This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Heimann, M.
Right arrow Articles by Rümenapf, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Heimann, M.
Right arrow Articles by Rümenapf, T.

 Previous Article  |  Next Article 

Journal of Virology, February 2006, p. 1915-1921, Vol. 80, No. 4
0022-538X/06/$08.00+0     doi:10.1128/JVI.80.4.1915-1921.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Core Protein of Pestiviruses Is Processed at the C Terminus by Signal Peptide Peptidase

Manuela Heimann,1 Gleyder Roman Sosa,1 Bruno Martoglio,2 Heinz-Jürgen Thiel,1 and Till Rümenapf1*

Institut für Virologie (FB Veterinärmedizin), Justus Liebig Universität Giessen, Frankfurter Str. 107, D-35392 Giessen, Germany,1 Novartis Institutes for BioMedical Research, Novartis Pharma AG, CH-4002 Basel, Switzerland2

Received 10 September 2005/ Accepted 18 November 2005


arrow
ABSTRACT
 
The core protein of pestiviruses is released from the polyprotein by viral and cellular proteinases. Here we report on an additional intramembrane proteolytic step that generates the C terminus of the core protein. C-terminal processing of the core protein of classical swine fever virus (CSFV) was blocked by the inhibitor (Z-LL)2-ketone, which is specific for signal peptide peptidase (SPP). The same effect was obtained by overexpression of the dominant-negative SPP D265A mutant. The presence of (Z-LL)2-ketone reduced the viability of CSFV almost 100-fold in a concentration-dependent manner. Reduction of virus viability was also observed in infection experiments using a cell line that inducibly expressed SPP D265A. The position of SPP cleavage was determined by C-terminal sequencing of core protein purified from virions. The C terminus of CSFV core protein is alanine255 and is located in the hydrophobic center of the signal peptide. The intramembrane generation of the C terminus of the CSFV core protein is almost identical to the processing scheme of the core protein of hepatitis C viruses.


arrow
INTRODUCTION
 
Pestiviruses are small, enveloped RNA viruses that account for important diseases in farm animals, e.g., classical swine fever (also known as hog cholera) and bovine viral diarrhea. Pestiviruses constitute one genus within the Flaviviridae and contain a message sense RNA of about 12.3 kilobases. The genome is translated into a single polyprotein that is processed by cellular and viral proteases into 12 mature proteins. The virion consists of four structural proteins, the core protein and the glycoproteins Erns, E1, and E2 (19). The core protein of all members of the Flaviviridae is a small protein rich in basic amino acids and locates at or near the N terminus of the polyprotein (11). In the pestivirus polyprotein, the core protein is located between the N-terminal protease Npro and the glycoprotein Erns. Npro generates the N terminus (Ser169) of the core protein by autocatalytic cleavage of the polyprotein (15, 18). Core protein is followed by Erns, whose N terminus (Asp268) is generated by signal peptidase (signalase, or SP) (16).

Two different mechanisms of release of core protein from the polyprotein have been described for members of the Flaviviridae. Members of the genus Flavivirus (e.g., yellow fever virus [YFV]) employ the virally encoded NS2B-3 protease to generate the C terminus of core protein. The NS2B-3 protease of YFV cleaves the core protein precursor at a tribasic consensus sequence at the N terminus of the preM signal peptide (1). For hepatitis C virus (HCV), signal peptide peptidase (SPP) was recently determined to cleave within the C-terminal domain of core protein (7). Thus far, three different C termini have been proposed for HCV core protein. N-terminal sequencing of HCV core-dihydrofolate reductase fusion proteins revealed cleavage after Leu179 or Leu182 (4). In a recent report, Phe177 was identified as the C terminus of HCV core protein by using matrix-assisted laser desorption ionization-time-of-flight mass spectrometry (MALDI-TOF MS) (8). All proposed C termini of HCV core protein locate within the central hydrophobic domain of the signal peptide that conducts the translocation of E1 to the endoplasmic reticulum (4). Evidence for the involvement of the intramembrane proteinase SPP in the processing of HCV core protein came from inhibitor studies using peptidomimetic (carboxybenzoyl-Leu-Leu)2-ketone [(Z-LL)2-ketone] and overexpression of the SPP D219A loss-of-function mutant (9, 20). Analysis of the SPP cleavage site revealed that helix-breaking or -bending residues are a prerequisite for SPP cleavage to occur. These residues were identified in the HCV sequence by site-directed mutagenesis of either Ser183Cys184 (7) or Ile175Phe176 (9). SPP is an aspartyl protease of the GXGD type and is related to presenilin (20). Several SPP-like proteins that operate at different subcellular localizations have been identified or functionally characterized (5). SPP promotes intramembrane proteolysis to release biologically important peptides that are incorporated, for example, as histocompatibility E (HLA-E) epitopes into polymorphic major histocompatibility complex class I molecules (2). The experiments described here show that processing of classical swine fever virus (CSFV) core protein is conducted by SPP and that inhibition of SPP results in a reduced virus yield.


arrow
MATERIALS AND METHODS
 
Viruses, cells, antibodies, and immunoblotting. CSFV AlfortTü (14) was propagated on SK6 cells (3) in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum at 37°C under 5% CO2. For detection of core protein, an anti-D1* polyclonal antiserum (18) and monoclonal antibody (MAb) GRS-5H4 (unpublished) were used. The FLAG epitope was detected with monoclonal antibody M2 (anti-FLAG) from Sigma. Immunoblot analysis of bacterial lysates or CSFV-infected cells was done essentially as described elsewhere (6). Peroxidase-conjugated anti-rabbit- or anti-mouse secondary antibodies were from Dianova. The signal was revealed using chemiluminescence and exposure to Kodak BioMax film (Sigma, Munich, Germany).

Bacterial expression of C-terminally truncated core protein. CSFV cDNA encoding Npro-core was amplified using oligonucleotide co64 (CGGGATCCATGGAGTTGAATCATTTT), which adds a BamHI restriction site to the 5' end of the Npro gene, and oligonucleotides that introduce an XhoI site downstream of an opal codon at positions analogous to Glu268 (co207, AACTCGAGTCAGGCTGCTACAGGCTGG), Ile257 (co209, AACTCGAGTCACGCCCAAGCCAACAG), Val256 (co210, AACTCGAGTCACGCCCAAGCCAACAGGGC), Ala255 (co211, AACTCGAGTCACCAAGCCAACAGGGCTTTT), and Trp254 (co212, AACTCGAGTCAAGCCAACAGGGCCTTTTTC). The PCR products were treated with BamHI and XhoI and ligated into BamHI/XhoI-digested plasmid pGEX6p1 (Amersham, Freiburg, Germany) in frame with a glutathione-S-transferase (GST) gene. The resulting plasmids p860 to p865 were transformed into Rosetta pLysS cells (Novagen, Darmstadt, Germany). Protein expression was initiated by addition of 1 mM isopropyl-thiogalactoside (Alexis, Gruenberg, Germany) at an optical density of 0.8 for 1 h at 37°C. Cells were boiled in 1% sodium dodecyl sulfate (SDS), subjected to SDS-polyacrylamide gel electrophoresis (PAGE) using Tris-Tricine buffers (17), and analyzed by immunoblot analysis using anti-D1* antiserum at a dilution of 1:10,000.

Cell-free translation. SP6 transcripts were synthesized from cDNA encoding Npro-core-Erns from CSFV and positioned downstream of a SP6 promoter and the 56-nucleotide (nt) nontranslated region of Sindbis virus (15). The plasmid was linearized with XbaI and subjected to transcription with SP6 RNA polymerase (Natutec, Kelsterbach, Germany). Uncapped transcripts were added to rabbit reticulocyte lysate (Promega, Mannheim, Germany) which was supplemented with canine microsomal membranes (Promega, Mannheim, Germany) and [35S]methionine (Amersham, Freiburg, Germany). (Z-LL)2-ketone (from B.M.) was dissolved in dimethyl sulfoxide (DMSO) and added to the translation reaction mixture at a concentration of 10 µM. Translation reactions were terminated by addition of cycloheximide, reaction products were diluted with phosphate-buffered saline (PBS), and microsomes were pelleted at 100,000 x g for 15 min in a TLA 45 rotor (Beckman, Munich, Germany). The microsomal pellet was washed once with ice-cold PBS and subjected to SDS-PAGE in Tris-Tricine gels. Gels were fixed in a solution containing 10% acetic acid and 40% methanol and were dried before exposure to Kodak Biomax X-ray film (Sigma, Munich, Germany).

Inhibition of core C-terminal processing. Multiple tissue culture plates containing 5 x 106 SK6 cells were infected with CSFV AlfortTü at a multiplicity of 3. At 12 h postinfection (p.i.), (Z-LL)2-ketone, MG132 (carboxybenzoyl-Leu-Leu-leucinal), proteasome inhibitor II (benzyloxycarbonyl-Leu-Leu-phenylalaninal), calpain inhibitor I (N-acetyl-Leu-Leu-norleucinal [ALLN]), and lactacystin (all from Calbiochem, Darmstadt, Germany) were added to the culture media of individual plates at a concentration of 10 µM. The culture media of CSFV-infected SK6 cells that were not treated with inhibitors were supplemented with 1% DMSO. For growth curve analysis, the culture medium was removed and replaced with fresh medium containing the respective inhibitor at 12, 24, 48, and 72 h postinfection. Titers of virus released into the collected supernatants were determined by infectious center assays using SK6 cells and monoclonal antibody A18 (anti-CSFV E2) (21). For protein analysis, infected cells were lysed 22 h postinfection and subjected to SDS-PAGE and immunoblot analysis.

Expression of dominant-negative signal peptide peptidase. (i) Construction of wt SPP and SPP D265A expression plasmids. The coding regions of human wild-type (wt) SPP and D265A mutant SPP (20) were ligated via HindIII (filled in) and EcoRI sites into BamHI (filled in)/EcoRI sites of plasmid pTRE (BD Clontech, Heidelberg, Germany) carrying a tetracycline-responsive element (12). A FLAG tag was introduced between the sixth and fifth from last amino acid of wt SPP and D265A mutant SPP by PCR using primers SPP-FLAG (GACGATGATAAGAAAGAGAAA-TGATGCAG) and SPP-FLAG rev (GTCTTTGTAGTCCAGCCCCTTCGATGCTG). The resulting plasmids (p927 and p928) were cotransfected with pEF-pac into SK6 TET-on (tetracycline-inducible expression; SK6T) cells using Superfect reagent (QIAGEN, Hilden, Germany). SK6T cells constitutively express the rtTA activator and were established by transfection of plasmid pcEFtet-on/NEO protein (12) and selection with 1 mg/ml G418 (Calbiochem, Darmstadt, Germany). SK6T cell clones expressing human wt and D265A mutant SPPs were first selected with 5 mg/ml puromycin (Alexis, Gruenberg, Germany) and then identified by immunohistochemistry using the anti-FLAG monoclonal antibody M2 (Sigma, Munich, Germany) after induction of the cells with 2 mg/ml doxycycline (Dox; MP Biochemicals, Eschwege, Germany) for 24 h.

(ii) Infection experiments. A total of 5 x 106 SK6T, SK6T-SPP wt, and SK6T-SPP D265A cells were infected with CSFV AlfortTü at a multiplicity of 3, and 5 mg/ml doxycycline was added. For growth curve analysis, the culture medium was removed and replaced with fresh medium containing doxycycline at 12, 24, 48, and 72 h postinfection. Titers of virus released into the collected supernatants were determined by infectious center assays on SK6 cells using monoclonal antibody A18 (21). For protein analysis, infected cells were lysed 24 h postinfection and subjected to SDS-PAGE and immunoblot analysis.

Purification of core protein from virions. A FLAG tag extended by an additional serine residue (SDYKDDDDK-S169) was added to the N terminus of CSFV core by PCR and cloned into the infectious cDNA clone p447 (3), giving rise to p585. Sequence analysis of the core coding region of p585 revealed that in addition to the FLAG tag (plus a serine residue), the codon of glycine213 (GGA) present in the CSFV Alfort strain (GenBank accession number J04358) had changed to glutamic acid (GAA). The virus recovered from electroporation of SK6 cells stably expressed the FLAG epitope over multiple passages and was used to infect 1010 38A1D porcine lymphoma cells. Cells were cultivated in 7 liters of culture medium in a 25-liter culture vessel with a bottle-top stirring device (both from Nalgene, Wiesbaden, Germany). At 72 h after infection, the culture medium was cleared by centrifugation at 10,000 x g for 30 min in a Sorvall GSA rotor (Kendro, Langenselbold, Germany). The supernatant was adjusted to 300 mM NaCl, 7% polyethylene glycol 6000 (PEG 6000) (Sigma, Munich, Germany), and stirred overnight at 4°C. The precipitate was pelleted at 15,000 x g for 30 min in a Sorvall GSA rotor. The pellet was dissolved in PBS and subjected to ultracentrifugation in a SW28 rotor (Beckman, Munich, Germany) for 3 h at 25,000 rpm. Concentrated virus was solubilized with 1% Triton X-100 in PBS and applied to a column packed with 1 ml of anti-FLAG M2 agarose (Sigma, Munich, Germany). The column was washed extensively with PBS, and FLAG-core was eluted with 100 mM glycine, pH 3.5, as described by the manufacturer. The eluate was subjected to N- and C-terminal sequencing and MALDI-TOF MS at Eurosequence BV (Groningen, The Netherlands).


arrow
RESULTS
 
Inhibitor of signal peptide peptidase blocks processing of CSFV core protein. The core protein of CSFV requires processing at the N and C termini in order to be released from the polyprotein. These cleavages are performed by the virally encoded autoprotease Npro and the host cellular SP between Cys168/Ser169 and Ala267/Asp268, respectively. Because the apparent molecular mass of a bacterially expressed core protein that terminates at Ala267 exceeded the apparent molecular mass of core protein from CSFV virions, a further proteolytic step was suspected (Fig. 1, lanes 1 and 2). Bacterially expressed core protein with C termini around tryptophan 254 almost comigrated with core protein from CSFV virions in immunoblot analysis (Fig. 1, lanes 2 to 7). This result indicated that mature CSFV core protein is about 12 to 14 amino acids smaller than the core precursor protein. A precise determination of the core protein's borders was not possible by the comigration approach, because it was not clear whether the additional processing step affected the N and/or C terminus. Recently a cleavage that occurs within the membrane-spanning C-terminal domain of the core protein of HCV (7) has been identified. As the processing protease, the novel aspartic proteinase SPP has been proposed (20). Important evidence for this finding came from the use of (Z-LL)2-ketone and the expression of a dominant-negative mutant of SPP (9). In either case the action of SPP was inhibited. Since HCV and CSFV share many features of genome organization and polyprotein processing, the effect of (Z-LL)2-ketone on the processing of CSFV core protein was assayed by cell-free translation and infection experiments. For cell-free translation, CSFV cDNA encoding Npro, core, and Erns was cloned into the XbaI/XhoI sites of pToto57 (15) downstream of a SP6 promoter and the 5' nontranslated region of Sindbis virus. Uncapped transcripts were prepared from an XhoI-linearized plasmid (p57core) and added to translation-grade reticulocyte lysate that was supplemented with [35S]methionine (Fig. 2, lane 1) and canine microsomal membranes (Fig. 2, lanes 2 to 5). After translation, crude lysates (Fig. 2, lanes 1, 2, and 3) or an enriched microsome fraction was subjected to SDS-PAGE using a Tris-Tricine buffer system. Only in the presence of microsomal membranes was core protein observed, which in the enriched microsome fraction is resolved into a doublet with apparent molecular masses of 14 kDa and 16 kDa. In the presence of 10 µM (Z-LL)2-ketone, the 16-kDa band (core+) is the predominant form of the core protein (Fig. 2, lanes 4 and 5). Both smaller and larger core protein bands are visible in the crude lysate (Fig. 2, lanes 2 and 3), but the resolution of the SDS-PAGE was massively compromised by high concentrations of hemoglobin. Enrichment of the microsomal membranes by centrifugation improved the separation of protein bands in the 12- to 20-kDa molecular mass range (Fig. 2, lanes 4 and 5) but led to underrepresentation of the mature core protein.


Figure 1
View larger version (26K):
[in this window]
[in a new window]
  		FIG. 1. Evidence for an additional cleavage of core protein. Core proteins with defined C termini (Ala267, Val256, Ala255, Trp254, Ala253) were expressed as GST-Npro-core fusions in E. coli. The autoproteolytic activity of Npro leads to the release of core protein. Crude bacterial lysates (lanes 1, 3, 4, 5, and 7) along with pelleted CSFV (lanes 2 and 6) were subjected to SDS-PAGE and immunoblot analysis. Polyclonal anti-D1* serum detects epitopes within the core protein as well as the Npro moiety of the GST-Npro fusion. While core protein with a C terminus at Ala267 (lane 1) has a higher apparent molecular mass, core proteins ending around Trp254 comigrate with the mature core protein from the virus. A light gray line is laid through the core protein bands from virions (lanes 2 and 5) to allow easier detection of mass differences.


Figure 2
View larger version (84K):
[in this window]
[in a new window]
  		FIG. 2. Processing of CSFV core protein is inhibited by (Z-LL)2-ketone. SP6 transcripts of CSFV encoding Npro-core-Erns were added to a reticulocyte lysate (lane 1) or lysates containing microsomal membranes (micr.) (lanes 2 to 5) in the presence of [35S]methionine. The SPP inhibitor (Z-LL)2-ketone was added at a concentration of 10 µM to the translation reaction mixtures for which results are shown in lanes 3 and 5. Crude lysates (lanes 1, 2, and 3) or microsomes enriched by centrifugation (lanes 4 and 5) were subjected to SDS-PAGE and autoradiography. In the absence of membranes, the core-Erns precursor and Npro are visible. Core and glycosylated Erns (48 kDa) are observed only in the presence of microsomal membranes and are enriched by centrifugation. Note the doublet of core and core+ in the absence of 10 µM (Z-LL)2-ketone (lane 4), while the higher-molecular-mass form of core is enriched in the presence of (Z-LL)2-ketone (lane 5).

Previous experiments had shown that CSFV core protein is easy to detect in material from concentrated virions by immunoblotting but rather difficult to find in CSFV-infected cells. Because there was reason to believe that core protein is unstable in CSFV-infected cells, the effects of (Z-LL)2-ketone and a selection of proteasome inhibitors on the processing and stability of core protein were studied (Fig. 3). SK6 cells were infected at a multiplicity of 3 with CSFV Alfort. At 12 h postinfection, (Z-LL)2-ketone and the proteasome inhibitors MG132, lactacystin, proteasome inhibitor II, and calpain inhibitor I (ALLN) were added for 10 h. Core protein was detected in the virus pellet (Fig. 3, lane 1) and cell lysates by Western blotting using anti-D1* antiserum (18). In the cell lysates no significant differences in the quantities were apparent, while the sizes of the core protein differed (Fig. 3, lanes 2 to 7). Core protein from cell lysates treated with lactacystin, ALLN, or DMSO (as a control) (Fig. 3, lanes 4, 6, and 7, respectively) comigrated with core protein of pelleted virus. The presence of (Z-LL)2-ketone (Fig. 3, lane 2) or proteasome inhibitor II (Fig. 3, lane 5) resulted in an increased molecular mass. MG132 gave rise to the simultaneous appearance of processed and unprocessed forms of core protein (Fig. 3, lane 3), a picture similar to that observed after cell-free translation.


Figure 3
View larger version (33K):
[in this window]
[in a new window]
  		FIG. 3. Processing of core protein in CSFV-infected cells is inhibited by different protease inhibitors. SK6 cells were infected with CSFV at a multiplicity of 3. At 12 h postinfection, DMSO (1%) (lane 7), (Z-LL)2-ketone (lane 2), MG132 (lane 3), lactacystin (lane 4), proteasome inhibitor II (Prot.inh.II) (lane 5), or ALLN (lane 6) was added for 10 h. All inhibitors were dissolved in DMSO and were used at concentrations of 10 µg/ml. Cells were lysed and subjected to SDS-PAGE and immunoblot analysis. Core protein from concentrated CSFV virions (equal to 106 FFU) is shown in lane 1. For detection of core protein, an anti-D1* polyclonal antiserum was employed which also detects Npro (visible at the upper margin). Detection of the weak signals (chemiluminescence) required extended exposure times (1 h).

Inhibition of SPP activity affects CSFV viability. Processing of CSFV core protein can apparently be blocked by (Z-LL)2-ketone and certain inhibitors of proteasomal degradation. It was therefore straightforward to examine the importance of C-terminal processing of core protein for the release of infectious CSFV. Pilot experiments revealed that MG132 and proteasome inhibitor II were not suitable for virus viability studies, because they exerted strong cytotoxicity. In contrast, (Z-LL)2-ketone left the monolayer intact even at high concentrations and thus allowed determination of growth kinetics after infection with CSFV. SK6 cells were infected with CSFV at a multiplicity of 3. At 6 h after infection, (Z-LL)2-ketone was added at concentrations of 10 µM, 50 µM, or 250 µM. Noncumulative growth curve analysis indicated a clear effect of (Z-LL)2-ketone on the release of infectious CSFV (Fig. 4). The inhibitory effect correlated with the concentration of (Z-LL)2-ketone and was most pronounced early in infection. A titer reduction of 96.8% was observed at 12 h after infection in the presence of 250 µM (Z-LL)2-ketone, while titer reductions were 91% and 82% at concentrations of 50 µM and 10 µM (Z-LL)2-ketone, respectively. The rate of inhibition decreased with time, and at 72 h the titers of (Z-LL)2-ketone-treated cells were equal to or even exceeded those of control infected cells. The presence of DMSO at a final concentration of 1% had no effect on virus release.


Figure 4
View larger version (15K):
[in this window]
[in a new window]
  		FIG. 4. Effect of (Z-LL)2-ketone on CSFV viability. SK6 cells were infected with CSFV at a multiplicity of 3. At 6 h after infection, (Z-LL)2-ketone was added at a concentration of 10 µM, 50 µM, or 250 µM. As a control, no inhibitor (w/o) or 1% DMSO was added to the culture medium. The culture medium was removed at 12, 24, and 72 h after transfection and replaced with fresh medium [with or without (Z-LL)2-ketone]. Virus titers were determined for each time point by infectious center assays on SK6 cells. The graph shows means from three independent experiments.

Cleavage of core protein is blocked by the dominant-negative D265A mutation of SPP. Inhibition of SPP by (Z-LL)2-ketone significantly reduced the viability of CSFV but did not abrogate generation of infectious virus (20). For this purpose, SK6 cell lines that inducibly expressed human D265A mutant and wt SPPs, respectively, were constructed. The SPP genes were modified by introduction of a C-terminal FLAG tag and were cloned into a tetracycline (TET-on)-controlled plasmid (pTRE). These plasmids were transfected into SK6T cells, which encode the tetracycline activator. SPP-expressing cell clones were identified by immunohistochemistry using the anti-FLAG antibody M2 after selection with puromycin.

The effect of expression of D265A dominant-negative mutant SPP on core protein processing was analyzed by infecting SK6T-SPP wt (Fig. 5, lanes 3 and 4) and SK6T-SPP D265A (Fig. 5, lanes 5 and 6) cells with CSFV at a multiplicity of 3. SK6T cells served as a control (Fig. 5, lanes 1 and 2). Induction of SPP expression was initiated by addition of Dox simultaneously with the infection. Cells were lysed 24 h after infection, and the processing of core protein and expression of SPP were analyzed by immunoblotting using monoclonal antibodies GRS-5H4 (anti-CSFV core protein) and M2 (anti-FLAG). FLAG-SPP was clearly overexpressed in the lysates of Dox-treated SK6T-SPP wt and SK6T-SPP D265A cells (Fig. 5, lanes 4 and 6) but was also detectable in uninduced cells (Fig. 5, lanes 3 and 5). While in the lysates of SK6T-SPP wt cells the processed core protein was detectable, in lysates of induced SK6T-SPP D265A cells only the precursor (core+) appeared (Fig. 5, lane 6). To assess the effects of D265A and wt SPP expression on the viability of CSFV, the respective cell lines were infected with CSFV and virus release was determined by noncumulative growth curve analysis (Fig. 6). Induction of SK6T-SPP D265A cells in multiple experiments led to a 30-fold reduction in CSFV titers compared to those for the noninduced cell line or SK6T cells. This inhibitory effect remained almost constant over 72 h (Fig. 6).


Figure 5
View larger version (42K):
[in this window]
[in a new window]
  		FIG. 5. Processing of core protein is blocked by expression of the dominant-negative SPP D265A mutant. Tetracycline-inducible SK6 cells (SK6T) (lanes 1 and 2) or SK6T cell lines expressing FLAG-tagged wt SPP (lanes 3 and 4) or SPP D265A (lanes 5 and 6) were infected with CSFV at a multiplicity of 3. SPP expression was induced by addition of Dox (5 µg/ml) at the time of infection (lanes 2, 4, and 6). Cells were lysed 24 h after infection and subjected to SDS-PAGE. Immunoblot analysis was performed with monoclonal antibodies GRS-5H4 (anti-CSFV core protein) and M2 (anti-FLAG). FLAG-SPP expression clearly increases with induction. Only in induced SK6T cells expressing SPP D265A does the uncleaved 16-kDa core precursor prevail (core+) (lane 6); in all other cells, C-terminal processing of core protein occurs.


Figure 6
View larger version (15K):
[in this window]
[in a new window]
  		FIG. 6. Expression of the dominant-negative SPP D265A mutant affects CSFV release. SK6T cells or SK6T cell lines expressing FLAG-tagged wt SPP or SPP D265A were infected with CSFV at a multiplicity of 3. SPP expression was induced by addition of Dox (5 µg/ml) at the time of infection. For noncumulative growth curve analysis, the culture medium was removed at 12 h, 24 h, 48 h, and 72 h p.i. and was replaced by fresh medium. Virus titers were determined for each time point by infectious center assays on SK6 cells. The graph shows means from three independent experiments.

Determination of N- and C-terminal borders of CSFV core protein. A hallmark of SPP activity is cleavage at an intramembrane position. Therefore, the C terminus of CSFV core protein should arise from the membrane-spanning signal sequence. The SDS-PAGE comigration studies of C-terminally truncated core proteins (Fig. 1) suggested a C terminus near Trp254, a position that would be in accordance with the proposed C termini of HCV core protein, Phe177 or Leu179. To precisely define the SPP cleavage site in the pestivirus polyprotein, the borders of mature core protein were determined. To this end a recombinant CSFV that carried a FLAG tag at the N terminus of the core protein was constructed. Viable virus (CSFVv585) was rescued from transfected SK6 cells with titers of about 5 x 106 focus-forming units (FFU)/ml. The presence of the FLAG tag in the rescued virus was verified by immunoblot analysis of pelleted virus using antibodies against core protein or the FLAG tag (Fig. 7A). The apparent molecular mass was increased due to the presence of the FLAG epitope (Fig. 7A, lane 2), which was also recognized by the anti-FLAG MAb M2 (Fig. 7A, lane 4). Core protein from a total of 1011 FFU of CSFVv585 was produced in suspension cultures using the porcine lymphoma cell line 38A1D (14). Virus was harvested 72 h p.i. by PEG precipitation and further concentrated by ultracentrifugation. The virus-containing pellet was solubilized in phosphate-buffered saline containing 1% Triton X-100 and subjected to immunoaffinity chromatography with anti-FLAG MAb M2-agarose (Fig. 7B, lane 1). After elution with 100 mM glycine at pH 3.5, a total of 14 µg of FLAG-core protein was recovered (Fig. 7B, lane 3). The purity of the protein was assayed by SDS-PAGE and Coomassie brilliant blue staining (Fig. 7B, lane 3). MALDI-TOF MS of the pooled elution fractions identified a protein of 10,895.7 Da (M + H+) as the predominant constituent. N-terminal sequencing of the purified core revealed the amino acid sequence NH2-Ser-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-COOH. The N-terminal serine residue preceding the FLAG sequence corresponds to the previously determined N terminus (18). C-terminal sequencing revealed the amino acids NH2-Ala-Trp-Ala-COOH. This tripeptide is unique within the CSFV polyprotein and locates within the hydrophobic membrane-spanning domain of the signal peptide (Fig. 8) The C terminus of CSFV core protein can therefore be assigned to Ala255.


Figure 7
View larger version (24K):
[in this window]
[in a new window]
  		FIG. 7. Purification of core protein. (A) Detection of FLAG-tagged core protein in CSFVv585. CSFVv585 was rescued after electroporation of an infectious cDNA clone (p585) that encodes a FLAG tag fused N-terminally to the core protein. SK6 cells were infected with wt CSFV or CSFVv585, each at a multiplicity of 0.5. At 48 h p.i., the culture medium was concentrated by ultracentrifugation, and the virus pellet was subjected to SDS-PAGE and immunoblot analysis using an anti-D1* polyclonal antibody (lanes 1 and 2) or monoclonal antibody M2 (anti-Flag) (lanes 3 and 4). The presence of the FLAG epitope in the structural core protein is evident from the increased molecular mass (lanes 2 and 4) and the reactivity with MAb M2 (lane 4). (B) Purification of core protein by immunoaffinity chromatography. A total of 1011 FFU of CSFVv585 was harvested from infected 38A1D cells grown in suspension culture and was concentrated 2,000-fold by precipitation with 7% PEG 6000 followed by ultracentrifugation. The virus was lysed with 1% Triton X-100 and subjected to immunoaffinity chromatography with anti-FLAG (MAb M2) agarose. Crude lysate (lane 1), unbound runoff (lane 2), and pooled elution fractions (lane 3) were analyzed by SDS-PAGE and stained with Coomassie brilliant blue. FLAG-core protein from the same preparation as that shown in the gel (arrow, lane 3) was subjected to N- and C-terminal sequencing and MALDI-TOF MS (not shown).


Figure 8
View larger version (10K):
[in this window]
[in a new window]
  		FIG. 8. C-terminal alignment of the amino acid sequences (single-letter code) of the C-terminal core-glycoprotein (Erns, E1, preM) junction from different members of the Flaviviridae. The arrow at the top shows the expanse of the signal peptide of CSFV and YFV. The SP cleavage site is indicated by white arrowheads; black arrowheads mark the processing sites of SPP in the polyproteins of CSFV and HCV. The gray arrowhead indicates the NS2B-3 processing site at the C terminus of YFV. For HCV three different C termini of core protein, Phe177, Leu179, and Leu182 (indicated by arrowheads 1, 2, and 3, respectively), have been proposed (4, 8). Interestingly, the position analogous to the SPP-generated C terminus of CSFV core protein, Ala255, would be Leu178 in the HCV sequence.


arrow
DISCUSSION
 
Three lines of evidence strongly suggest that SPP is responsible for the maturation of core protein. These are (i) the blocking of core protein processing by (Z-LL)2-ketone, (ii) the inhibition of the C-terminal cleavage by overexpression of D265A SPP, and (iii) the determination of an intramembrane cleavage site. The determination of the C terminus of core protein is the most important result of our study, because it describes the final processing product that is incorporated into CSFV particles. C-terminal sequencing was unambiguous and revealed a C terminus at alanine 255. It was also important to show that the N terminus of core protein remains unchanged after the release by Npro. According to these data, FLAG-core protein consists of 95 amino acids and has a calculated average molecular mass of 10,863.31 Da (22). This is very close to the molecular mass determined by MALDI-TOF MS [10,895.7 Da (M + H+)]. The deviation of 32.4 Da accounts for less than one amino acid and may indicate that the core protein is posttranslationally modified. It was recently reported that the N-terminal serine residue of insect cell-expressed HCV core protein is acetylated (8). Acetylation (42.03 Da) of the N-terminal serine of CSFV core protein would increase the calculated mass to 10,905.33 Da. The deviation from the observed mass (10,895.7 Da) accounts for less than the mass of a carbon atom.

The intramembrane cleavage occurs C-terminally of the sequence RKKLEKALLAWA255, which is invariably conserved among 75 sequences from all pestivirus species. Amino acids located C-terminally of the SPP cleavage site display considerable variability. Very likely the core proteins of other pestivirus species are processed at the same position, yielding core proteins of 87 (CSFV) to 90 (bovine viral diarrhea virus) amino acids. The core protein is apparently flexible in size, and the addition of a FLAG tag does not impede its function or CSFV viability. Comparison of the amino acids surrounding the proposed SPP cleavage sites in the polyproteins of HCV (Phe177/Leu178, Leu179/Ala180, or Leu182/Ser183) and CSFV (Ala255/Val256) revealed only hydrophobicity as a common feature. A large aromatic residue (Trp or Phe), which occupies the P2 position of the SPP cleavage site in CSFV core protein, is also adjacent to the suggested cleavage sites of the HCV core protein (Fig. 8). As one requirement for SPP cleavage, the existence of helix-bending or -breaking residues was claimed (7). McLauchlan et al. described the important role of residues Ser183 and Cys184 for SPP cleavage of HCV core protein. Okamoto et al. could not confirm these results but found instead that the change of Ile-Phe177 to Ala-Leu177 aborted HCV core protein processing (9). Preliminary mutational analysis of the CSFV SPP cleavage site revealed that Trp254 is essential for CSFV core protein processing. Therefore, it is likely that Trp254 of CSFV is functionally analogous to Phe177 of HCV.

A signal peptide peptidase that degrades the signal peptide was identified in 2002 by affinity purification using the diazirine-containing derivative of (Z-LL)2-ketone, TBL4K (20). Its inhibitory effect on the processing of HCV core protein supported the claim that SPP is responsible for the cleavage. Interestingly, the peptidomimetics MG132 and proteasome inhibitor II also efficiently blocked the cleavage of CSFV core protein. Both are characterized as potent inhibitors of proteasomal proteolytic activities, but it is unlikely that core processing occurs at the proteasome level (10, 13). Both inhibitors are structurally related to (Z-LL)2-ketone and contain one additional amino acid. MG132 (Z-LLL-aldehyde) and proteasome inhibitor II (Z-LLF-aldehyde) apparently bind to SPP and inhibit its function.

The participation of SPP in C-terminal processing of CSFV core was further confirmed by the use of the dominant-negative D265A SPP mutant. Overexpression of this enzymatically inactive mutant (20) but not of wild-type SPP in tetracycline-inducible SK6 cell lines led to an accumulation of unprocessed core protein after infection with CSFV. Apparently, only high concentrations of D265A SPP were able to inhibit CSFV core protein processing after induction, while low-level basal expression in noninduced SK6 cells had no apparent effect (Fig. 6). Because the dominant-negative effect of SPP relies on the competition between active and inactive enzymes for the substrate, the relatively low expression levels may account for the missing inhibitory effect of D265A SPP on HCV core protein cleavage in 293T cells (9). McLauchlan et al. have put forward the idea that blocking SPP might "have the potential to affect the HCV life cycle and reduce any impact of HCV on associated disease" (7). This idea could be confirmed for CSFV, because inhibition of SPP by different approaches reduced the release of infectious virus as much as 100-fold. Nevertheless, we were surprised that even high concentrations of (Z-LL)2-ketone or expression of D265A SPP did not result in a more pronounced effect. The strongest titer reductions by (Z-LL)2-ketone were observed early after infection. The inhibition of SPP by (Z-LL)2-ketone is probably incomplete, which would allow accumulation of small amounts of correctly processed core protein over time. Also, the limited solubility of (Z-LL)2-ketone in water may be critical for bioavailability. The titer reduction observed with the dominant-negative SPP D265A mutant displays different kinetics. Here the virus release remains steady at 20- to 30-fold-reduced levels over 72 h. Due to induced expression, an accumulation of the inactive enzyme can be postulated. Thus, the dominant-negative effect is increasingly stronger within the observation window, which counteracts the accumulation of processed (functional) core protein. In accordance with this assumption, induction of D265A SPP 12 h before CSFV infection showed an even stronger inhibitory effect (data not shown). Interestingly, addition of (Z-LL)2-ketone to CSFV-infected D265A SPP-expressing SK6T cells did not reduce virus titers below the level observed with D265A SPP (not shown).

Intramembrane cleavage is an unusual processing mechanism that has thus far not been observed in viral (poly)protein biosynthesis other than in C-terminal core protein processing of pestiviruses and hepaciviruses. The usage of SPP in polyprotein cleavage therefore defines yet another common feature that underscores the close relationship between these two groups of viruses. An interesting question to solve in further studies is the relevance of the peculiar structure of the C terminus of CSFV core protein, with six hydrophobic amino acids (ALLAWA), for its function in virus assembly.


arrow
ACKNOWLEDGMENTS
 
We thank John McLauchlan for fruitful discussions.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Institut für Virologie, FB Veterinärmedizin, Justus Liebig Universität Giessen, Frankfurter Str. 107, D-35392 Giessen, Germany. Phone: 49-641-9938356. Fax: 49-641-9938359. E-mail: Till.H.Ruemenapf{at}vetmed.uni-giessen.de. Back


arrow
REFERENCES
 
    1
  1. Amberg, S. M., A. Nestorowicz, D. W. McCourt, and C. M. Rice. 1994. NS2B-3 proteinase-mediated processing in the yellow fever virus structural region: in vitro and in vivo studies. J. Virol. 68:3794-3802.[Abstract/Free Full Text]
    2. 2
  2. Braud, V. M., D. S. Allan, C. A. O'Callaghan, K. Soderstrom, A. D'Andrea, G. S. Ogg, S. Lazetic, N. T. Young, J. I. Bell, J. H. Phillips, L. Lanier, and A. J. McMichael. 1998. HLA-E binds to natural killer cell receptors CD94/NKG2A, B and C. Nature 391:795-799.[CrossRef][Medline]
    3. 3
  3. Gallei, A., T. Rümenapf, H. J. Thiel, and P. Becher. 2005. Characterization of helper virus-independent cytopathogenic classical swine fever virus generated by an in vivo RNA recombination system. J. Virol. 79:2440-2448.[Abstract/Free Full Text]
    4. 4
  4. Hussy, P., H. Langen, J. Mous, and H. Jacobsen. 1996. Hepatitis C virus core protein: carboxy-terminal boundaries of two processed species suggest cleavage by a signal peptide peptidase. Virology 224:93-104.[CrossRef][Medline]
    5. 5
  5. Krawitz, P., C. Haffner, R. Fluhrer, H. Steiner, B. Schmid, and C. Haass. 2005. Differential localization and identification of a critical aspartate suggest non-redundant proteolytic functions of the presenilin in homologues SPPL2b and SPPL3. J. Biol. Chem. 280:39515-39523.[Abstract/Free Full Text]
    6. 6
  6. Maurer, K., T. Krey, V. Moennig, H.-J. Thiel, and T. Rümenapf. 2004. CD46 is a cellular receptor for bovine viral diarrhea virus. J. Virol. 78:1792-1799.[Abstract/Free Full Text]
    7. 7
  7. McLauchlan, J., M. K. Lemberg, G. Hope, and B. Martoglio. 2002. Intramembrane proteolysis promotes trafficking of hepatitis C virus core protein to lipid droplets. EMBO J. 21:3980-3988.[CrossRef][Medline]
    8. 8
  8. Ogino, T., H. Fukuda, S. Imajoh-Ohmi, M. Kohara, and A. Nomoto. 2004. Membrane binding properties and terminal residues of the mature hepatitis C virus capsid protein in insect cells. J. Virol. 78:11766-11777.[Abstract/Free Full Text]
    9. 9
  9. Okamoto, K., K. Moriishi, T. Miyamura, and Y. Matsuura. 2004. Intramembrane proteolysis and endoplasmic reticulum retention of hepatitis C virus core protein. J. Virol. 78:6370-6380.[Abstract/Free Full Text]
    10. 10
  10. Orlowski, M., C. Cardozo, and C. Michaud. 1993. Evidence for the presence of five distinct proteolytic components in the pituitary multicatalytic proteinase complex. Properties of two components cleaving bonds on the carboxyl side of branched chain and small neutral amino acids. Biochemistry 32:1563-1572.[CrossRef][Medline]
    11. 11
  11. Rice, C. M. 1996. Flaviviridae: the viruses and their replication, p. 931-959. In B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed., vol. 1. Lippincott-Raven, Philadelphia, Pa.
    12. 12
  12. Rinck, G., C. Birghan, T. Harada, G. Meyers, H.-J. Thiel, and N. Tautz. 2001. A cellular J-domain protein modulates polyprotein processing and cytopathogenicity of a pestivirus. J. Virol. 75:9470-9482.[Abstract/Free Full Text]
    13. 13
  13. Rock, K., C. Gramm, L. Rothstein, K. Clark, R. Stein, L. Dick, D. Hwang, and A. Goldberg. 1994. Inhibitors of the proteasome block the degradation of most cell proteins and the generation of peptides presented on MHC class I molecules. Cell 78:761-771.[CrossRef][Medline]
    14. 14
  14. Rümenapf, T., G. Meyers, R. Stark, and H. J. Thiel. 1989. Hog cholera virus—characterization of specific antiserum and identification of cDNA clones. Virology 171:18-27.[CrossRef][Medline]
    15. 15
  15. Rümenapf, T., R. Stark, M. Heimann, and H.-J. Thiel. 1998. N-terminal protease of pestiviruses: identification of putative catalytic residues by site-directed mutagenesis. J. Virol. 72:2544-2547.[Abstract/Free Full Text]
    16. 16
  16. Rümenapf, T., G. Unger, J. H. Strauss, and H.-J. Thiel. 1993. Processing of the envelope glycoproteins of pestiviruses. J. Virol. 67:3288-3294.[Abstract/Free Full Text]
    17. 17
  17. Schägger, H., and G. V. Jagow. 1987. Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal. Biochem. 166:368-379.[CrossRef][Medline]
    18. 18
  18. Stark, R., G. Meyers, T. Rümenapf, and H.-J. Thiel. 1993. Processing of pestivirus polyprotein: cleavage site between autoprotease and nucleocapsid protein of classical swine fever virus. J. Virol. 67:7088-7095.[Abstract/Free Full Text]
    19. 19
  19. Thiel, H. J., R. Stark, E. Weiland, T. Rümenapf, and G. Meyers. 1991. Hog cholera virus: molecular composition of virions from a pestivirus. J. Virol. 65:4705-4712.[Abstract/Free Full Text]
    20. 20
  20. Weihofen, A., K. Binns, M. K. Lemberg, K. Ashman, and B. Martoglio. 2002. Identification of signal peptide peptidase, a presenilin-type aspartic protease. Science 296:2215-2218.[Abstract/Free Full Text]
    21. 21
  21. Weiland, E., R. Stark, B. Haas, T. Rümenapf, G. Meyers, and H.-J. Thiel. 1990. Pestivirus glycoprotein which induces neutralizing antibodies forms part of a disulfide-linked heterodimer. J. Virol. 64:3563-3569.[Abstract/Free Full Text]
    22. 22
  22. Wilkins, M. R., I. Lindskog, E. Gasteiger, A. Bairoch, J.-C. Sanchez, D. F. Hochstrasser, and R. D. Appel. 1997. Detailed peptide characterization using PEPTIDEMASS—a World-Wide-Web-accessible tool. Electrophoresis 18:403-408.[CrossRef][Medline]

Journal of Virology, February 2006, p. 1915-1921, Vol. 80, No. 4
0022-538X/06/$08.00+0     doi:10.1128/JVI.80.4.1915-1921.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Wegelt, A., Reimann, I., Zemke, J., Beer, M. (2009). New insights into processing of bovine viral diarrhea virus glycoproteins Erns and E1. J. Gen. Virol. 90: 2462-2467 [Abstract] [Full Text]  
  • Piccone, M. E., Feng, Y., Chang, A. C. Y., Mosseri, R., Lu, Q., Kutish, G. F., Lu, Z., Burrage, T. G., Gooch, C., Rock, D. L., Cohen, S. N. (2009). Identification of Cellular Genes Affecting the Infectivity of Foot-and-Mouth Disease Virus. J. Virol. 83: 6681-6688 [Abstract] [Full Text]  
  • Robakis, T., Bak, B., Lin, S.-h., Bernard, D. J., Scheiffele, P. (2008). An Internal Signal Sequence Directs Intramembrane Proteolysis of a Cellular Immunoglobulin Domain Protein. J. Biol. Chem. 283: 36369-36376 [Abstract] [Full Text]  
  • Targett-Adams, P., Hope, G., Boulant, S., McLauchlan, J. (2008). Maturation of Hepatitis C Virus Core Protein by Signal Peptide Peptidase Is Required for Virus Production. J. Biol. Chem. 283: 16850-16859 [Abstract] [Full Text]  
  • Ivanyi-Nagy, R., Lavergne, J.-P., Gabus, C., Ficheux, D., Darlix, J.-L. (2008). RNA chaperoning and intrinsic disorder in the core proteins of Flaviviridae. Nucleic Acids Res 36: 712-725 [Abstract] [Full Text]  
  • Murray, C. L., Marcotrigiano, J., Rice, C. M. (2008). Bovine Viral Diarrhea Virus Core Is an Intrinsically Disordered Protein That Binds RNA. J. Virol. 82: 1294-1304 [Abstract] [Full Text]  
  • Tews, B. A., Meyers, G. (2007). The Pestivirus Glycoprotein Erns Is Anchored in Plane in the Membrane via an Amphipathic Helix. J. Biol. Chem. 282: 32730-32741 [Abstract] [Full Text]  
  • Murray, C. L., Jones, C. T., Tassello, J., Rice, C. M. (2007). Alanine Scanning of the Hepatitis C Virus Core Protein Reveals Numerous Residues Essential for Production of Infectious Virus. J. Virol. 81: 10220-10231 [Abstract] [Full Text]  
  • Targett-Adams, P., Schaller, T., Hope, G., Lanford, R. E., Lemon, S. M., Martin, A., McLauchlan, J. (2006). Signal Peptide Peptidase Cleavage of GB Virus B Core Protein Is Required for Productive Infection in Vivo. J. Biol. Chem. 281: 29221-29227 [Abstract] [Full Text]  
  • Vauloup-Fellous, C., Pene, V., Garaud-Aunis, J., Harper, F., Bardin, S., Suire, Y., Pichard, E., Schmitt, A., Sogni, P., Pierron, G., Briand, P., Rosenberg, A. R. (2006). Signal Peptide Peptidase-catalyzed Cleavage of Hepatitis C Virus Core Protein Is Dispensable for Virus Budding but Destabilizes the Viral Capsid. J. Biol. Chem. 281: 27679-27692 [Abstract] [Full Text]  
  • Krey, T., Himmelreich, A., Heimann, M., Menge, C., Thiel, H.-J., Maurer, K., Rumenapf, T. (2006). Function of Bovine CD46 as a Cellular Receptor for Bovine Viral Diarrhea Virus Is Determined by Complement Control Protein 1.. J. Virol. 80: 3912-3922 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Heimann, M.
Right arrow Articles by Rümenapf, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Heimann, M.
Right arrow Articles by Rümenapf, T.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»