hepatitis C Virus: Making the Best of a Bad Virus. J. Virol. 81: 8853-8867 [Full Text]  
• Zhang, P., Wu, C. G., Mihalik, K., Virata-Theimer, M. L., Yu, M.-y. W., Alter, H. J., Feinstone, S. M. (2007). Hepatitis C virus epitope-specific neutralizing antibodies in Igs prepared from human plasma. Proc. Natl. Acad. Sci. USA 104: 8449-8454 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Eren, R. Articles by Dagan, S. Search for Related Content PubMed PubMed Citation Articles by Eren, R. Articles by Dagan, S.