Previous Article | Next Article ![]()
Journal of Virology, February 2006, p. 1231-1241, Vol. 80, No. 3
0022-538X/06/$08.00+0 doi:10.1128/JVI.80.3.1231-1241.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Department of Plant Pathology, University of Kentucky, Plant Science Building, Lexington, Kentucky 40546
Received 18 July 2005/ Accepted 5 November 2005
|
|
|---|
80% of all genes of yeast, led to the identification of 11 host genes affecting RNA recombination in Tomato bushy stunt virus (TBSV), a small model plant virus (E. Serviene, N. Shapka, C. P. Cheng, T. Panavas, B. Phuangrat, J. Baker, and P. D. Nagy, Proc. Natl. Acad. Sci. USA 102:10545-10550, 2005). To further test the role of host genes in viral RNA recombination, in this paper, we extended the screening to 800 essential yeast genes present in the yeast Tet-promoters Hughes Collection (yTHC). In total, we identified 16 new host genes that either increased or decreased the ratio of TBSV recombinants to the nonrecombined TBSV RNA. The identified essential yeast genes are involved in RNA transcription/metabolism, in protein metabolism/transport, or unknown cellular processes. Detailed analysis of the effect of the identified yeast genes revealed that they might affect RNA recombination by altering (i) the ratio of the two viral replication proteins, (ii) the stability of the viral RNA, and/or (iii) the replicability of the recombinant RNAs. Overall, this and previous works firmly establish that a set of essential and nonessential host genes could affect TBSV recombination and evolution. |
|
|---|
Progress in our understanding of viral RNA recombination has been slowed down by the difficulty of detection of new recRNAs, the adverse selection pressure on some recRNAs, and the poor predictability of recombination events. Development of powerful model RNA recombination systems, however, has revealed many unique features of viral RNA recombination. For example, sequencing of numerous recRNAs in Brome mosaic virus (BMV) (3, 33, 36, 53), Turnip crinkle virus (TCV) (6, 7, 37, 38, 40), and tombusviruses (61, 62) established that recombination does not occur randomly within the viral RNA genome but rather, there are recombination "hot spots". These include AU-rich sequences (31, 34, 58), inter- or intramolecular secondary structures (19, 35, 62), and cis-acting RNA elements with high affinity toward the viral replicase (8, 10, 40). Mutagenesis of the replicase proteins has led to altered recombination frequencies or altered the sites of recombination (15, 30, 47), suggesting that many recombination events are due to template switching (replicase jumping) by the viral replicase (22, 27, 39). In vitro template-switching experiments confirmed the abilities of purified viral RNA-dependent RNA polymerases or partially purified viral replicases to switch templates (8, 25, 52). Nonreplicative RNA recombination events have also been demonstrated for a small group of RNA viruses (11, 18).
In spite of our growing understanding of RNA recombination, the role of the host in the recombination process is not yet understood. However, recombination is known to be more frequent in some host species than in other host species (12, 64), indicating that host genes likely affect the RNA recombination process, similar to the significant influence of host genes on viral RNA replication (2, 26, 45). Identification of all the host genes affecting viral RNA recombination would be a major advance toward understanding the mechanism of RNA recombination and the selection pressure favoring or selecting against the new emerging recombinant viruses.
Tombusviruses, such as Tomato bushy stunt virus (TBSV) and Cucumber necrosis virus (CNV), are simple, single-component RNA viruses that code for five proteins. The two N-terminally overlapping proteins, termed p33 and p92, are essential for replication. The p92 is the viral RNA-dependent RNA polymerases, whereas p33 replication cofactor, an RNA-binding protein (46, 49, 50), is involved in template selection and recruitment of viral RNA into replication (29, 43, 49). These proteins interact with each other and the viral RNA in cells (43, 51), which leads to replication complexes formed on peroxisomal membranes (41, 43). Recent development of yeast as a model host for tombusvirus replication facilitated the identification of 96 host genes whose separate deletions affected the replication of a tombusvirus replicon RNA in yeast (45). These observations support the significant role of the host in virus replication (45).
One of the most intriguing features of tombusviruses is their ability to frequently participate in RNA recombination and generate defective interfering (DI) RNAs. DI RNAs are noncoding deletion derivatives of genomic RNA (gRNA) that have been used as model templates for replication and recombination studies (20, 63). In addition to the in vitro (8, 9) and in planta (47, 58, 60-62) recombination assays, a novel yeast-based RNA recombination assay has been developed recently (44). The tombusvirus recRNAs obtained in yeast were dimer-sized RNAs which were also present in plant cells, suggesting that yeast could be a suitable host for RNA recombination studies (44). Indeed, based on the available yeast single-gene knockout (YKO) library containing
4,800 strains (
80% of all yeast genes in yeast), 11 nonessential host genes were identified which either increased or suppressed the accumulation of tombusvirus recRNAs (57). In this paper, we extended the screening for genes affecting tombusvirus recombination to the essential yeast genes. Among the 800 essential host genes present in the yeast Tet-promoters Hughes Collection (yTHC) (out of
1,100 predicted essential yeast genes) (28), we found that 16 genes affected the accumulation of tombusvirus recRNAs. These essential yeast genes, which either increased or decreased the accumulation of tombusvirus recRNAs, are involved in RNA transcription/metabolism, protein metabolism/transport, or unknown cellular processes. Detailed analysis of the effect of a selected group of yeast genes revealed that they could affect (i) the amount of viral replication proteins, (ii) the stability of the viral RNA, and/or (iii) the replicability of the new recRNAs. Overall, this and previous genetic screening of yeast led to the identification of 27 host genes (out of
5,600 genes that represent
95% of all predicted yeast genes) that affected the accumulation of TBSV recRNAs.
|
|
|---|
1 leu2
0 met15
0 ura3
0) by a one-step integration of the tTA transactivator, under the control of the cytomegalovirus (CMV) promoter, at the URA3 locus. The kanR-tetO7-TATA cassette on a plasmid was then integrated into the genome, replacing the endogenous promoter for each gene (28). The expression plasmid pGAD-His92 (containing CNV p92 gene and LEU2 marker) has been previously described (48). For construction of the pYC/DI-AU-FP plasmid, pDI-73-AU-FP (58) was digested with XbaI and BstXI, followed by gel purification of the 330-bp fragment (containing AU-FP sequence and portion of DI-72 RII) and ligation with two DI-72-derived fragments (the 170-bp HindIII-XbaI fragment, containing RI, and the 450-bp BstXI-SacI, including portion of RII, the entire RIII/IV, and the ribozyme sequences [44]). After ligation, the DI-AU-FP region was PCR-amplified with primers 542 (GCCCGAAGCTTGGAAATTCTCCAGGATTTC) and 1069 (CCGGTCGAGCTCTACCAGGTAATATACCACAACGTGTGT). The obtained PCR product was treated with HindIII and SacI and ligated into pYC/DI-72 (44, 48).
For construction of pGBK-His33/DI-AU-FP, we PCR amplified the GAL1-DI-AU-FP region from plasmid pYC/DI-AU-FP using primers 1546 (CCGCAATTCACGGATTAGAAGCCGCCGAGCGGGT) and 1069 (CCGGTCGAGCTCTACCAGGTAATATACCACAACGTGTGT). The PCR product was treated with EcoRI and SacI, followed by ligation into pHisGBK-His33-DI-72 (T. Panavas and P. D. Nagy, unpublished data) treated with EcoRI and SacI.
For construction of pGBK-His33/rec
170RII/
70RII, we PCR amplified three separate regions of pYC/DI-AU-FP: first, GAL1 with primers 1546 and 1667 (GGACAAGCTTAATATTCCCTATAGTG), followed by treatment with EcoRI and HindIII; second, the
170RII/RIII/RIV part of DI-72 with primers 1668 (GGACAAGCTTGGAGAGTCTGCATATCACACCTG) and 1638, followed by treatment with HindIII and XmaI; and third, the
70RII/RIII/RIV part of DI-72 with primers 1640 (GGACCCGGGAAAGCGGTTTGTGAGAAG) and 1069, followed by treatment with XmaI and SacI. Then the GAL1 and
170RII/RIII/RIV PCR products were ligated together, followed by a new round of PCR amplification with primers 1546 and 1638 (GGACGGTACCCCGGGCTGCATTTCTGCAATG). The obtained 780-bp PCR product was treated with EcoRI and XmaI, followed by ligation with
70RII/RIII/RIV and cloning into pHisGBKHis33-DI-72 (T. Panavas and P. D. Nagy, unpublished data) treated with EcoRI and SacI.
Yeast transformation and cultivation. The parental strain (BY4741) and the strains in the yTHC collection were cotransformed with different combinations of plasmids using the LiAc/ssDNA/PEG method (17a), and transformants were selected by complementation of auxotrophic markers.
For analysis of DI-AU-FP RNA accumulation and generation of new recRNAs, each transformed yTHC strain was inoculated into SC-LH medium containing 2% galactose and supplemented with Geneticin G418 (200 mg/liter) and cultured for 24 to 48 h at 29°C until an optical density at 600 nm of
0.8 to 1.0 was reached. For the maximum level of essential gene expression, yeast was grown in the absence of doxycycline, whereas to reduce the expression levels of the essential genes, yeast was grown in the same medium in the presence of 10 mg/liter doxycycline (28). Our preliminary experiments showed that the use of 10 mg/liter doxycycline was as good as 25 or 50 mg/liter doxycycline and better than 3.3 mg/liter to affect TBSV recombination (not shown). Therefore, we used 10 mg/liter doxycycline throughout the experiments to turn the particular gene off.
In the RNA stability experiments with DI-AU-FP RNA (the replicon RNA) or rec
170RII/
70RII RNA (a representative recRNA), yeast strains (lacking plasmid pGAD-His92) were grown in SC-H medium containing 2% galactose for 24 h at 29°C. Cells were harvested by centrifugation at 1,100 x g for 5 min, followed by resuspension of cells in SC-H medium containing 2% glucose and by culturing at 29°C. Samples for total RNA extraction were collected every 30 min up to 4 h.
RNA analysis. Total RNA isolation and Northern blot analysis were performed as described previously (44, 48). Briefly, for extraction of total RNA, yeast cells were broken by shaking for 1 to 2 min at room temperature with equal volumes of RNA extraction buffer (50 mM NaOAc [pH 5.2], 10 mM EDTA, 1% sodium dodecyl sulfate [SDS]) and water-saturated phenol and then incubated for 4 min at 65°C, followed by ethanol precipitation. The obtained RNA samples were separated on a 1.5% agarose gel and transferred to a Hybond-XL membrane (Amersham) before hybridization with a DI-72 RNA-specific probe. For detection of plus-strand replicon RNA and the recRNAs, we prepared 32P-labeled RIII/IV() probe with T7 transcription from PCR product obtained with primers 1165 (AGCGAGTAAGACAGACTCTTCA) and 22 (GTAATACGACTCACTATAGGGCTGCATTTCTGCAATGTTCC) on DI-72 templates.
Protein analysis. For protein analysis, yeast strains were cultivated as described above for RNA analysis. A total of 50 ml yeast culture was harvested, the pelleted cells were resuspended in 200 µl cold TG buffer (50 mM Tris-HCl [pH 7.5], 10% glycerol, 15 mM MgCl2, 10 mM KCl), and 250 µl of glass beads was added to each sample. The cells were broken with a Genogrinder for 2 min at 1,500 rpm. Each sample was further mixed with 600 µl prechilled TG buffer, and unbroken cells were removed by centrifugation at 100 x g for 5 min. Enriched-membrane fractions were collected by centrifugation at 21,000 x g for 10 min, resuspended in SDS-polyacrylamide gel electrophoresis loading buffer, and incubated at 85°C for 15 min. The supernatant was used for SDS-polyacrylamide gel electrophoresis and Western blot analysis as described previously (44, 48). The primary antibody was anti-His6 (Invitrogen), and the secondary antibody was alkaline phosphatase-conjugated anti-mouse immunoglobulin G antibody (Sigma).
5' Rapid amplification of complementary ends (RACE) and RT-PCR analysis of the junction sites in the recRNAs. We used both total yeast RNA extracts and gel-isolated recRNAs for reverse transcription (RT)-PCRs to specifically amplify regions covering the junction sites (57). First, the RT reaction included primer 14 (GTAATACGACTCACTATAGGGTTCTCTGCTTTTACGAAG) for cDNA synthesis, followed by PCR with primers 168 (TCGTCTTATTGGACGAATTCCTGTTTACGAAAG) and 270 (TTGGAAATTCTCCTTCAGTCTGAGTTTGTGGA). The PCR products were cloned into pGEM-T Easy vector (Promega) and sequenced using M13 reverse primer.
The 5' and 3' sequences of recRNAs were determined using 5' RACE and 3' RACE (57). The resulting products were cloned and sequenced (8).
|
|
|---|
![]() View larger version (25K): [in a new window] |
FIG. 1. Replication and recombination of TBSV replicon RNA in yeast from the yTHC collection. (A) Schematic representation of the DI-AU-FP replicon RNA with four noncontiguous regions (RI to RIV) derived from TBSV genomic RNA and the artificial AU-FP region to promote recombination (58). (B and C) The scheme of launching DI-AU-FP replication and regulation of host gene expression from the Tet-titratable promoter. P33 and p92 replication proteins are expressed constitutively from the ADH1 promoter, whereas DI-AU-FP is expressed from the regulatable GAL1 promoter. Replication (and probably recombination) of DI-AU-FP takes place in the cytoplasm (on peroxisomal membrane surfaces). The expression of a particular host gene occurs in the absence of doxycycline, and it is switched off in the presence of doxycycline. (D) (Top). Ethidium bromide-stained agarose gel of total RNA extracts obtained from the parental yeast strains (grown without doxycycline [DOX] or with doxycycline [+DOX]) showing the accumulation of DI-AU-FP replicon RNA and the recombinant RNA. The yeast cells coexpressed DI-AU-FP RNA, and p33/p92 replication proteins. (Bottom). Northern blot analysis of total RNA extracts with a 32P-labeled RNA probe specific for RIII/IV of DI-AU-FP. The samples are the same as in the top panel. The unmarked faint bands represent degradation products (5' truncated RNAs that migrate fast) and additional recombinants (slow migrating).
|
20,000 copies per yeast cells). In addition, new recRNAs (
15% of the level of the original replicon RNA) (Fig. 1D) also accumulated after 24 h of culturing. The addition of 10 mg/liter doxycycline to the growth medium did not alter the accumulation of the original replicon RNA, the formation of recRNAs, and the ratio between recRNAs and the replicon RNA (Fig. 1D) in the case of the parental yeast strain (which carries all yeast genes and with expression of genes from their natural promoters), suggesting that the presence of doxycycline did not affect the replication or recombination of the DI-AU-FP replicon RNA in the parental yeast strain. To characterize the putative recRNAs that accumulated in the parental yeast strain replicating DI-AU-FP, we performed 5' RACE, 3' RACE, and RT-PCR to cover the junction sites in the recRNAs (Fig. 2). Sequence analysis of the recRNAs showed that they were derived by recombination possibly between two 5' truncated replicon RNAs, as shown in Fig. 2 (C.-P. Cheng, E. Serviene, and P. D. Nagy, submitted for publication). Although the sequences present at the 5' end and at the junction sites in the recRNAs were variable, we placed the recRNAs into two groups, long and short (Fig. 2), based on their sizes. The short recRNAs with larger 5' deletions were more common (visible on ethidium bromide-stained agarose gels or Northern blots) (Fig. 1D). Similar to other recRNAs characterized in the in vitro replicase assays (8), in plants or plant protoplasts (61-63), and in yeast (44, 57), both the short and long recRNAs contained one to eight extra, nonviral sequences at the junction sites (Fig. 2). The presence of extra nucleotides is likely due to replicase errors during the template-switching events (8). Overall, Fig. 1 and 2 established that DI-AU-FP replicon RNA could efficiently generate recRNAs at detectable levels in the parental yeast strain, making it a suitable construct for high-throughput recombination studies (see below).
![]() View larger version (54K): [in a new window] |
FIG. 2. 5' Sequences and junction sequences in recRNAs generated in the parental yeast coexpressing DI-AU-FP RNA and p33/p92. (A and B) (Top) Schematic presentation of the two types of recombinants containing partially duplicated sequences from the 3' half of DI-AU-FP replicon RNA joined in a head-to-tail fashion. The actual 5' ends (left panel) and junction sequences are shown for a number of recRNAs. Note that most of the 3' sequences (3' part of RII, RIII, and RIV) and 5' deletions (RI and 5' part of RII) are not shown. indicates the number of deleted nucleotides, whereas virus-templated and nonviral sequences are shown in uppercase and lowercase letters, respectively. The 3' end in RIV (at both the internal and 3'-terminal locations) contained the authentic viral sequence.
|
![]() View larger version (89K): [in a new window] |
FIG. 3. Sixteen yTHC yeast strains show an altered recRNA/replicon ratio compared to the parental strain. (A) Northern blot analysis of total RNA extracts from the shown yeast strains (four independent samples are shown for each strain [two samples were grown without and two with doxycycline {DOX}] to illustrate the reproducibility of recombinant accumulation) was performed with a radiolabeled RNA complementary to RIII/IV. Arrow points at the DI-AU-FP replicon, whereas the novel recRNAs (short and long [Fig. 2]) are depicted with arrowheads. Asterisks mark a 5'-truncated replicon RNA that might serve as a recombination substrate (C.-P. Cheng, E. Serviene, and P. D. Nagy, unpublished). rRNA is shown as a loading control. Host genes in open and closed circles showed increased or reduced accumulation of recRNAs compared to the replicon RNA in the presence of doxycycline. (B) The ratio of recRNA versus replicon RNA is shown in selected yTHC strains graphically. (C) The accumulation level of replicon RNA is shown in selected yTHC strains graphically. The accumulation level of DI-AU-FP in the parental strain was scored as 100%.
|
The observation that seven of the identified host genes affected tombusvirus recombination in a doxycycline-independent manner might be explained by the use of a Tet-titratable promoter for their expression. We propose that these host genes might be expressed at lower levels from the Tet-titratable promoter than from their natural promoters. Thus, these proteins might be present at a reduced level even in the absence of doxycycline compared to the parental strain.
The 16 essential host genes identified in the screen mentioned above code for proteins with different molecular functions in various cellular processes (Yeast Genome Database, SGD [http://www.yeastgenome.org]). These include RNA binding/processing (RRP9, NOP10), RNA helicase/unwinding (SEN1), RNase (RPM2), or RNA polymerase/RNA transcription (RPB11, RGR1, ARP9) (Table 1). Others are involved in protein modification (MPS1), protein catabolism (RPT4), or protein transport (COP1). FAS2 codes for a protein reductase/synthase, which affects fatty acid biosynthesis, whereas RIB7-coded protein has deaminase activity. POL1 has DNA polymerase function, whereas ORC6 is involved in DNA replication. We also identified two genes with currently unknown functions (YDR327W and YKL033W) (Table 1). Altogether, the identified host factors could have either direct or indirect effects on tombusvirus recombination (see below).
|
View this table: [in a new window] |
TABLE 1. Names and functions of the identified host genes
|
![]() View larger version (80K): [in a new window] |
FIG. 4. Northern blot analysis of DI-AU-FP RNA transcripts from total RNA extracts obtained from selected yTHC yeast strains coexpressing p33 but lacking p92. Note the lack of recombinant RNAs and the presence of the original (containing plasmid-borne 5' and 3' sequences) and ribozyme-cleaved DI-AU-FP RNA transcripts in all samples in the absence of TBSV replication. The ribozyme-cleaved DI-AU-FP RNA transcripts are more active in replication/recombination than the uncleaved transcripts (data not shown). DOX, doxycycline.
|
Comparison of the accumulation of DI-AU-FP transcripts generated from the expression plasmids in the selected yTHC strains revealed that the amount of transcripts decreased in nine strains, increased in five strains (MPS1, ARP9, SEN1, NOP10, and ORC6), and did not change in two strains (RRP9 and YKL033W) plus the parental strain in the presence of doxycycline. Altogether, we did not find a good overall correlation between altered DI-AU-FP transcript levels and the alteration in the recRNA/replicon ratio. For example, the POL1, RPB11, and RPM2 strains showed decreased levels in DI-AU-FP transcript accumulation, yet they increased (POL1), decreased (RPB11), and left unchanged (RPM2), respectively, the recRNA/replicon ratio in the absence or presence of doxycycline (Fig. 4). However, we did observe a reverse correlation between low DI-AU-FP transcript levels and high recRNA accumulation in strains POL1, COP1, and RGR1 in the presence of doxycycline (Fig. 5). Therefore, it is possible that the initial amount of replicon RNA could affect recRNA generation/accumulation in some strains.
![]() View larger version (31K): [in a new window] |
FIG. 5. Western analysis of p33 and p92 replicase proteins in total protein samples using anti-His tag antibody. See further details in the legend to Fig. 3.
|
Role of the identified host factors in postrecombinational accumulation of the recRNAs. The accumulation of viral recRNAs in the host cells depends on two major processes: the primary recombination events, followed by the secondary postrecombinational amplification/selection (27, 31). Host factors might be able to affect either of these processes. Unfortunately, it is difficult to measure the primary recombination events (i.e., the frequency of recombination) in our yeast recombination assay due to efficient postrecombinational amplification of the recRNAs. However, the role of postrecombinational selection can be tested because it likely depends on (i) the in vivo stability of the recRNA, (ii) the ability of the recRNA to replicate, and (iii) the ability of the recRNA to compete with the abundant replicon RNA in the cells. Altogether, each of the above secondary selection processes could influence the ratio of recRNA and replicon RNA in the identified host strains. Therefore, we performed tests to determine the effect of postrecombinational selection on the accumulation of recRNAs in nine yTHC strains and the parental strains.
Stability of a representative cloned recRNA (named rec
170RII/
70RII) (Fig. 6A) versus the replicon RNA (i.e., DI-AU-FP) was analyzed by determining the half-life of these RNAs in the absence of replication. To do so, either the recRNA or the replicon RNA was expressed (in the presence of p33 but in the absence of p92 to prevent replication) for 24 h by growing the selected yTHC strains and parental strains in an inducing medium (containing galactose), followed by repression of RNA transcription (via growing yeast in glucose-containing medium) and time-course RNA analysis. For these experiments, we selected nine yeast strains, which showed the most pronounced effects on RNA recombination (Fig. 3). Altogether, these experiments established that the recRNA had a
6-fold-increased stability compared to the replicon RNA in the parental yeast (Table 2). The stability of these RNAs was not affected by doxycycline in the parental strain, suggesting that doxycycline does not indirectly affect viral RNA stability. We also found a
2-fold increase in recRNA stability in a doxycycline-independent manner for the FAS2 and NOP10 strains. Similarly, increased stability of recRNA over the replicon RNA was observed in the case of COP1, RGR1, and RPB11, but in a doxycycline-dependent manner (Table 2). On the contrary, the stability of recRNA versus replicon RNA decreased in the MPS1 and RRP9 strains (Table 2). Altogether, these data suggest that the stability of recRNA is a factor that could affect the accumulation of the recRNA in selected yTHC cells. However, stability of the recRNA versus the replicon RNA cannot explain the altered recRNA/replicon ratio for most of the identified yTHC strains. For example, the POL1 strain showed high RNA stability for both replicon RNA and the recRNA in a doxycycline-independent manner (Table 2) and yet recRNA accumulated efficiently only in the presence of doxycycline in the POL1 strain (Fig. 3A and B). Also, recRNA showed a
6-fold increase in stability in parental yeast and yet the replicon RNA accumulated to an amount
6-fold higher than the more stable recRNA (Fig. 3A and B). Therefore, altered stability of the recRNA in the host strains identified above is unlikely to be the only factor affecting recombinant accumulation compared with the original replicon RNA.
![]() View larger version (47K): [in a new window] |
FIG. 6. Accumulation of a representative recRNA in selected yTHC strains. (A) Schematic presentation of a representative "short" recRNA, termed rec 170RII/ 70RII RNA, that was coexpressed with p33/p92 replication proteins in yeast. (B) Northern blot analysis of total RNA extracts from the shown yeast strains was performed as described for Fig. 3. Asterisk marks the accumulation of 5'-truncated viral RNA product (Fig. 3). (C) The accumulation level of rec 170RII/ 70RII RNA is shown in selected yTHC strains graphically, and the level in the parental strain was scored as 100%.
|
|
View this table: [in a new window] |
TABLE 2. Half-lifea of the replicon and the recRNA in yTHC yeast
|
170RII/
70RII recRNA (Fig. 6A) with p33 and p92 in yTHC cells in the presence or absence of doxycycline. Comparison of accumulation levels for recRNA in parental strains and the selected yTHC strains revealed that recRNA accumulated at different levels (more than twofold differences) in all nine yTHC strains tested compared to the parental yeast strain (Fig. 6B and C). For six strains (POL1, COP1, RGR1, RPT4, RRP9, and FAS2), the recRNA replicated two- to sixfold better in the presence of doxycycline, whereas for RPB11 and NOP10, the recRNA replicated less in the presence of doxycycline (Fig. 6B and C). Interestingly, recRNA replication was ninefold higher in MPS1 than in the parental strain, but independent of doxycycline (Fig. 6B and C). Overall, the replication data obtained with recRNA (Fig. 6B and C) versus replicon RNA (Fig. 3C) suggest that POL1, COP1, and RGR1 (in a doxycycline-dependent way) and NOP10 (in a doxycycline-independent way) might show increased recRNA levels (Fig. 3B) because these strains accumulated the recRNAs more efficiently than the replicon RNA. Therefore, it is possible that these host proteins could affect tombusvirus recombination indirectly by facilitating the accumulation of the recRNA better than the replicon RNA.
In contrast, in spite of the efficient replication of recRNA in RPT4 and RRP9 (Fig. 6B and C), these strains supported the low recRNA/replicon ratio compared to the parental strain (Fig. 3A and B). Therefore, RPT4 and RRP9 host genes could be directly involved in tombusvirus recombination, not by affecting recRNA versus replicon RNA accumulation.
Another interesting gene is MPS1, which increased recRNA replication ninefold (Fig. 6B and C) in a doxycycline-independent manner, and yet the MPS1 strain supported a low recRNA/replicon ratio in the presence of doxycycline compared to the parental strain (Fig. 3A and B). In the case of RPB11, both the recRNA and the replicon RNA accumulated threefold less efficiently in the presence of doxycycline than in its absence (Fig. 6B), whereas the recRNA/replicon ratio decreased fourfold in the presence of doxycycline (Fig. 3B). Also, the replication data on recRNA and the replicon RNA do not correlate with the recRNA/replicon ratio for FAS2 in the absence of doxycycline, whereas the correlation exists in the presence of doxycycline. Thus, it is possible that MPS1, RPB11, and FAS2 could also be directly involved in RNA recombination.
Altogether, these replication data suggest that POL1, COP1, RGR1, and NOP10 could enhance the ability of the recRNA to replicate efficiently in these yeast strains. Thus, these host factors might have only an indirect effect on the recombination process. On the other hand, the replication data cannot explain the observed changes in the recRNA/replicon ratio in RRP9, MPS1, RPT4, and RPB11 and can only partially explain changes for the FAS2 strain, suggesting that these genes could affect tombusvirus recombination directly.
A small set of host factors affects tombusvirus recombination.
The possible effect of host genes on viral RNA recombination has been studied with Tombusviruses (57). The previous genetic screen involving
4,800 nonessential single gene deletions in the YKO library (57), and the current genetic screen with 800 essential yeast genes in the yTHC library identified 11 and 16 host genes, respectively, that affected viral recRNA accumulation. Altogether, the two genetic screens combined cover close to 95% of all the estimated number of genes (
5,800) present in the yeast genome. Therefore, we estimate that less than 0.5% of host genes affect viral RNA recombination. This number is probably an underestimate, because genetic screens frequently overlook redundant genes (such as gene families) with similar functions whose deletion/regulation could be compensated by other genes. Nevertheless, the identified host genes represent the first set of host genes shown to affect viral RNA recombination and thus, they should be valuable for studies on the mechanism of RNA recombination and the role of the host in virus evolution.
Conclusions. The identified host genes in the previous (57) and current (Table 1) works can be placed into several groups: (i) RNA-binding proteins, ribonucleases, and a helicase; (ii) intracellular transport proteins; (iii) kinases and phosphatases; (iv) protease, protein reductase, and endopeptidase; (v) transcription factors; (vi) DNA replication factors; and (vii) genes with unknown functions. Some of these proteins might have a direct effect, while other proteins could have an indirect effect, on viral RNA recombination. Further detailed studies will establish the functional roles of many of the identified proteins in tombusvirus recombination.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»