This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Deng, T.
Right arrow Articles by Fodor, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Deng, T.
Right arrow Articles by Fodor, E.

 Previous Article  |  Next Article 

Journal of Virology, December 2006, p. 11911-11919, Vol. 80, No. 24
0022-538X/06/$08.00+0     doi:10.1128/JVI.01565-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Role of Ran Binding Protein 5 in Nuclear Import and Assembly of the Influenza Virus RNA Polymerase Complex{triangledown}

Tao Deng,1,{dagger} Othmar G. Engelhardt,1,{dagger},{ddagger} Benjamin Thomas,2 Alexandre V. Akoulitchev,2 George G. Brownlee,1 and Ervin Fodor1*

Sir William Dunn School of Pathology, University of Oxford, Oxford, United Kingdom,1 Oxford Central Proteomics Facility, Sir William Dunn School of Pathology, University of Oxford, Oxford, United Kingdom2

Received 21 July 2006/ Accepted 21 September 2006


arrow
ABSTRACT
 
The influenza A virus RNA-dependent RNA polymerase is a heterotrimeric complex of polymerase basic protein 1 (PB1), PB2, and polymerase acidic protein (PA) subunits. It performs transcription and replication of the viral RNA genome in the nucleus of infected cells. We have identified a nuclear import factor, Ran binding protein 5 (RanBP5), also known as karyopherin ß3, importin ß3, or importin 5, as an interactor of the PB1 subunit. RanBP5 interacted with either PB1 alone or with a PB1-PA dimer but not with a PB1-PB2 dimer or the trimeric complex. The interaction between RanBP5 and PB1-PA was disrupted by RanGTP in vitro, allowing PB2 to bind to the PB1-PA dimer to form a functional trimeric RNA polymerase complex. We propose a model in which RanBP5 acts as an import factor for the newly synthesized polymerase by targeting the PB1-PA dimer to the nucleus. In agreement with this model, small interfering RNA (siRNA)-mediated knock-down of RanBP5 inhibited the nuclear accumulation of the PB1-PA dimer. Moreover, siRNA knock-down of RanBP5 resulted in the delayed accumulation of viral RNAs in infected cells, confirming that RanBP5 plays a biological role during the influenza virus life cycle.


arrow
INTRODUCTION
 
The genome of influenza A virus (family Orthomyxoviridae) consists of eight RNA segments of negative polarity. These RNA segments are bound by the viral RNA-dependent RNA polymerase (RdRp) and nucleoprotein (NP), forming viral ribonucleoprotein complexes (vRNPs). Upon infection of a cell and release of vRNPs into the cytoplasm, vRNPs are transported into the nucleus to catalyze primary viral RNA transcription (vRNA to mRNA synthesis). Subsequently, the newly synthesized viral RNA polymerase is transported from the cytoplasm into the nucleus and catalyzes secondary transcription and replication (vRNA to cRNA to vRNA synthesis). Newly formed vRNPs, in association with other viral proteins (M1 and NEP, the nuclear export protein), are exported into the cytoplasm and transported to the cell membrane, the site for viral assembly and budding (reviewed in references 16, 27, and 34).

Since influenza virus transcribes and replicates its RNA genome in the nucleus of infected cells (reviewed in references 2 and 14), a number of viral proteins must enter the nucleus during the viral life cycle, namely the NP, the viral RdRp, the matrix protein M1, the NEP (formerly known as NS2), and the nonstructural protein NS1. Influenza virus therefore relies on the host cellular transport machinery for successful nuclear import and export of viral components during its life cycle.

Transport into and out of the nucleus is an active, energy-dependent process for most proteins (reviewed in references 3, 20, and 28). Small molecules are able to diffuse freely across the nuclear pore complex (NPC), whereas larger proteins and large macromolecular complexes, such as messenger RNPs and ribosomes, require specialized transport receptors which direct them through the NPC. Nucleocytoplasmic transport is a highly selective process that involves the specific recognition of appropriate nuclear localization sequences (NLS) or nuclear export sequences by suitable importins or exportins, respectively. With regard to nuclear import, members of the importin ß superfamily (e.g., importin ß) typically bind to adapter proteins (e.g., importin {alpha}), which are responsible for binding to NLS-containing cargo. In some cases, importin ß can bind cargo directly without the involvement of an adapter (23, 44). The ability of importin ß to interact with various proteins of the NPC (e.g., nucleoporins) enables it to transport its cargo into the nucleus. This directionality is determined by a steep gradient of a small GTPase called Ran across the nuclear envelope, where the concentration of the GTP-bound form is greatest in the nucleus. This RanGTP gradient is maintained by a nuclear Ran guanine nucleotide exchange factor (RanGEF) and a cytoplasmic Ran GTPase activating protein (RanGAP) and is believed to power all nucleocytoplasmic transport processes. Upon entry into the nucleus, RanGTP binds to importin ß and induces a conformational change that ultimately results in the release of the NLS cargo (reviewed in references 8 and 32).

Proteins destined for nuclear import generally possess a classical NLS which is characterized by a short stretch of basic amino acids in either one (monopartite) or two (bipartite) clusters. These NLS proteins usually bind to importin ß via members of the importin {alpha} family. However, some cargoes can bind directly to importin ß and are transported without the involvement of importin {alpha} (38, 42). Recently, it has been proposed that some importins have a second cellular function, serving as cytoplasmic chaperones for exposed basic domains to avoid undesired interactions during protein folding and transit to the nucleus (24).

Influenza A virus NP, the major component of vRNPs, is known to interact with several members of the importin {alpha} family of proteins, and it was proposed that these import receptors play a role in the nuclear import of vRNPs (5, 29, 37). An unconventional NLS at the extreme N terminus of NP was shown to be particularly important for import of both NP and RNPs reconstituted in vitro from vRNA and purified NP (10).

Currently, no import receptors involved in the nuclear transport of the viral RdRp have yet been identified. The viral RdRp is a heterotrimeric complex of three subunits, polymerase basic protein 1 (PB1), PB2, and polymerase acidic protein (PA), which are encoded by the three largest segments of the virus genome. In order to perform secondary transcription and replication, the three newly synthesized polymerase subunits have to be transported from the cytoplasm into the nucleus and assembled into a functional trimeric complex. It has been demonstrated that individually expressed PB1, PB2, and PA subunits can enter the nucleus (1, 25, 40). NLS have been described in all three subunits (31, 33, 35), although no specific importins involved in their nuclear import have been identified. A more recent study found that only coexpressed PB1 and PA accumulated efficiently in the nucleus, suggesting that the dimer of PB1-PA might be a substrate for nuclear import (18).

As yet, it is unclear where in the cell assembly of the viral RdRp takes place. A partially purified dimer of PB1-PA was capable of forming a functional polymerase complex by associating with PB2 in vitro (12). Based on these in vitro assembly studies and in vivo nuclear localization studies (18), it was proposed that PB1 and PA associate in the cytoplasm and are transported into the nucleus as a dimer. PB2 enters the nucleus independently and joins the PB1-PA dimer in the nucleus to form functional RdRp (12).

Deciphering the nuclear import pathway(s) used by the viral RdRp is of interest not only because it will shed light on an important part of the complex interplay between the host cell and the virus but also because nuclear import and assembly of the RdRp are essential steps in the viral life cycle that may be targeted for therapeutic intervention. Moreover, an understanding of the interplay between the host cell and the virus, in particular, elucidating the molecular interactions between the viral RNA polymerase and host factors, could also lead to an understanding of the as yet unclear role of the viral polymerase in determining host range specificity and pathogenicity of avian and human influenza virus isolates (19, 22, 41).

We report here that both PB1 alone and the dimer formed by PB1 and PA interact with the import receptor Ran binding protein 5 (RanBP5) and that this interaction is sensitive to RanGTP, which suggests that RanBP5 is a bona fide import receptor for these viral proteins. Release of RanBP5 from the PB1-PA dimer by RanGTP treatment allows complex formation with PB2, leading to a functional polymerase complex. Furthermore, knock-down of RanBP5 expression in cells inhibits the nuclear accumulation of the PB1-PA dimer and leads to decreased levels of viral RNA synthesis, suggesting that the interaction between RanBP5 and PB1 is biologically relevant.


arrow
MATERIALS AND METHODS
 
Plasmids. The plasmids coding for PB1, PB2, and PA of influenza virus A/WSN/33 (pcDNA-PB1, pcDNA-PA, pcDNA-PB1tap, pcDNA-PB2tap, pcDNA-PAtap, pcDNA-PB1-GFP, pcDNA-PB2-GFP, and pcDNA-PA-GFP) have been described previously (12, 15, 17, 18). The plasmid encoding the His-tagged Ran mutant Q69L [pQE32-Ran(Q69L), glutamine to leucine at amino acid residue 69] was obtained from D. Görlich (26).

Purification of TAP-tagged proteins. Human embryonic kidney 293T cells were transfected with the corresponding pcDNA plasmids to express influenza virus RNA polymerase subunits individually or in combination to obtain partially purified polymerase monomers, dimers, and a trimeric complex. Polymerase proteins and interacting host proteins were purified by using the tandem affinity purification (TAP) method as described previously (12, 18, 39). Briefly, cell lysates prepared from transfected 293T cells were incubated with immunoglobulin G (IgG)-Sepharose and bound proteins released by cleavage with tobacco etch virus (TEV) protease (Invitrogen). Purified protein samples were analyzed by sodium dodecyl sulfate-8% polyacrylamide gel electrophoresis (SDS-8% PAGE), followed by silver staining with a SilverXpress kit (Invitrogen) or Western blotting.

Identification of host proteins by mass spectrometry. Protein samples were analyzed by SDS-8% PAGE, and protein bands were stained with the mass spectrometry-compatible SilverQuest silver staining kit (Invitrogen). Bands of interest were excised, cut into small pieces, and washed twice in 100 µl of 50 mM ammonium bicarbonate in 50% acetonitrile. Gel pieces were then soaked in 100% acetonitrile for 20 min, followed by freeze-drying. The dried gel pieces were rehydrated in 30 µl of sequencing grade trypsin (Promega) solution (0.01 µg/µl) in 20 mM ammonium bicarbonate and incubated at 16°C for 18 h. The supernatant was collected, and the gel pieces were extracted in 100 µl of 50% acetonitrile in 0.1% formic acid. The supernatants were combined, and the extracted peptides were freeze-dried. Peptides were dissolved in 7 µl of 0.1% formic acid and analyzed by liquid chromatography-tandem mass spectrometry (LC/MS/MS) at the Oxford Central Proteomics Facility, Sir William Dunn School of Pathology, University of Oxford.

RanGTP release and RNA polymerase complex assembly experiments in vitro. For the RanGTP release experiment, PB1tap, PB1-PAtap dimer, or PAtap, expressed in transfected 293T cells was immobilized on IgG-Sepharose. The immobilized and partially purified polymerase proteins were treated with either RanGTP or buffer, as a negative control, for 30 min at 25°C in 100 µl of Ran buffer (10 mM Tris-HCl [pH 8.0], 150 mM NaCl, 5 mM MgCl2, 0.1% Igepal CA-630, 1x Complete Mini, EDTA-free protease inhibitor cocktail tablet [Roche]). The Q69L mutant of Ran was used in these release experiments because it is unable to hydrolyze its bound GTP (4). Recombinant His-tagged Ran(Q69L) was expressed in Escherichia coli and purified on a HiTrap chelating column (GE Healthcare) loaded with nickel sulfate, followed by cation exchange chromatography on a HiTrap SP FF column (GE Healthcare) (26). About 10 µg of Ran(Q69L) was preincubated with 10 mM GTP for 1 h at 4°C prior to addition to the Ran buffer-bead mixture. IgG-Sepharose beads were washed two times with 1 ml of wash buffer (10 mM Tris-HCl [pH 8.0], 150 mM NaCl, 0.1% Igepal CA-630, 1 mM phenylmethylsulfonyl fluoride) and once with 1 ml of cleavage buffer (10 mM Tris-HCl [pH 8.0], 150 mM NaCl, 0.1% Igepal CA-630, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride). Proteins were released from IgG-Sepharose by cleavage with TEV protease (Invitrogen) at 16°C for 2 h. Alternatively, for the RNA polymerase complex assembly experiment, RanGTP or buffer treated immobilized PB1tap, PB1-PAtap, or PAtap was incubated with crude cell lysates of 293T cells containing PB2 for 15 min at 25°C. After four washes with 1 ml of wash buffer and one wash with 1 ml of cleavage buffer, bound proteins were released from IgG-Sepharose by cleavage with TEV protease. Proteins were analyzed by SDS-8% PAGE and visualized by silver staining or Western blotting. Transcriptional activity of the reconstituted RNA polymerase complex was assayed by in vitro ApG-primed transcription as described previously (12). Transcription products were analyzed by 20% PAGE in 7 M urea, followed by autoradiography and quantitation by phosphorimaging analysis.

Design of siRNA and knock-down of RanBP5. Synthetic small interfering RNA (siRNA) duplexes targeting RanBP5 and control siRNAs targeting the chloramphenicol acetyltransferase (CAT) and green fluorescent protein (GFP) genes were designed by using the Dharmacon siDESIGN Center (http://www.dharmacon.com/sidesign/). The following siRNAs (Dharmacon) were used: UAAGACCAAUGCUCCAAUAUU and GGAAGCAACUCUACAGCUAUU to target RanBP5, UCAUCGCUCUGGAGUGAAUUU to target the CAT gene, and UUUCGCGUAUGGUCUUCAAUU to target the GFP gene (sense sequences are shown). To knock down RanBP5, 293T cells in 35-mm dishes were transfected in suspension with 5 µg of a mixture of the two RanBP5-specific siRNAs using Lipofectamine 2000 transfection reagent (Invitrogen). As a control, cells were transfected with a mixture of two siRNAs targeting CAT and GFP. At 48 h posttransfection, cells were infected with influenza A/WSN/33 virus at a multiplicity of infection of 1 or were mock infected. Total RNA was isolated 3, 4.5, or 6 h postinfection using TRIzol (Invitrogen). To analyze RanBP5 mRNA, reverse transcription was performed with a T20 primer and SuperScript reverse transcriptase (Invitrogen), followed by quantitative PCR performed by using a QuantiTect SYBR Green PCR Kit (QIAGEN) and a Corbett Rotor-Gene RG-3000 cycler. The following PCR primers were used: GGAGATCAGCAAAGCTTTGGT and TGCCACTCGAACACCATCGTG. Reactions were set up in triplicate, and data were analyzed by using the comparative quantitation function of the Rotor-Gene 6 software. To analyze knock-down levels of RanBP5 protein, siRNA-treated cells were harvested 48 h after siRNA transfection and lysed in SDS-PAGE lysis buffer. Proteins were analyzed by SDS-8% PAGE, followed by Western blotting.

Analysis of vRNAs by primer extension. Primer extension analysis of neuraminidase (NA)-specific vRNAs was performed as described previously (7, 17). To analyze NS-specific viral RNAs, the following primers were used: TGATTGAAGAAGTGAGACACAG to detect NS vRNA and CGCTCCACTATTTGCTTTCC to detect NS cRNA and NS1 mRNA. The expected size of the NS-specific primer extension products in nucleotides is 156 for vRNA, 226 for cRNA, and between 236 and 251, depending on the length of the capped primer, for mRNA. Transcription products were analyzed on 6% polyacrylamide gels containing 7 M urea in Tris-borate-EDTA buffer and were detected by autoradiography. Products were quantitated by phosphorimaging analysis.

Localization of polymerase subunits in RanBP5 knock-down cells. 293T cells grown on 22- by 22-mm coverslips in six-well plates were transfected with a mixture of the two RanBP5-specific siRNAs (see above). As a control, cells were transfected with siRNA targeting CAT. At 48 h after siRNA transfection, cells were transfected with plasmids expressing the PB1-GFP and PA dimer or PB1-GFP or PB2-GFP monomers. After 6 h, the transfection mixture was replaced with minimal essential medium containing 10% fetal calf serum, and the cells were incubated for 18 h. Cells were fixed with 4% paraformaldehyde in 250 mM HEPES (pH 7.5), and coverslips were mounted in Mowiol containing 4',6'-diamidino-2-phenylindole. Cells were viewed by using a Zeiss Axioplan microscope with a Zeiss x63 oil immersion objective with a numerical aperture of 1.25, and the images were processed by using Adobe Photoshop 7.0. For numerical analysis of polymerase distribution in transfected cells, 300 (for individually expressed PB1-GFP) or 500 (for PB2-GFP or PB1-GFP coexpressed with PA) fluorescent cells per coverslip were examined and scored according to whether the observed fluorescence was predominantly cytoplasmic, nuclear, or present throughout the cell. Percentages of cells were calculated and expressed as an average from three independent experiments.


arrow
RESULTS
 
RanBP5 interacts with PB1 but not with PB2 and PA. We wanted to identify proteins interacting with the influenza virus RNA polymerase subunits using a biochemical approach. For this purpose, plasmids expressing the three subunits of the viral RdRp fused with a C-terminal TAP tag were transfected individually into 293T cells. The polymerase subunits together with any associated proteins were purified from lysates of transfected cells on IgG-Sepharose, followed by release of the purified proteins by cleavage with TEV protease. Purified samples were analyzed by SDS-PAGE and silver staining. As shown in Fig. 1A, a prominent band at a molecular mass of approximately 115 kDa was present in a sample containing purified PB1 (lane 2) but not in samples containing the other two subunits, PA and PB2 (lanes 1 and 3). The copurifying band was excised from a gel similar to the one shown in Fig. 1A and subjected to in-gel trypsin digestion followed by LC/MS/MS. Peptides obtained from this analysis identified the 115-kDa band as RanBP5, which is also known as karyopherin ß3, importin ß3, or importin 5 (Fig. 1C). The identity of this protein was confirmed by Western blot analysis using a polyclonal antibody specific for RanBP5. This revealed a band of the correct size in a purified sample of PB1 but not of PA or PB2 (Fig. 1A, lower panel).


Figure 1
View larger version (41K):
[in this window]
[in a new window]

 
FIG. 1. Identification of RanBP5 as an interactor of influenza virus RNA polymerase subunit PB1. (A and B) Purification of TAP-tagged RNA polymerase subunits, dimers, and trimeric complex from 293T cells transfected with the indicated expression plasmids. Purified proteins were analyzed by silver staining of an SDS-8% PAGE gel (upper panel) or by Western blotting using a polyclonal anti-karyopherin ß3 antibody (Santa Cruz) (lower panels). Positions of PB1tap, PB2tap, PAtap, PB1, PA, and RanBP5 are indicated. The identity of the polymerase subunits was established in previous experiments by Western blot analysis using PB1-, PB2-, and PA-specific antibodies (12). Sizes of protein standards (Bio-Rad) in kilodaltons are shown on the left. The open circles indicate the positions of Hsp90 identified by both matrix-assisted laser desorption ionization-time of flight and LC/MS/MS (12). (C) Sequence of RanBP5 (accession number NM_002271) with peptides identified by LC/MS/MS shown in bold. The sequence coverage was 20%.

RanBP5 interacts with PB1-PA dimer but not with PB1-PB2 dimer or trimeric PB1-PB2-PA polymerase complex. We also purified dimers of polymerase subunits as well as the trimeric RdRp from cells transfected with different combinations of expression plasmids encoding TAP-tagged and untagged polymerase subunits. Both silver staining of SDS-PAGE gels (Fig. 1B, upper panel) and Western blot analysis (lower panel) showed copurification of endogenous RanBP5 with PB1-PAtap dimer (lane 1), whereas only trace amounts of RanBP5 were observed copurifying with a PB1-PB2tap dimer or a trimeric polymerase complex purified using PB2tap (lanes 2 and 3). These results show that RanBP5 can interact with either PB1 alone or PB1 bound to PA, but it cannot interact efficiently with PB1 once it is bound to PB2 (either in a PB1-PB2 dimer or in the context of the trimeric complex).

RanBP5 forms a potential import complex with PB1 and PB1-PA dimer. RanBP5 is a member of the importin ß family of transport receptors. Interactions between nuclear import receptors and their import substrates are typically characterized by their sensitivity to RanGTP. After nuclear import, a high RanGTP concentration in the nucleus triggers the release of import substrates from the import receptors. Indeed, this feature has been exploited in the past to identify new import substrates for import receptors by searching for proteins that bound putative importins only in the absence of RanGTP (30).

In order to test whether the interaction between RanBP5 and PB1 was sensitive to RanGTP, we purified PB1 and PB1-PA dimer from transiently transfected 293T cells expressing PB1tap or PB1 and PAtap, respectively. The polymerase proteins immobilized on IgG-Sepharose were incubated with a RanGTP that possessed a point mutation of glutamine to leucine at amino acid residue 69 [Ran(Q69L)] which inhibits its GTPase activity (4). The immobilized polymerase subunits plus their associated proteins were released from IgG-Sepharose by TEV protease cleavage (Fig. 2A). Western blot analysis revealed that RanBP5 associated with both PB1 and PB1-PA dimer, as expected (see above). However, the levels of RanBP5 were greatly reduced after incubation with Ran(Q69L)GTP in the case of the PB1-PA dimer (compare lanes 3 and 4) and, to a lesser extent, in the case of the PB1 monomer (compare lanes 1 and 2). RanBP5 was consistently more efficiently released from the PB1-PA dimer compared to the PB1 monomer in several repeats of this experiment (results not shown). These results support the hypothesis that RanBP5 is an authentic import receptor for PB1 and the PB1-PA dimer.


Figure 2
View larger version (34K):
[in this window]
[in a new window]

 
FIG. 2. (A) The interaction between RanBP5 and PB1 is disrupted in the presence of RanGTP. PB1tap or PB1/PAtap dimer were bound to IgG-Sepharose and incubated with Ran(Q69L)GTP or buffer. The immobilized material was released by cleavage with TEV protease and analyzed by silver staining of SDS-8% PAGE gels (upper panel) or Western blotting with a polyclonal anti-karyopherin ß3 antibody (Santa Cruz) (lower panel). Positions of PB1, PB1tap, PAtap, and RanBP5 are indicated. Sizes of protein standards (Bio-Rad) in kilodaltons are shown on the left. (B) RanGTP-treated PB1-PA dimer assembles with PB2 into a transcriptionally active polymerase complex. PB1tap, PB1/PAtap dimer, or PAtap, bound to IgG-Sepharose and treated with Ran(Q69L)GTP or buffer, was incubated with crude cell lysates from 293T cells containing PB2. Bound material was released by cleavage with TEV protease and analyzed by silver staining of SDS-8% PAGE gels (upper panel) or by Western blotting with a rabbit polyclonal anti-PB2 antibody (13) (middle panel). Transcriptional activity of the reconstituted RNA polymerase complex was assayed by in vitro ApG-primed transcription (lower panel). Positions of RanBP5, PB1, PAtap, PB2, and transcription products (TP) are indicated on the right. The position of PB1tap and the size of protein standards in kilodaltons are shown on the left. The open circles indicate the positions of Hsp90 identified by both matrix-assisted laser desorption ionization-time of flight and LC/MS/MS (12).

PB2 forms a transcriptionally active RNA polymerase complex with RanGTP-treated PB1-PA dimer in vitro. To study whether RanGTP-mediated release of RanBP5 from PB1-PA could facilitate assembly with PB2, we performed an experiment similar to that described in Fig. 2A. After Ran(Q69L)GTP treatment of immobilized PB1tap, PB1-PAtap, or PAtap as a negative control, the beads were incubated with cell lysates from 293T cells expressing PB2. The amount of assembled PB2 was below detection levels on silver-stained SDS-PAGE (Fig. 2B, upper panel), but it could be detected by Western blotting (middle panel). We found that more PB2 assembled with Ran(Q69L)GTP-treated PB1-PA compared to buffer-treated PB1-PA dimer (compare lanes 3 and 4). By visual comparison of the intensity of the PB2-specific bands in three independent experiments, we estimate that about two- to threefold more PB2 was present in the Ran(Q69L)GTP-treated sample. We found a corresponding increase in the transcriptional activity of the assembled polymerase; 3.2 times higher transcriptional activity (average of two experiments) was observed if the PB1-PA dimer was treated with Ran(Q69L)GTP instead of buffer prior to assembly with PB2 (Fig. 2B, lower panel, compare lanes 3 and 4). In contrast, RanGTP treatment did not appear to increase the amount of PB2 assembled with PB1 monomer (Fig. 2B, middle panel, compare lanes 1 and 2). These results support the hypothesis that RanGTP-mediated release of RanBP5 from the PB1-PA dimer could facilitate complex formation with PB2 in the cell nucleus.

Knock-down of RanBP5 in cells infected with influenza virus decreases viral RNA accumulation. To assess the biological significance of the observed interaction between RanBP5 and PB1, we performed siRNA-mediated knock-down of RanBP5. A mixture of two siRNA oligonucleotides targeting RanBP5 mRNA was transfected into 293T cells. Specific siRNA decreased levels of RanBP5 mRNA to about 10 to 20% of the control sample treated with CAT- and GFP-specific siRNA (Fig. 3A). The decrease in mRNA levels was also reflected in a decreased amount of RanBP5 protein as determined by Western blot analysis (Fig. 3B).


Figure 3
View larger version (23K):
[in this window]
[in a new window]

 
FIG. 3. Knock-down of RanBP5 in 293T cells. (A) Quantitation of RanBP5 mRNA by quantitative reverse transcription-PCR. Cells were transfected with RanBP5- or CAT- and GFP-specific siRNA, and 48 h posttransfection they were infected with influenza A/WSN/33 virus. Total RNA was harvested 3.0, 4.5, or 6.0 h postinfection, and RNA concentration was determined by measuring the optical density at 260 nm. RanBP5 mRNA was determined by quantitative PCR. The relative values shown are an average of three measurements of three independent RNA samples. Values for the RNA sample harvested at 6 h postinfection from cells treated with control siRNA were set to 1. Standard deviations are shown. (B) Western blot analysis of knock-down levels of RanBP5. Karyopherin {alpha}3, detected with a goat polyclonal anti-KPNA3 antibody (Abcam), was used as a loading control. Positions of RanBP5 and karyopherin {alpha}3 are indicated on the right. Sizes of protein standards (Bio-Rad) in kilodaltons are shown on the left.

In order to study the effect of RanBP5 knock-down on viral RNA transcription and replication, cells were infected with influenza A/WSN/33 virus 48 h after siRNA transfection, and the steady-state levels of all three RNA species for segment 6 (NA) were determined using primer extension assays (Fig. 4A). Figure 4B shows a summary of three independent siRNA transfection/influenza virus infection experiments over a time course from 3 to 6 h postinfection. For each time point tested, RNA levels obtained in cells transfected with the CAT- and GFP-specific control siRNA were taken as 100%. At early time points postinfection, levels of viral RNA species were lower in cells that received RanBP5-specific siRNA compared to control cells. The reduction in levels of virus-specific RNA was reproducible and statistically significant (P < 0.05) for the 3- and 4.5-h time points (with the exception of mRNA at 4.5 h which, although reduced, was statistically not significantly different from the control). At 6 h postinfection, however, viral RNA synthesis in cells knocked down for RanBP5 reached levels comparable to control cells. To confirm that the inhibitory effect of RanBP5 knock-down on viral RNA levels at early time points postinfection was not segment specific, we also performed similar primer extension analysis for segment 8 (NS) (Fig. 4C). Knock-down of RanBP5 again resulted in a reduction of levels of mRNA and vRNA at the 3- and 4.5-h time points postinfection. Due to weak signals, quantitation of cRNA was not feasible in this experiment. Taken together, these results are consistent with the hypothesis that RanBP5 plays a role in the viral life cycle.


Figure 4
View larger version (26K):
[in this window]
[in a new window]

 
FIG. 4. Effect of RanBP5 knock-down on viral RNA levels in infected cells. 293T cells transfected with RanBP5- or CAT- and GFP-specific siRNA were infected with influenza A/WSN/33, and total RNA was isolated at the time points indicated. (A) Primer extension assay analyzing NA-specific viral RNAs. The positions of transcription products derived from NA mRNA, cRNA, vRNA, and 5S rRNA, used as an internal control, are indicated on the right. Positions of size markers (32P-labeled 1-kb ladder; Invitrogen) in nucleotides are indicated on the left. (B and C) Statistical analysis of NA-specific (B) and NS-specific (C) viral RNAs in infected cells transfected with RanBP5 siRNA. An average of three measurements of three independent RNA samples is shown with standard deviations. Values were standardized to the 5S rRNA signal, and for each time point, values were expressed as a percentage of the control values that were set to 100% (samples treated with CAT- and GFP-specific siRNA). One sample Student's t test was performed to assess whether the values were significantly different from 100%. Values significantly different from 100% (P < 0.05) are indicated by an asterisk (*).

Knock-down of RanBP5 inhibits the nuclear accumulation of the PB1-PA dimer. We hypothesized that the delayed accumulation of viral RNAs in RanBP5 knock-down cells could be caused by a defect in RNA polymerase nuclear import. To test this hypothesis, we coexpressed PB1-GFP and PA in 293T cells treated with RanBP5-specific siRNA. We found that in cells treated with the CAT-specific control siRNA, PB1-GFP localized predominantly to the nucleus (Fig. 5) as expected (18). In contrast, in RanBP5 siRNA-treated cells, PB1-GFP was distributed all over the cell, with strong signals observed in the cytoplasm. We also analyzed the cellular distribution of PB1-GFP expressed in the absence of PA. In the control cells treated with CAT-specific siRNA, PB1-GFP was observed both in the cytoplasm and nucleus, usually with a predominant cytoplasmic signal (Fig. 5). This result is consistent with our previous observation that PA is required for the nuclear accumulation of PB1 (18). In cells treated with RanBP5-specific siRNA, a higher percentage of cells showed exclusively cytoplasmic signal. In order to exclude the possibility that knock-down of RanBP5 by siRNA had a general effect on nuclear import, we analyzed the localization of individually expressed PB2-GFP which is known to accumulate in the cell nucleus (18, 25, 31, 40) and does not interact with RanBP5 (see above). We found that the nuclear accumulation of PB2-GFP was not affected by RanBP5 knock-down as it showed a predominantly nuclear localization in both CAT and RanBP5 siRNA-treated cells (Fig. 5). Taken together, these results show that RanBP5 plays a role in the nuclear import of PB1 and the PB1-PA dimer.


Figure 5
View larger version (60K):
[in this window]
[in a new window]

 
FIG. 5. Effect of RanBP5 knock-down on RNA polymerase localization. CAT- or RanBP5-specific siRNA-treated cells, expressing PB1-GFP and PA (PB1-GFP/PA), PB1-GFP, or PB2-GFP, were analyzed by fluorescence microscopy. Cells were scored for the localization pattern of the GFP-tagged polymerase subunit: N, predominantly nuclear; N/C, distributed throughout the cell; C, predominantly cytoplasmic. The number of cells showing each localization pattern was expressed as a percentage of the total cell number. The average of three experiments with standard deviations is shown. Examples of the localization patterns of GFP-tagged polymerase subunits (GFP) are shown under the corresponding charts. The bottom panels show the same fields of cells as the upper panels, stained for DNA, to indicate the location of nuclei. Note that cells expressing PB2-GFP, which exhibited a strong nuclear signal and a fainter mitochondrial signal, as observed previously (6, 18), were scored as cells with predominantly nuclear localization.


arrow
DISCUSSION
 
Orthomyxoviruses such as influenza viruses are unusual among RNA viruses in that they replicate and transcribe their genomic RNA in the nucleus of the infected cell. Influenza virus has evolved to make use of this environment by usurping for its own gene expression certain cellular activities that are only present in the nucleus (reviewed in references 2 and 14). On the other hand, this dependence on host nuclear functions requires mechanisms that allow the transport of viral components into and out of the nucleus.

We have found a nuclear import receptor, RanBP5, as a novel interacting partner of the PB1 subunit of the viral RdRp. RanBP5 is a member of the importin ß superfamily (9, 20) and is known to mediate the nuclear import of histones and ribosomal proteins L23a, S7, and L5 (11, 23, 44). In this study, RanBP5 was found to copurify with individually expressed PB1 but not with individually expressed PB2 or PA polymerase subunits. The identity of RanBP5 was confirmed by both mass spectrometry and Western blot analyses. RanBP5 also copurified efficiently with a PB1-PA dimer but not with either a PB1-PB2 dimer or the trimeric PB1-PB2-PA polymerase complex. Both PB1-RanBP5 and PB1-PA-RanBP5 complexes were sensitive to RanGTP, which caused the release of RanBP5. This suggests that RanBP5 could be an import receptor for PB1 and PB1-PA in infected cells. Moreover, release of RanBP5 from the PB1-PA dimer by RanGTP treatment facilitated the assembly of PB1-PA dimer and PB2 monomer into a transcriptionally active RNA polymerase complex. In agreement with a biological role of RanBP5 during the viral life cycle, knock-down of RanBP5 levels by siRNA inhibited the nuclear accumulation of the PB1-PA dimer in transfected cells and resulted in the delayed accumulation of viral RNAs, i.e., mRNA, cRNA, and vRNA, in infected cells.

Recently, a model was proposed for the transport and assembly of the viral RdRp (12). According to this model, PB1 and PA form a dimer in the cytoplasm, and they are transported into the nucleus as a dimeric complex. This was based on an observation that PB1 accumulates efficiently in the cell nucleus only if coexpressed with PA (18). On the other hand, individually expressed PB2 was found to accumulate in the cell nucleus, in agreement with previous findings that PB2 contains nuclear localization signals (25, 31, 40). Therefore, it was proposed that PB2 could form a trimeric complex with PB1-PA dimer in the cell nucleus. As further support for this model, an active RdRp could be reconstituted in vitro from partially purified PB1-PA dimer and PB2 but not from individual subunits or from a partially purified PB1-PB2 dimer and PA, suggesting a sequential assembly model for the viral RdRp (12). Based on the findings described in this paper, we propose that RanBP5 could mediate the nuclear import of the PB1-PA dimer (Fig. 6). In agreement with this model, siRNA-mediated knock-down of RanBP5 inhibited the nuclear accumulation of the PB1-PA dimer. There was about a fourfold decrease in the number of cells showing exclusively nuclear PB1-GFP in the RanBP5 knock-down cells compared to the control cells treated with CAT-specific siRNA. Coexpression of PA was essential for the nuclear accumulation of PB1-GFP as it exhibited a predominantly cytoplasmic localization when it was expressed individually, in agreement with a previous report (18). The localization of individually expressed PB1-GFP was also affected by RanBP5 knock-down, resulting in a higher percentage of cells showing an exclusively cytoplasmic localization. Thus, RanBP5 appears to contribute to the nuclear targeting of PB1 even in the absence of PA, but for its efficient nuclear accumulation, PA is required. This is consistent with the observation that the PB1-PA-RanBP5 complex is more sensitive to RanGTP than the PB1-RanBP5 complex, as RanGTP-mediated release of RanBP5 from the PB1-PA dimer was reproducibly more efficient compared to the release from the PB1 monomer. We speculate that a conformational change in PB1-RanBP5, induced by PA binding, might be required for the assembly of an import-competent complex.


Figure 6
View larger version (34K):
[in this window]
[in a new window]

 
FIG. 6. Model for the transport and assembly of the influenza virus RNA polymerase complex (see text for details).

After nuclear import, RanGTP-induced release of RanBP5 from the PB1-PA dimer could allow PB2 binding (Fig. 6). Indeed, we showed that RanGTP-mediated release of RanBP5 from the PB1-PA dimer facilitated the assembly with PB2. In agreement with this, we observed higher transcriptional activity if assembly was performed with a RanGTP-treated PB1-PA dimer compared to a buffer-treated PB1-PA dimer. The fact that some PB2 could assemble with PB1-PA dimer in the absence of RanGTP treatment, although less efficiently, could indicate that some RanBP5-free PB1-PA might be present in our partially purified PB1-PA preparations. Interestingly, RanGTP-mediated release of RanBP5 from PB1 monomer did not increase the efficiency of assembly with PB2. This may be because PB2 has an intrinsically low affinity for PB1 in the absence of PA, which is consistent with the observation that only low levels of PB1 copurify with PB2tap if PA is absent (Fig. 1B, compare the intensity of PB1 bands in lanes 2 and 3). Although our results are consistent with the transport and assembly model proposed in Fig. 6, we cannot exclude the possibility that alternative transport and assembly pathways for the newly synthesized viral RNA polymerase operate in infected cells.

Our model predicts that PB1 and PA are transported into the nucleus as a complex, which seemingly contradicts previous observations that the nuclear import of PA is delayed compared to PB1 (1, 36). We do not understand the reason for this discrepancy, but we speculate that it could be due to low sensitivity of detection in previous studies using indirect immunofluorescence. Indeed, it was demonstrated previously (18) and confirmed in this study that the nuclear accumulation of PB1-GFP is dependent on the coexpression of PA (Fig. 5). Moreover, it was also reported that all three polymerase subunits accumulated efficiently in the nuclei of MDBK cells infected with influenza A/WSN/33 virus as early as 2 to 3 h postinfection (18).

The observation that siRNA knock-down of RanBP5 results in the inhibition of the accumulation of all three viral RNA species at early time points postinfection is consistent with the hypothesis that RanBP5 plays a role in the nuclear import of the newly synthesized RNA polymerase. It was not surprising that inhibition was only partial as residual RanBP5 could be detected in RanBP5 knock-down cells 48 h after siRNA transfection (Fig. 3B) at the point when infections were performed. This residual RanBP5 could transport viral polymerase into the nucleus but possibly in reduced amounts, resulting in lower levels of viral transcripts. This is in agreement with the results presented in Fig. 5 showing that some polymerase could still be detected in the nucleus of RanBP5 knock-down cells. At later time points postinfection, no inhibition of viral RNA levels was observed in RanBP5 knock-down cells. It is possible that as more polymerase accumulates in the nucleus, the system becomes saturated, and increased levels of polymerase do not result in a further increase of viral transcription products. We speculate that only a limited fraction of the newly synthesized polymerase might be transcriptionally engaged, while most of the polymerase fulfils a structural function by playing a role in the assembly of unengaged progeny vRNPs. At late time points postinfection, newly synthesized viral polymerase could preferentially function in the assembly of progeny RNPs.

In theory, it is possible that RanBP5 also plays a role in the nuclear import of incoming vRNPs, introduced into the cell by the infecting virions, via an interaction with the RNA polymerase of vRNPs. However, this is unlikely since in vRNPs the polymerase is present as a trimeric complex, and we showed that only trace levels of RanBP5 interacted with a trimeric RdRp. Nevertheless, to address this possibility, we performed an siRNA knock-down and infection experiment similar to the one described in Fig. 4 but including cycloheximide immediately after infection in order to prevent synthesis of viral proteins. Under these conditions only viral mRNAs are observed, synthesized by the incoming vRNPs (43). In preliminary experiments, there were no differences in viral mRNA levels in cells transfected with RanBP5-specific siRNA and control cells (results not shown). This experiment supports the hypothesis that RanBP5 is not involved in nuclear import of incoming vRNPs. In fact, it was proposed that karyopherins {alpha}1 and {alpha}2 mediate the nuclear import of incoming vRNPs via their interactions with the NP component of vRNPs (37).

There is emerging evidence that members of the importin ß-type receptors, including RanBP5, fulfill a dual function both as nuclear import receptors and cytoplasmic chaperones to prevent aggregation of their basic import cargoes by shielding basic patches on the cargoes (21, 24). Therefore, RanBP5 might also act as a chaperone for the PB1 subunit to prevent self-aggregation or undesired interactions between PB1 and host factors. However, this hypothesis remains to be tested.

The influenza virus RNA polymerase plays a crucial role in determining host range specificity and pathogenicity and could mediate adaptation of avian influenza viruses to mammalian hosts (19, 22, 41). The molecular mechanisms behind these functions are unknown, but they imply that interactions with host factors are involved. Here, we showed that one of the polymerase subunits, PB1, derived from influenza A/WSN/33, originally a human influenza isolate, interacts with a host factor, RanBP5, in mammalian cells. We propose that RanBP5 plays a role during the viral life cycle by being involved in the nuclear import of the newly synthesized viral RNA polymerase. It remains to be determined whether a similar mechanism operates in avian cells to facilitate the nuclear import of the RNA polymerase of avian influenza viruses.


arrow
ACKNOWLEDGMENTS
 
We thank M. Smith for excellent technical assistance, D. Görlich and F. Vreede for reagents, and S. M. Liu and F. Vreede for helpful discussions and critical reading of the manuscript.

This work was supported by the MRC (senior nonclinical research fellowship G117/457 to E.F., program grant G9523972 to G.G.B., and cooperative grant G9826944).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Sir William Dunn School of Pathology, University of Oxford, South Parks Road, Oxford OX1 3RE, United Kingdom. Phone: 44 1865 275580. Fax: 44 1865 275556. E-mail: ervin.fodor{at}path.ox.ac.uk. Back

{triangledown} Published ahead of print on 27 September 2006. Back

{dagger} These authors contributed equally to this study. Back

{ddagger} Present address: Division of Virology, National Institute for Biological Standards and Control, South Mimms, Potters Bar EN6 3QG, United Kingdom. Back


arrow
REFERENCES
 
    1
  1. Akkina, R. K., T. M. Chambers, D. R. Londo, and D. P. Nayak. 1987. Intracellular localization of the viral polymerase proteins in cells infected with influenza virus and cells expressing PB1 protein from cloned cDNA. J. Virol. 61:2217-2224.[Abstract/Free Full Text]
  2. 2
  3. Amorim, M. J., and P. Digard. 9 June 2006, posting date. Influenza A virus and the cell nucleus. Vaccine. [Online.] doi:10.1016/j.vaccine.2006.05.066.
  4. 3
  5. Bayliss, R., A. H. Corbett, and M. Stewart. 2000. The molecular mechanism of transport of macromolecules through nuclear pore complexes. Traffic 1:448-456.[CrossRef][Medline]
  6. 4
  7. Bischoff, F. R., C. Klebe, J. Kretschmer, A. Wittinghofer, and H. Ponstingl. 1994. RanGAP1 induces GTPase activity of nuclear Ras-related Ran. Proc. Natl. Acad. Sci. USA 91:2587-2591.[Abstract/Free Full Text]
  8. 5
  9. Bullido, R., P. Gómez-Puertas, C. Albo, and A. Portela. 2000. Several protein regions contribute to determine the nuclear and cytoplasmic localization of the influenza A virus nucleoprotein. J. Gen. Virol. 81:135-142.[Abstract/Free Full Text]
  10. 6
  11. Carr, S. M., E. Carnero, A. García-Sastre, G. G. Brownlee, and E. Fodor. 2006. Characterization of a mitochondrial-targeting signal in the PB2 protein of influenza viruses. Virology 344:492-508.[CrossRef][Medline]
  12. 7
  13. Chan, A. Y., F. T. Vreede, M. Smith, O. G. Engelhardt, and E. Fodor. 2006. Influenza virus inhibits RNA polymerase II elongation. Virology 351:210-217.[CrossRef][Medline]
  14. 8
  15. Clarke, P. R., and C. Zhang. 2001. Ran GTPase: a master regulator of nuclear structure and function during the eukaryotic cell division cycle? Trends Cell Biol. 11:366-371.[CrossRef][Medline]
  16. 9
  17. Conti, E., and E. Izaurralde. 2001. Nucleocytoplasmic transport enters the atomic age. Curr. Opin. Cell Biol. 13:310-319.[CrossRef][Medline]
  18. 10
  19. Cros, J. F., A. García-Sastre, and P. Palese. 2005. An unconventional NLS is critical for the nuclear import of the influenza A virus nucleoprotein and ribonucleoprotein. Traffic 6:205-213.[CrossRef][Medline]
  20. 11
  21. Deane, R., W. Schäfer, H. P. Zimmermann, L. Mueller, D. Görlich, S. Prehn, H. Ponstingl, and F. R. Bischoff. 1997. Ran-binding protein 5 (RanBP5) is related to the nuclear transport factor importin-beta but interacts differently with RanBP1. Mol. Cell. Biol. 17:5087-5096.[Abstract]
  22. 12
  23. Deng, T., J. Sharps, E. Fodor, and G. G. Brownlee. 2005. In vitro assembly of PB2 with a PB1-PA dimer supports a new model of assembly of influenza A virus polymerase subunits into a functional trimeric complex. J. Virol. 79:8669-8674.[Abstract/Free Full Text]
  24. 13
  25. Digard, P., V. C. Blok, and S. C. Inglis. 1989. Complex formation between influenza virus polymerase proteins expressed in Xenopus oocytes. Virology 171:162-169.[CrossRef][Medline]
  26. 14
  27. Engelhardt, O. G., and E. Fodor. 2006. Functional association between viral and cellular transcription during influenza virus infection. Rev. Med. Virol. 16:329-345.[CrossRef][Medline]
  28. 15
  29. Engelhardt, O. G., M. Smith, and E. Fodor. 2005. Association of the influenza A virus RNA-dependent RNA polymerase with cellular RNA polymerase II. J. Virol. 79:5812-5818.[Abstract/Free Full Text]
  30. 16
  31. Fodor, E., and G. G. Brownlee. 2002. Influenza virus replication, p. 1-29. In C. W. Potter (ed.), Influenza. Elsevier, Amsterdam, The Netherlands.
  32. 17
  33. Fodor, E., M. Crow, L. J. Mingay, T. Deng, J. Sharps, P. Fechter, and G. G. Brownlee. 2002. A single amino acid mutation in the PA subunit of the influenza virus RNA polymerase inhibits endonucleolytic cleavage of capped RNAs. J. Virol. 76:8989-9001.[Abstract/Free Full Text]
  34. 18
  35. Fodor, E., and M. Smith. 2004. The PA subunit is required for efficient nuclear accumulation of the PB1 subunit of the influenza A virus RNA polymerase complex. J. Virol. 78:9144-9153.[Abstract/Free Full Text]
  36. 19
  37. Gabriel, G., B. Dauber, T. Wolff, O. Planz, H. D. Klenk, and J. Stech. 2005. The viral polymerase mediates adaptation of an avian influenza virus to a mammalian host. Proc. Natl. Acad. Sci. USA 102:18590-18595.[Abstract/Free Full Text]
  38. 20
  39. Gorlich, D., and U. Kutay. 1999. Transport between the cell nucleus and the cytoplasm. Annu. Rev. Cell Dev. Biol. 15:607-660.[CrossRef][Medline]
  40. 21
  41. Harel, A., and D. J. Forbes. 2004. Importin beta: conducting a much larger cellular symphony. Mol. Cell 16:319-330.[Medline]
  42. 22
  43. Hatta, M., P. Gao, P. Halfmann, and Y. Kawaoka. 2001. Molecular basis for high virulence of Hong Kong H5N1 influenza A viruses. Science 293:1840-1842.[Abstract/Free Full Text]
  44. 23
  45. Jäkel, S., and D. Gorlich. 1998. Importin beta, transportin, RanBP5 and RanBP7 mediate nuclear import of ribosomal proteins in mammalian cells. EMBO J. 17:4491-4502.[CrossRef][Medline]
  46. 24
  47. Jäkel, S., J. M. Mingot, P. Schwarzmaier, E. Hartmann, and D. Görlich. 2002. Importins fulfill a dual function as nuclear import receptors and cytoplasmic chaperones for exposed basic domains. EMBO J. 21:377-386.[CrossRef][Medline]
  48. 25
  49. Jones, I. M., P. A. Reay, and K. L. Philpott. 1986. Nuclear location of all three influenza polymerase proteins and a nuclear signal in polymerase PB2. EMBO J. 5:2371-2376.[Medline]
  50. 26
  51. Kutay, U., E. Izaurralde, F. R. Bischoff, I. W. Mattaj, and D. Görlich. 1997. Dominant-negative mutants of importin-beta block multiple pathways of import and export through the nuclear pore complex. EMBO J. 16:1153-1163.[CrossRef][Medline]
  52. 27
  53. Lamb, R. A., and R. M. Krug. 2001. Orthomyxoviridae: the viruses and their replication, p. 1487-1530. In D. M. Knipe, P. M. Howley, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman, and S. E. Straus (ed.), Fields virology, 4th ed. Lippincott Williams & Wilkins, Philadelphia, Pa.
  54. 28
  55. Mattaj, I. W., and L. Englmeier. 1998. Nucleocytoplasmic transport: the soluble phase. Annu. Rev. Biochem. 67:265-306.[CrossRef][Medline]
  56. 29
  57. Melén, K., R. Fagerlund, J. Franke, M. Köhler, L. Kinnunen, and I. Julkunen. 2003. Importin alpha nuclear localization signal binding sites for STAT1, STAT2, and influenza A virus nucleoprotein. J. Biol. Chem. 278:28193-28200.[Abstract/Free Full Text]
  58. 30
  59. Mingot, J. M., S. Kostka, R. Kraft, E. Hartmann, and D. Görlich. 2001. Importin 13: a novel mediator of nuclear import and export. EMBO J. 20:3685-3694.[CrossRef][Medline]
  60. 31
  61. Mukaigawa, J., and D. P. Nayak. 1991. Two signals mediate nuclear localization of influenza virus (A/WSN/33) polymerase basic protein 2. J. Virol. 65:245-253.[Abstract/Free Full Text]
  62. 32
  63. Nakielny, S., and G. Dreyfuss. 1999. Transport of proteins and RNAs in and out of the nucleus. Cell 99:677-690.[CrossRef][Medline]
  64. 33
  65. Nath, S. T., and D. P. Nayak. 1990. Function of two discrete regions is required for nuclear localization of polymerase basic protein 1 of A/WSN/33 influenza virus (H1 N1). Mol. Cell. Biol. 10:4139-4145.[Abstract/Free Full Text]
  66. 34
  67. Neumann, G., G. G. Brownlee, E. Fodor, and Y. Kawaoka. 2004. Orthomyxovirus replication, transcription, and polyadenylation. Curr. Top. Microbiol. Immunol. 283:121-143.[Medline]
  68. 35
  69. Nieto, A., S. de la Luna, J. Barcéna, A. Portela, and J. Ortín. 1994. Complex structure of the nuclear translocation signal of influenza virus polymerase PA subunit. J. Gen. Virol. 75:29-36.[Abstract/Free Full Text]
  70. 36
  71. Nieto, A., S. de la Luna, J. Barcéna, A. Portela, J. Valcárcel, J. A. Melero, and J. Ortín. 1992. Nuclear transport of influenza virus polymerase PA protein. Virus Res. 24:65-75.[CrossRef][Medline]
  72. 37
  73. O'Neill, R. E., R. Jaskunas, G. Blobel, P. Palese, and J. Moroianu. 1995. Nuclear import of influenza virus RNA can be mediated by viral nucleoprotein and transport factors required for protein import. J. Biol. Chem. 270:22701-22704.[Abstract/Free Full Text]
  74. 38
  75. Palmeri, D., and M. H. Malim. 1999. Importin beta can mediate the nuclear import of an arginine-rich nuclear localization signal in the absence of importin alpha. Mol. Cell. Biol. 19:1218-1225.[Abstract/Free Full Text]
  76. 39
  77. Puig, O., F. Caspary, G. Rigaut, B. Rutz, E. Bouveret, E. Bragado-Nilsson, M. Wilm, and B. Séraphin. 2001. The tandem affinity purification (TAP) method: a general procedure of protein complex purification. Methods 24:218-229.[CrossRef][Medline]
  78. 40
  79. Smith, G. L., J. Z. Levin, P. Palese, and B. Moss. 1987. Synthesis and cellular location of the ten influenza polypeptides individually expressed by recombinant vaccinia viruses. Virology 160:336-345.[CrossRef][Medline]
  80. 41
  81. Subbarao, E. K., W. London, and B. R. Murphy. 1993. A single amino acid in the PB2 gene of influenza A virus is a determinant of host range. J. Virol. 67:1761-1764.[Abstract/Free Full Text]
  82. 42
  83. Truant, R., and B. R. Cullen. 1999. The arginine-rich domains present in human immunodeficiency virus type 1 Tat and Rev function as direct importin beta-dependent nuclear localization signals. Mol. Cell. Biol. 19:1210-1217.[Abstract/Free Full Text]
  84. 43
  85. Vreede, F. T., T. E. Jung, and G. G. Brownlee. 2004. Model suggesting that replication of influenza virus is regulated by stabilization of replicative intermediates. J. Virol. 78:9568-9572.[Abstract/Free Full Text]
  86. 44
  87. Yaseen, N. R., and G. Blobel. 1997. Cloning and characterization of human karyopherin ß3. Proc. Natl. Acad. Sci. USA 94:4451-4456.[Abstract/Free Full Text]


Journal of Virology, December 2006, p. 11911-11919, Vol. 80, No. 24
0022-538X/06/$08.00+0     doi:10.1128/JVI.01565-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Wang, P., Song, W., Mok, B. W.-Y., Zhao, P., Qin, K., Lai, A., Smith, G. J. D., Zhang, J., Lin, T., Guan, Y., Chen, H. (2009). Nuclear Factor 90 Negatively Regulates Influenza Virus Replication by Interacting with Viral Nucleoprotein. J. Virol. 83: 7850-7861 [Abstract] [Full Text]  
  • Rolling, T., Koerner, I., Zimmermann, P., Holz, K., Haller, O., Staeheli, P., Kochs, G. (2009). Adaptive Mutations Resulting in Enhanced Polymerase Activity Contribute to High Virulence of Influenza A Virus in Mice. J. Virol. 83: 6673-6680 [Abstract] [Full Text]  
  • Li, Z., Watanabe, T., Hatta, M., Watanabe, S., Nanbo, A., Ozawa, M., Kakugawa, S., Shimojima, M., Yamada, S., Neumann, G., Kawaoka, Y. (2009). Mutational Analysis of Conserved Amino Acids in the Influenza A Virus Nucleoprotein. J. Virol. 83: 4153-4162 [Abstract] [Full Text]  
  • Hemerka, J. N., Wang, D., Weng, Y., Lu, W., Kaushik, R. S., Jin, J., Harmon, A. F., Li, F. (2009). Detection and Characterization of Influenza A Virus PA-PB2 Interaction through a Bimolecular Fluorescence Complementation Assay. J. Virol. 83: 3944-3955 [Abstract] [Full Text]  
  • Manzoor, R., Sakoda, Y., Nomura, N., Tsuda, Y., Ozaki, H., Okamatsu, M., Kida, H. (2009). PB2 Protein of a Highly Pathogenic Avian Influenza Virus Strain A/chicken/Yamaguchi/7/2004 (H5N1) Determines Its Replication Potential in Pigs. J. Virol. 83: 1572-1578 [Abstract] [Full Text]  
  • Rameix-Welti, M.-A., Tomoiu, A., Dos Santos Afonso, E., van der Werf, S., Naffakh, N. (2009). Avian Influenza A Virus Polymerase Association with Nucleoprotein, but Not Polymerase Assembly, Is Impaired in Human Cells during the Course of Infection. J. Virol. 83: 1320-1331 [Abstract] [Full Text]  
  • Bradel-Tretheway, B. G., Kelley, Z., Chakraborty-Sett, S., Takimoto, T., Kim, B., Dewhurst, S. (2008). The human H5N1 influenza A virus polymerase complex is active in vitro over a broad range of temperatures, in contrast to the WSN complex, and this property can be attributed to the PB2 subunit. J. Gen. Virol. 89: 2923-2932 [Abstract] [Full Text]  
  • Jorba, N., Area, E., Ortin, J. (2008). Oligomerization of the influenza virus polymerase complex in vivo. J. Gen. Virol. 89: 520-524 [Abstract] [Full Text]  
  • Naito, T., Kiyasu, Y., Sugiyama, K., Kimura, A., Nakano, R., Matsukage, A., Nagata, K. (2007). An influenza virus replicon system in yeast identified Tat-SF1 as a stimulatory host factor for viral RNA synthesis. Proc. Natl. Acad. Sci. USA 104: 18235-18240 [Abstract] [Full Text]  
  • Gabriel, G., Abram, M., Keiner, B., Wagner, R., Klenk, H.-D., Stech, J. (2007). Differential Polymerase Activity in Avian and Mammalian Cells Determines Host Range of Influenza Virus. J. Virol. 81: 9601-9604 [Abstract] [Full Text]  
  • Naito, T., Momose, F., Kawaguchi, A., Nagata, K. (2007). Involvement of Hsp90 in Assembly and Nuclear Import of Influenza Virus RNA Polymerase Subunits. J. Virol. 81: 1339-1349 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Deng, T.
Right arrow Articles by Fodor, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Deng, T.
Right arrow Articles by Fodor, E.