This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schaap-Nutt, A.
Right arrow Articles by Arvin, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schaap-Nutt, A.
Right arrow Articles by Arvin, A. M.

 Previous Article  |  Next Article 

Journal of Virology, December 2006, p. 11806-11816, Vol. 80, No. 23
0022-538X/06/$08.00+0     doi:10.1128/JVI.00466-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

ORF66 Protein Kinase Function Is Required for T-Cell Tropism of Varicella-Zoster Virus In Vivo{triangledown}

Anne Schaap-Nutt,* Marvin Sommer, Xibing Che, Leigh Zerboni, and Ann M. Arvin

Department of Pediatrics, Stanford University School of Medicine, Stanford, California

Received 6 March 2006/ Accepted 5 September 2006


arrow
ABSTRACT
 
Several functions have been attributed to the serine/threonine protein kinase encoded by open reading frame 66 (ORF66) of varicella-zoster virus (VZV), including modulation of the apoptosis and interferon pathways, down-regulation of major histocompatibility complex class I cell surface expression, and regulation of IE62 localization. The amino acid sequence of the ORF66 protein contains a recognizable conserved kinase domain. Point mutations were introduced into conserved protein kinase motifs to evaluate their importance to ORF66 protein functions. Two substitution mutants were generated, including a G102A substitution, which blocked autophosphorylation and altered IE62 localization, and an S250P substitution, which had no effect on either autophosphorylation or IE62 localization. Both kinase domain mutants grew to titers equivalent to recombinant parent Oka (pOka) in vitro. pOka66G102A had slightly reduced growth in skin, which was comparable to the reduction observed when ORF66 translation was prevented by stop codon insertions in pOka66S. In contrast, infection of T-cell xenografts with pOka66G102A was associated with a significant decrease in infectious virus production equivalent to the impaired T-cell tropism found with pOka66S infection of T-cell xenografts in vivo. Disrupting kinase activity with the G102A mutation did not alter IE62 cytoplasmic localization in VZV-infected T cells, suggesting that decreased T-cell tropism is due to other ORF66 protein functions. The G102A mutation reduced the antiapoptotic effects of VZV infection of T cells. These experiments indicate that the T-cell tropism of VZV depends upon intact ORF66 protein kinase function.


arrow
INTRODUCTION
 
Varicella-zoster virus (VZV) is a human alphaherpesvirus that causes chickenpox, or varicella. Infection begins with inoculation of respiratory mucosa, followed by cell-associated viremia and a vesicular rash that develops 10 to 21 days after exposure (2). T cells appear to be a major target cell for VZV viremia and have the capacity to transport infectious virus through the circulation, resulting in the formation of typical cutaneous lesions in human skin xenografts in the severe combined immunodeficiency (SCID)-hu mouse model in vivo (23-25, 30). VZV infection of T cells has been associated with robust virion production, modulation of the apoptosis and interferon pathways, and decreased cell surface expression of major histocompatibility (MHC) class I (1, 40).

The VZV serine/threonine protein kinases encoded by open reading frame 47 (ORF47) and ORF66 are essential for the efficient replication of VZV in T cells in the SCID-hu mouse model (31, 40). Experiments with pOka66S, a parent Oka (pOka) ORF66 stop codon mutant, showed only minimal effects of blocking ORF66 protein expression on growth in vitro and on skin infection but a marked reduction in both growth and virion formation in T cells (40). ORF47 kinase-deficient mutants, on the other hand, have severely impaired virion production, despite normal plaque formation, in cultured cells and do not replicate in T cells (4, 5). These observations with ORF47 and ORF66 mutants support the concept that VZV infection of T cells, in contrast to skin, requires efficient virion formation and egress for transfer to uninfected cells because VZV-infected T cells do not undergo cell fusion.

Our goal was to further examine the contribution of ORF66 protein to VZV replication in T cells by evaluating whether kinase function of the ORF66 protein was required. Sequence analysis has revealed that VZV ORF66 protein is highly homologous to serine/threonine protein kinases in other alphaherpesviruses, which can be assigned to one of two distinct families based on sequence homology to either the US3 or UL13 gene products of herpes simplex virus type 1 (HSV-1). ORF66 is related to US3, which has homologues only in alphaherpesviruses (32, 44). By analogy with HSV US3, ORF66 protein probably phosphorylates a number of viral and cellular proteins; however, whether the two alphaherpesvirus kinases have similar phosphorylation targets is not yet known. Despite this uncertainty, it appears that ORF66 protein and US3 share some functions, such as the ability to block apoptosis of infected cells in certain cell types (34, 38, 40).

IE62, the major VZV gene transactivator, is phosphorylated both by cellular kinases and by the viral protein kinases encoded by ORF47 and ORF66 (10, 19-21, 33, 36). IE62 is primarily nuclear within VZV-infected cells at early stages of infection and then becomes predominantly cytoplasmic at later times when it is incorporated into the tegument of purified VZ virions (20, 21). IE62 remains completely nuclear in melanoma cells infected with either vOka or pOka recombinant viruses that do not express ORF66 protein, indicating that it is required for late cytoplasmic localization of IE62 (20, 40). This exclusively nuclear localization of IE62 is also observed in transient transfections with plasmids expressing ORF66 protein with mutations in the kinase domain, indicating that this effect is dependent on ORF66 kinase activity (21). ORF66 protein has recently been shown to directly phosphorylate IE62 near its nuclear localization signal (NLS), causing the nuclear exclusion of IE62 likely by masking the NLS (10).

Serine/threonine protein kinases share highly conserved, recognizable motifs within their kinase domains, which fold into topologically similar three-dimensional structures (14, 15, 22). The consensus kinase domain of the ORF66 protein, which is predicted to span amino acids 93 to 378, contains sequences matching these 12 consensus eukaryotic cellular serine/threonine kinase subdomains (14, 15, 35, 44). We used this information to design targeted mutations in ORF66, with the goal of evaluating the importance of these putative kinase motifs for ORF66 protein function when changes in the ORF66 sequence were introduced into the VZV genome by cosmid mutagenesis. The effects of these ORF66 mutations on VZV replication were assessed in vitro, and mutants were evaluated for their impact on the pathogenesis of VZV infection in T cells and skin in vivo in the SCID-hu mouse model.


arrow
MATERIALS AND METHODS
 
Generation of pOka recombinant viruses with targeted changes in the predicted serine/threonine kinase domain of ORF66. Recombinant viruses were generated using cosmids derived from pOka (37). The entire pOka genome is contained in four overlapping SuperCos 1 cosmid vectors (Stratagene, La Jolla, CA) designated pvFsp73 (pOka nucleotides [nt] 1 to 33128; Dumas nt 1 to 33211), pvSpe14 (pOka nt 21796 to 61868; Dumas nt 21875 to 62008), pvPme2 (pOka nt 53756 to 96035; Dumas nt 53877 to 96188), and pvSpe23 (pOka nt 94055 to 125123; Dumas nt 94208 to 124884). ORF66 is located in the unique short region in the cosmid pvSpe23. In order to make mutations in ORF66, the cosmid pvSpe23{Delta}Avr was digested with SacI, and the 6-kb SacI fragment was inserted into the pBluescript KS(–) plasmid vector (Stratagene) to make pSac6A, containing ORFs 64 to 69 (40).

Two different methods were employed to introduce single amino acid substitutions into the ORF66 kinase domain. Three individual point mutations were made using the QuikChange site-directed mutagenesis kit XL (Stratagene): K122N, D224N, and P251S. These mutations were made using the oligonucleotides 5'-CATGTGGTCATTAACGCGGTCAACGTC-3', 5'-GTTTGTGTGGGAAACTTTGGAGCAGCG-3', and 5'-CGCCACAAACTCTTCTGAGTTATTGGCTAGAG-3', respectively, and their reverse complements. Six other single amino acid substitutions were made by PCR mutagenesis using two rounds of PCR per mutation as described previously (3). In the first PCR, a 5'-outside primer (5'-CGTTTAAAGCGCGTTTTC-3') was used in combination with the first mutagenic primer for each mutation. In parallel, another PCR was performed with a 3'-outside primer (5'-GCCACCGTATCCGCGTAT-3') in combination with the second mutagenic primer. The two resulting PCR products divided the 2-kb AvrII-PmlI fragment into two smaller fragments. The mutagenic primers were designed according to the following principle: 5'-10-bp complete sequence alignment-mutation-20-bp complete sequence alignment-3'. For example, the two mutagenic primers used to create the mutation G102A (replacement of Gly102 with Ala) read as follows: G102A-A, 5'-ACCTTCCGCC[substitution of C to G]CTGGTGTAAACGTTTTTAAT-3'; and G102A-B, 5'-TTTACACCAG[substitution of G to C]GGCGGAAGGTTTTGCGTTTG-3'. The primers used for the other mutations were 5'-TTGACCCGCTCTAATGACCACATGTTCACAT-3' and 5'-GTGGTCATTAGAGCGGGTCAACGTCAAGGAA-3' for K122R, 5'-GATTTTATATTACGGTGAATAATACTGTTAT-3' and 5'-TATTCACCGTAATATAAAATCTGAAAATATA-3' for D206N, 5'-TAAATATATTGTCAGATTTTATATCACGGTG-3' and 5'-TAAAATCTGACAATATATTTATTAACCACC-3' for E210D, 5'-GCTCCAAAGTTTCCCACACAAACATCACCTG-3' and 5'-TTGTGTGGGAAACTTTGGAGCAGCGTGTTTC-3' for D224N, and 5'-AACTCAGGAGGGTTTGTGGCGATTGTTCCAG-3' and 5'-CGCCACAAACCCTCCTGAGTTATTGGCTAGA-3' for S250P.

For the second PCR round, the two PCR products resulting from the first PCRs were gel purified and combined. The second PCR was performed with the outside primers only. The mutagenic primers self-prime due to a 20-bp overlap at the site of the mutation in the two PCR fragments generated in the first PCR round. The second PCR round resulted in a 2-kb fragment, which was cloned into pCR4-Topo (Invitrogen, Carlsbad, CA) and sequenced to verify the mutation. Sequence analysis was done at the Stanford University Protein and Nucleic Acid Facility. Each ORF66-Topo plasmid, as well as the plasmid pSac6A containing ORFs 64 to 69, was digested with AvrII and PmlI, and the fragment containing the mutation was ligated into pSac6A. The AvrII-SgrAI fragments from each pSac6A plasmid containing an ORF66 kinase point mutation were then excised and ligated back into the cosmid pvSpe23{Delta}Avr.

Repaired cosmids were constructed by cloning the intact ORF66 gene, including the putative promoter region and the polyadenylation site, into a unique AvrII restriction site at nucleotide 112,956 (Dumas 112,854) in the pvSpe23{Delta}Avr cosmid containing each point mutation. The ORF66 gene was amplified by PCR using the oligonucleotides 5'-GCCCTCTTATCCTAGGATCAC-3' and 5'-ACAATCCTAGGAAAATGATCCC-3' (pOka nt 113,022 and 114,499; Dumas nt 112,919 and 114,396) to introduce AvrII sites at each end. The amplified ORF66 gene was ligated into the mutated pvSpe23{Delta}Avr cosmid at the AvrII site, and clones containing ORF66 in the native, 5'-to-3' orientation (upper strand) were selected.

Transfection, virus isolation, and growth kinetics. Recombinant viruses were isolated by transfection of human melanoma (MeWo) cells with mutated pvSpe23{Delta}Avr cosmid and the three intact cosmids, pFsp73, pSpe14, and pPme2, as described previously (27, 43). Melanoma cells were maintained in tissue culture medium (MEM; Mediatech, Washington, DC) supplemented with 10% fetal calf serum (Gemini Bio-Products, Woodland, CA), nonessential amino acids, and antibiotics. All mutations were sequenced to verify substitutions. DNA was isolated from melanoma cells with DNAzol reagent (GIBCO/BRL, Grand Island, NY) and from implant tissues using the DNeasy tissue kit (QIAGEN, Chatsworth, CA). Solubilized DNA was used as a template for PCR primers that annealed in the intergenic regions upstream and downstream of ORF66. PCR was performed using the Elongase enzyme mix (GIBCO). PCR products were cloned into pCR4-TOPO (Invitrogen, Carlsbad, CA) and sequenced by the Stanford Protein and Nucleic Acid Facility or Sequetech Corp. (Mountain View, CA). Sequencing reactions were primed using the M13 primers contained in the PCR4-TOPO vector and custom primers within ORF66.

Replication of pOka and pOka ORF66 mutants was assessed by infectious focus assay. Cells from three replicate wells were trypsinized on days 1 to 6 after inoculation, and the number of infectious foci was determined by titration on melanoma cell monolayers at each time point as described elsewhere (30, 31). Statistical comparisons were done using the Student's t test.

Immunoblot analysis of protein expression. Whole-cell lysates were prepared by lysing infected or uninfected melanoma cells with 1 ml radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris [pH 8], 150 mM NaCl, 1% IGEPAL CA-360 [Sigma, St. Louis, MO], 0.1% sodium dodecyl sulfate [SDS; Bio-Rad, Hercules, CA], 0.5% deoxycholic acid [Sigma], Complete Mini protease inhibitor tablet [Roche]) per T75 flask and sonicating. Cytoplasmic lysates were prepared by lysing cells in hypotonic buffer (20 mM HEPES, 10 mM KCl, 1.5 mM MgCl2, 1 mM EDTA, 10% glycerol) containing protease inhibitors, 1 mM Na3VO4, 1 mM dithiothreitol (DTT), and 50 mM NaF. After 15 min on ice, IGEPAL CA-360 was added to a final concentration of 0.2% and the lysate was vortexed and centrifuged. The pellet was washed twice with hypotonic buffer containing 0.4% IGEPAL CA-360 and used for nuclear fraction collection. The nuclear pellet was lysed by incubation for 30 min on ice in hypertonic buffer (20 mM HEPES, 450 mM NaCl, 10 mM KCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.2% IGEPAL CA-360, 20% glycerol, protease inhibitors, 1 mM Na3VO4, 1 mM DTT, and 50 mM NaF), followed by vortexing and centrifuging.

Lysates were boiled in sample buffer and separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) in 10% gels. Proteins were transferred to Immobilon-P (polyvinylidene difluoride) membranes (Millipore, Bedford, MA). The amount of total protein in 15 µl of each sample was equivalent as verified by Bradford assay (Bio-Rad) and amido black stain. Immunoblotting was performed using rabbit polyclonal antibody to ORF66 protein (40), rabbit polyclonal antibody to IE62 (kindly provided by Paul Kinchington, University of Pittsburgh), and mouse monoclonal antibody to {alpha}-tubulin (Sigma).

Infection of human xenografts in SCID-hu mice. T-cell or skin xenografts were engrafted in male homozygous C.B-17scid/scid mice (30) by using human fetal tissues obtained with informed consent according to federal and state regulations. Animal use was approved by the Stanford University Administrative Panel on Laboratory Animal Care. VZV recombinant viruses were isolated in human melanoma cells, passed three times onto human embryonic lung (HEL) fibroblasts, and stored at –80°C in tissue culture medium supplemented with 10% fetal calf serum, antibiotics, and 10% dimethyl sulfoxide. Infected cells were injected into the implants, and infectious virus titers were determined for each inoculum at the time the implants were injected. Skin xenografts were harvested at 10 and 18 days after inoculation. T-cell xenografts were harvested at 10 to 14 and 18 to 21 days after inoculation or mock infection. Tissues were analyzed by infectious focus assay and PCR/sequencing to verify expected mutations.

Flow cytometric detection of caspase-3 activation. Human T cells were isolated from tonsil tissue according to a protocol approved by the Stanford University Committee for Research Involving Human Subjects. The tonsils were dissociated to single cells and purified to >95% T cells as previously described (24). T cells were cocultured with virus-infected HEL fibroblast monolayers and harvested 48 and 72 h after infection. T cells were stained with fluorescein isothiocyanate (FITC)-conjugated monoclonal rabbit anti-active caspase-3 antibody according to the manufacturer's protocol (Apoptosis kit 1; BD Biosciences, San Diego, CA). To identify VZV-infected tonsil T cells, cells were stained with monoclonal antibodies specific for human CD3 (clone S4.1, conjugated to TRI-COLOR; Caltag) and VZV-immune or non-VZV-immune polyclonal human serum (immunoglobulin G [IgG] purified) along with Alexa Fluor 647-conjugated goat anti-human IgG (H+L; Molecular Probes, Eugene, OR).

Localization of VZV proteins by confocal microscopy. At 24 to 72 h after infection, VZV-infected melanoma cell monolayers were fixed with 2% paraformaldehyde, permeabilized with 0.1% Triton X-100, and washed with phosphate-buffered saline (PBS, 0.01 M, pH 7.4). Human tonsil T cells were infected by coculture with infected fibroblasts for 72 h, washed twice with PBS, cytospun onto poly-L-lysine-coated slides, and fixed/permeabilized using the same method.

Plasmids containing the ORF66 gene were generated by PCR amplifying the wild-type or mutated ORF66 coding region using oligonucleotides 5'-AAGTATAATGGACGACGTTGATGC-3' and 5'-CTTAATGAATTTTAATCTCCAACT-3' and inserting the resulting PCR product into TA cloning sites of the pCR3.1 plasmid vector (Invitrogen) to make the plasmids pCR66-wt, pCR66-K122R, pCR66-D206N, pCR66-E210D, pCR66-D224N, and pCR66-P251S. Subconfluent melanoma cell monolayers were cotransfected with the pCMVIE62 plasmid (kindly provided by John Hay, State University of New York at Buffalo) and each pCR66 plasmid at a ratio of 3:1 using Lipofectamine 2000 according to the manufacturer's instructions (Invitrogen). Transiently transfected cells were fixed and permeabilized for confocal microscopy at 48 h posttransfection as described above for infected cell monolayers.

Both melanoma and T cells were blocked overnight at 4°C with PBS containing 0.2% bovine serum albumin and 10% normal goat serum. After washing with PBS, cells were incubated 1 h at 37°C with primary antibodies. The antibodies used were murine anti-IE62 monoclonal antibody (Chemicon, Temecula, CA), murine anti-gE monoclonal antibody (Chemicon), rabbit polyclonal anti-ORF66 IgG (40), and murine anti-human CD3 antibody (PharMingen). Following three 5-min washes with PBS, the secondary antibodies, FITC-coupled anti-mouse and Texas Red-coupled anti-rabbit (Jackson ImmunoResearch), were added for 45 min at 37°C and shielded from light. Coverslips were mounted with Vectashield containing 4',6'-diamidino-2-phenylindole (DAPI) nuclear stain (Vector Laboratories) and stored in the dark. Imaging was performed at the Cell Sciences Imaging Facility (Stanford, CA) with a Zeiss LSM 510 confocal laser scanning microscope (Carl Zeiss).

Transmission electron microscopy. HEL fibroblasts were infected with 1,000 CFU of each virus and grown on glass coverslips for 48 h. Cells were washed in PBS and fixed in 2% glutaraldehyde-0.1 M PBS (pH 7.0) for 35 min. Samples were postfixed in osmium tetroxide-PBS (Polysciences, Inc., Warrington, PA) for 1 h and stained with 0.25% uranyl acetate (Polysciences) overnight. After dehydration with a graded series of alcohol and propylene oxide washes, samples were embedded by placing gelatin capsules filled with resin on top of the coverslip and then sprayed with liquid nitrogen. Thin sections were collected on copper grids, stained with uranyl acetate (Polysciences) and lead citrate, and viewed using a Phillips CM-12 transmission electron microscope.

Northern blot analysis of ORF66 transcripts. T75 flasks of melanoma cells were infected with pOka or pOka66S. Total single-stranded RNA was extracted with TRI reagent (Invitrogen) at 48 h postinfection. The RNA was separated by electrophoresis in formamide-formaldehyde denaturing 1.1% agarose gels in morpholinepropanesulfonic acid buffer and transferred to a positively charged nylon membrane (Roche). RNA detection on membranes was done using nonradioactive digoxigenin-labeled riboprobes; the membranes were then reacted with antidigoxigenin-alkaline phosphatase Fab fragments and detected with CSPD chemiluminescent substrate (Roche). Riboprobes to detect ORF66 transcripts were made by linearizing a pCR4-TOPO vector (Invitrogen) containing the ORF66 sequence by digestion with PstI and using T7 RNA polymerase (Ambion, Austin, TX) to synthesize positive-strand RNA-specific probes.

Kinase assays to assess ORF66 phosphorylation. Infected and uninfected melanoma cells were lysed at 48 h postinfection with RIPA buffer containing protease inhibitors, 1 mM Na3VO4, 1 mM DTT, and 50 mM NaF and sonicated. Protein A/G PLUS-agarose beads (Santa Cruz Biotechnology) were incubated overnight at 4°C with either polyclonal rabbit anti-ORF66 IgG or rabbit preimmune IgG. The beads were washed with HNTG buffer (20 mM Tris, pH 8.0, 150 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5% IGEPAL CA-360) and incubated with cell lysate for 3 h at 4°C. The beads were then washed three times in HNTG buffer, followed by a single wash in kinase buffer (50 mM Tris/HCl [pH 9], 20 mM MgCl2, 0.1% IGEPAL CA-360, 1 mM DTT). Beads were collected, and kinase buffer was replaced with 30 µl of kinase reaction buffer (998 µl of kinase buffer, 2 µl of 10 mM cold ATP, and 24 µl of [{gamma}-32P]ATP). Following 30 min of incubation at 30°C, samples were boiled with sample buffer and separated by SDS-PAGE. Gels were dried onto chromatography paper (Whatman, Maidstone, England), and photographic film (Kodak) was used to detect the radioactive signals associated with the immunoprecipitated proteins.


arrow
RESULTS
 
Replication of pOka recombinants with mutations in the ORF66 kinase domain. Eight individual point mutations were introduced into ORF66 that were designed to disrupt 5 of the 12 conserved kinase subdomains in the ORF66 protein (Fig. 1). Three types of kinase motifs were targeted for mutagenesis: (i) those involved in ATP binding within subdomains I and II, (ii) the catalytic domains located in the central core of the kinase in subdomains VIb and VII, and (iii) the APE motif in subdomain VIII.


Figure 1
View larger version (47K):
[in this window]
[in a new window]
 
FIG. 1. ORF66 kinase domain mutations and transfection results. (A) Multiple amino acid sequence alignment of catalytic domain residues of ORF66 and its alphaherpesvirus homologues. Residues mutated in ORF66 for these experiments are shown in black boxes with white lettering. The dots represent sequence not shown between the aligned sequences. Roman numerals above the sequence alignment refer to the five conserved protein kinase subdomains in which mutations were introduced in this study. Lines between ORF66 and homologous residues indicate amino acids that are identical among all of these genes, while stars indicate similar amino acids. (B) Locations of each mutation within the ORF66 kinase domain. Transfection results with cosmids carrying each single amino acid substitution are listed in the columns to the right of the diagram. In the first column, the number of transfections (TF) that yielded infectious virus for each mutant is shown, out of the total number of transfections that were performed with that mutated Spe23{Delta}Avr cosmid and yielded the control pOka virus. The second column shows the number of positive transfections out of the total number of transfections done with the mutated cosmid that contained a rescue insertion of intact ORF66.

ATP binding/phosphate anchor residue mutations. The first mutation, G102A, altered one of the conserved glycine residues within the ATP-binding motif GxGxxGxV in subdomain I, near the amino terminus of the catalytic domain (Fig. 1B). This glycine-rich loop has been shown in cellular kinases to anchor the ATP (22). The second Gly residue of this motif was shown to be the most critical for ATP binding in cyclic AMP-dependent protein kinase and is conserved in greater than 99% of known protein kinases (16). The ORF66 sequence varies slightly from the consensus (TPG102AEGFA) and lacks the first Gly residue, but this residue is conserved among the other alphaherpesvirus protein kinases. The virus designated pOka66G102A was generated containing this mutation (Fig. 1B).

Two mutations were made to substitute either asparagine (K122N) or arginine (K122R) in the subdomain II motif [AVI]xKx for the invariant catalytic lysine at position 122. This lysine helps anchor and orient ATP through interactions with the {alpha}- and ß-phosphates (14). Mutation of this residue has consistently created kinase-dead variants of other protein kinases, including US3 of HSV (6, 7, 15, 18, 28). pOkaK122N and pOkaK122R viruses were recovered in only 2 of 12 and 1 of 7 transfections, respectively (Fig. 1B).

Central core catalytic domain mutations. Three mutations, D206N, E210D, and D224N, were made in the central core of the kinase domain, beginning with subdomain VI (Fig. 1B). This region is the most extensively conserved and contains a number of invariant amino acids essential for catalytic function. The motif HRD[LIVMFY]KxxN (residues 203 to 213 of VZV) is consistent with the consensus pattern of the serine/threonine kinase catalytic loop, where the aspartic acid residue (D206) is likely the catalytic base that accepts a proton from the substrate hydroxyl group during phosphotransfer (14, 26). Virus was recovered from only one of seven transfections with cosmids containing the D206N mutation and from only two of eight transfections with cosmids containing the E210D mutation.

The mutation D224N was designed to disrupt the catalytic motif comprised of the DFG triplet in subdomain VII, which is the most highly conserved short kinase sequence and is essential for ATP binding. When the invariant Asp224 was changed to Asn in ORF66, recombinant pOka could not be recovered in 12 independent transfections (Fig. 1B). Insertion of an intact copy of ORF66 at the nonnative AvrII site did not generate repaired virus in three transfections (Fig. 1B).

APE motif mutations. Two mutations, S250P and P251S, were made in the highly conserved APE motif in subdomain VIII (Fig. 1B). The conserved stretch between residues 240 and 255 (subdomains VII and VIII) distinguishes serine/threonine kinases from tyrosine kinases (42). Substrate recognition is often activated by phosphorylation of this region, and the proline residue at position 251 is a key protein kinase catalytic domain indicator (15). This motif is SPE in ORF66, which also fits the consensus. Although transfections yielded virus containing the S250P mutation in ORF66, which was designated pOka66S250P, in two of three transfections, the P251S mutation was only recovered in two of eight cosmid transfections (Fig. 1B).

Effect of kinase mutant ORF66 proteins on the localization of IE62. IE62 has been shown to localize primarily to the nuclei of cells transfected with an IE62-expressing plasmid (pCMVIE62), but it translocates to the cytoplasm in the majority of cells following phosphorylation at Ser686 by the ORF66 kinase (10, 21). Cotransfection of plasmids expressing IE62 and ORF66 wild-type and mutant proteins was thus used to evaluate the activity of ORF66 protein expressed from these plasmids (Fig. 2). As expected, most cells transfected with IE62 plasmid alone had exclusively nuclear IE62 localization (approximately 97% of cells with detectable IE62). Cotransfection with a plasmid expressing wild-type ORF66 reversed the expression pattern of IE62, with approximately 88% of the cells expressing ORF66 protein having cytoplasmic, rather than exclusively nuclear, IE62, demonstrating that functional ORF66 protein was expressed from this plasmid. Cotransfection of IE62-expressing plasmids with plasmids expressing ORF66 protein carrying each of the kinase mutations, K122R, D206N, E210D, D224N, and P251S, yielded exclusively nuclear IE62 in 83 to 100% of the cells in which both proteins were detectable, indicating that these mutated forms of the ORF66 protein abrogated its kinase function.


Figure 2
View larger version (32K):
[in this window]
[in a new window]
 
FIG. 2. Effects of ORF66 wild-type and mutated proteins on nuclear localization of IE62. Melanoma cells were transfected with pCMV62, expressing IE62, either alone (top row) or in combination with a threefold excess of ORF66 protein-expressing plasmid (pCR66-wt, pCR66-K122R, pCR66-D206N, pCR66-E210D, pCR66-D224N, or pCR66-P251S). Cells were fixed 48 h after transfection and analyzed by confocal microscopy for expression of ORF66 and IE62 proteins. IE62 was detected with a secondary FITC-conjugated antibody (green), and ORF66 protein was detected with a secondary Texas Red-conjugated antibody (red). Images of each row were merged with DAPI nuclear stain (third panel). Colocalizations of ORF66 kinase and IE62 appear yellow. Bars, 20 µm.

Northern blot analysis of ORF66 transcripts. The discovery of short and long isoforms of US3 in pseudorabies virus (PRV) and, recently, in HSV-1, due to alternative splicing and the presence of multiple ATG translation initiation codons, prompted investigation of the possibility that truncated forms of ORF66 protein could be present in infected cells (39, 46). Although ORF66 protein was not detected in the pOka66S mutant and short forms have not been seen by Western blotting, it remains possible that some ORF66 protein is made in this mutant or that a short form exists and is essential to VZV replication. Because PRV and HSV-1 short transcripts of US3 are detectable by Northern blotting, ORF66 transcripts were also examined in infected melanoma cells collected at 48 h postinfection and analyzed by Northern blotting with an ORF66-specific probe. No transcripts were detected from mock-infected melanoma cells (data not shown). The ORF66 probe showed hybridization with the 1.4-kb and 2.5-kb forms of ORF66 mRNA (data not shown). The 1.4-kb RNA is consistent with the expected size of ORF66 transcripts, and the other approximately 2.5-kb RNA is a read-through mRNA originating from the ORF66 start site and terminating at the ORF67 stop site (data not shown). Unlike US3 in HSV and PRV, in which only the read-through transcript (coterminal with US4) is present, ORF66 is followed by its own polyadenylation signal (AATAAA), located 18 bp downstream from the TAA termination codon at nucleotide 114,236 (9). No truncated transcripts of ORF66 were detected.

Evaluation of the effects of ORF66 kinase mutations G102A and S250P in melanoma cells in vitro. Prior to evaluation in the SCID-hu skin and T-cell xenografts, two of the mutants were selected for further evaluation of growth and kinase function. Viruses containing the two substitution mutations G102A and S250P were characterized for growth characteristics and evidence of effects on kinase activity in vitro. The growth kinetics of pOka66G102A and pOka66S250P, with mutations in the ATP-binding motif and in the APE motif, respectively, were equivalent to pOka over a 6-day interval (Fig. 3). The pOka, pOka66G102A, and pOka66S250P viruses grew to approximately 3 x 105 infectious foci/ml. Plaque sizes were not significantly different between the ORF66 mutants and pOka; the mean and standard errors were as follows: pOka, 0.90 ± 0.10 mm; pOka66S, 0.87 ± 0.13 mm (40); pOka66G102A, 0.84 ± 0.10 mm; pOka66S250P, 1.01 ± 0.17 mm (data not shown).


Figure 3
View larger version (23K):
[in this window]
[in a new window]
 
FIG. 3. Effects of ORF66 mutations on VZV growth in vitro. Melanoma cells were inoculated on day 0 with 1 x 103 CFU of pOka or pOka ORF66 mutants. Two pOka66G102A and pOka66S250P mutant viruses were generated and tested independently. Aliquots were harvested daily for 6 days, and the number of infectious foci was determined by titration on melanoma cell monolayers. Each time point represents the mean of results for at least three wells. The x axis shows the days after inoculation when infected cell monolayers were harvested, and the y axis shows infectious foci per milliliter by infectious focus assay. One asterisk indicates that titers were significantly different from pOka (P < 0.05) at the same time point, while two asterisks indicate a difference with a P value of <0.001.

The effects of the G102A and S250P mutations on cellular expression and localization of the ORF66 protein and IE62 were examined by confocal microscopy at 48 and 72 h after infection with pOka, pOka66S, pOka66G102A, and pOka66S250P (Fig. 4A). ORF66 protein has previously been shown to localize to both nuclei and the cytoplasm of infected cells in vitro (19, 44). No differences were observed in the localization of the ORF66 protein in cells infected with pOka, pOka66G102A, or pOka66S250P at either time point. As expected, ORF66 protein was not detected in the pOka66S-infected cell control. By 72 h postinfection, both ORF66 protein and IE62 were detected in the nuclei and in the cytoplasm of pOka-infected cells, and IE62 was strictly nuclear in the pOka66S-infected cells (40). In cells infected with pOka66G102A, IE62 was also completely nuclear throughout the 72-h course of infection, similar to pOka66S. However, the mutation of ORF66 residue S250 in the pOka66S250P virus did not affect IE62 localization.


Figure 4
View larger version (54K):
[in this window]
[in a new window]
 
FIG. 4. Localization of ORF66 and IE62 proteins in melanoma cells. (A) pOka and pOka ORF66 mutants were analyzed by confocal microscopy for expression of ORF66 and IE62 proteins. Melanoma cells were infected with 1 x 103 CFU of pOka, pOka66S, pOka66G102A, or pOka66S250P and fixed after 72 h. IE62 was detected with a secondary FITC-conjugated antibody (green), and ORF66 protein was detected with a secondary Texas Red-conjugated antibody (red). Images of each row were merged with DAPI nuclear stain (third panel). Colocalizations of ORF66 kinase and IE62 appear yellow. Bar, 10 µm. (B) Whole-cell lysate (left panels), cytoplasmic lysate (middle panels), and soluble nuclear lysate (right panels) were prepared from melanoma cells that were uninfected (lane 1) or infected with pOka (lane 2), pOka66S (lane 3), pOka66G102A (lane 4), or pOka66S250P (lane 5) for 48 h. In the top panels, IE62 is shown to migrate at approximately 175 kDa. The middle panels show ORF66 protein at approximately 48 kDa in whole-cell lysate and both cytoplasmic and nuclear fractions. {alpha}-Tubulin was detected in all cytoplasmic and whole-cell lysates but not in nuclear lysates, as expected.

The altered localization of IE62 was further confirmed by immunoblotting to detect IE62 in cytoplasmic and nuclear fractions of melanoma cell lysate (Fig. 4B). IE62 was not present in the cytoplasmic fraction of cells infected with pOka66G102A or the pOka66S control, but cytoplasmic IE62 was detected in cells infected with pOka and pOka66S250P at 48 h after infection. IE62 was found in nuclear lysate, as well as the whole-cell lysate, from cells infected with each of these four viruses. ORF66 protein was also detected in cytoplasmic, nuclear, and whole-cell lysates from cells infected with pOka, pOka66G102A, and pOka66S250P, but not in cells infected with pOka66S. {alpha}-Tubulin was not detected in the soluble nuclear fraction, confirming the separation of nuclear and cytoplasmic lysates.

The effect of the ORF66 G102A mutation on virion production and morphogenesis was assessed by transmission electron microscope analysis of HEL fibroblasts infected with pOka66G102A and compared to cells infected with pOka and pOka66S. Typical nucleocapsids were observed within the nucleus, and complete virus particles were readily observable within cytoplasmic vesicles and on the cell surface in cells infected with the three viruses (Fig. 5).


Figure 5
View larger version (89K):
[in this window]
[in a new window]
 
FIG. 5. pOka and ORF66 mutants generate complete virions in vitro. HEL fibroblasts were infected with 1 x 103 CFU of pOka, pOka66S, or pOka66G102A. Forty-eight hours postinfection, complete viral particles were observed by transmission electron microscopy in infected fibroblasts. A representative image of one cell infected with each virus is pictured, with at least one nucleocapsid in the nucleus (arrowheads) and two or more complete virions on the cell surface (arrows). The locations of the nucleus (Nuc) and cytoplasm (Cyt) are indicated. Magnification, x10,000.

To characterize the kinase activity of ORF66 protein and effects of the ORF66 mutations on this function, we investigated whether the kinase domain mutant ORF66 proteins retained the capacity for autophosphorylation in two independent kinase assays performed using ORF66 protein immunoprecipitated from melanoma cells infected with pOka, pOka66S, pOka66G102A, and pOka66S250P (Fig. 6). The intact ORF66 protein from pOka-infected cells and the ORF66-S250P protein from pOka66S250P-infected cells were both autophosphorylated during VZV replication in vitro, while the ORF66-G102A protein was not. It is not clear whether there is a significant difference in the phosphorylation signal of ORF66-S250P compared with wild-type ORF66. ORF66 autophosphorylation was not detected in immunoprecipitates from lysates of cells that were uninfected or infected with pOka66S, or in infected cell lysates immunoprecipitated with rabbit preimmune IgG.


Figure 6
View larger version (47K):
[in this window]
[in a new window]
 
FIG. 6. Autophosphorylation of the ORF66 kinase. Melanoma cells were left uninfected (lane 1) or infected with pOka (lanes 2 and 3), pOka66S (lane 4), pOka66G102A (lane 5), or pOka66S250P (lane 6). The cell lysate was immunoprecipitated with either polyclonal rabbit anti-ORF66 IgG (lanes 1, 3, 4, 5, and 6) or with rabbit preimmune IgG (lane 2). The immunoprecipitated proteins were incubated in kinase reaction buffer and subjected to SDS-PAGE. The arrow indicates the expected position of the autophosphorylated ORF66 protein.

Evaluation of the effects of the ORF66 kinase mutations on infection of human skin xenografts in vivo. The growth of the pOka virus in SCID-hu skin tissue at day 10 postinoculation was approximately 5.8 x 102 infectious foci/implant, and the titer increased to 1.4 x 104 at day 18 (data not shown). The pOka66S titer was significantly lower at day 18 with 1.8 x 103 infectious foci/implant (P < 0.05), and the pOka66G102A virus was significantly lower than pOka at both time points, with a titer of approximately 9.0 x 101 infectious foci/implant at day 10 (P < 0.001) and 5.9 x 101 infectious foci/implant at day 18 (P < 0.05). The difference between growth of pOka66S and pOka66G102A was not significant. The ORF66 sequence and mutations were confirmed for viruses recovered from skin xenografts (data not shown).

Evaluation of the effects of the ORF66 kinase mutations on infection of T cells in vivo and in vitro. Eliminating ORF66 expression by stop codon insertion in vOka and pOka was previously shown to reduce the growth of VZV in T cells in vivo (31, 40). The growth of pOka66G102A in T-cell xenografts was also impaired significantly compared to pOka, with a titer of approximately 2.9 x 103 infectious foci/xenograft at days 10 to 14 (P < 0.05) (Fig. 7). The titer of pOka66G102A at days 18 to 21 was 2.7 x 103 infectious foci/xenograft (P = 0.06). Although pOka66G102A appeared to yield slightly more infectious virus than pOka66S at both time points, these differences were not statistically significant. The growth of pOka66S250P did not differ significantly from pOka at either time point (data not shown).


Figure 7
View larger version (49K):
[in this window]
[in a new window]
 
FIG. 7. Replication of VZV ORF66 mutants in T-cell xenografts in SCID-hu mice. T-cell xenografts were inoculated with HEL fibroblasts infected with pOka, pOka66S, or pOka66G102A on day 0 (inoculum titers are shown on the y axis as infectious foci/ml) and harvested at 10 to 14 or 18 to 21 days. T-cell suspensions were prepared, and titers were determined by infectious center assay. Each time point represents the mean number of plaques from two to four xenografts. Xenografts in which infectious virus was not recovered were excluded. One asterisk indicates that titers were significantly different from pOka (P < 0.05) at the same time point.

The effects of disrupting the conserved ATP anchor motif on VZV T-cell tropism by the substitution of alanine for glycine in pOka66G102A were investigated further by experiments to analyze IE62 localization in T cells by confocal microscopy. In contrast to fibroblasts infected with pOka66G102A and pOka66S (Fig. 4), IE62 showed no nuclear retention in T cells infected with these ORF66 kinase mutants at 72 h after infection (Fig. 8). IE62 localized primarily to the cytoplasm of T cells infected with pOka, pOka66S, pOka66G102A, or pOka66S250P in a pattern that was indistinguishable with all four viruses. Thus, these experiments provided the unexpected finding that the requirement for ORF66 kinase function in determining the intracellular localization of IE62 is cell type specific.


Figure 8
View larger version (34K):
[in this window]
[in a new window]
 
FIG. 8. IE62 localization in T cells infected with pOka ORF66 mutants. T cells infected with pOka and pOka ORF66 mutants were analyzed by confocal microscopy for localization of IE62. Purified tonsil T cells were infected by coculture with fibroblast monolayers either uninfected (mock) or infected with pOka, pOka66S, pOka66G102A, or pOka66S250P. T cells were fixed and stained after 72 h. IE62 was detected with a secondary FITC-conjugated antibody (green, left panels), and gE was detected with a secondary Texas Red-conjugated antibody (red, middle panels). The cells were also stained with antibodies to CD3 and secondary Texas Red-conjugated antibody (red) to determine that most were CD3+ T cells; a representative picture is shown in the top row. Images of each row were merged with DAPI nuclear stain (third panel). Colocalizations of IE62 and gE appear yellow. Bars, 20 µm.

Caspase-3 is a protease that cleaves other caspases and protein targets and serves as an early marker of apoptosis. Previously, analysis of pOka66S demonstrated that the ORF66 protein was required to block apoptosis, as measured by inhibition of caspase-3 activation in VZV-infected T cells (40); therefore, pOka66G102A and pOka66S250P were compared to pOka and pOka66S in this assay (Fig. 9). When T cells were infected and examined by flow cytometry, the percentage of VZV-positive T cells that expressed activated caspase-3 was less than 5.5% in pOka- and pOka66S250P-infected cultures at 48 and 72 h after inoculation. In contrast, 15.6% and 13.6% of pOka66S-infected T cells and 15.3% and 14.4% of pOka66G102A-infected T cells were active caspase-3 positive at these time points. Caspase-3 activation was not detected above a background of less than 0.5% in any of the VZV-negative T-cell populations from cultures infected with pOka or ORF66 mutant viruses or in mock-infected cultures.


Figure 9
View larger version (30K):
[in this window]
[in a new window]
 
FIG. 9. Flow cytometric analysis of apoptosis in T cells infected with pOka and ORF66 mutants. Purified human tonsil T cells were cocultured with fibroblasts that were either uninfected or infected with pOka, pOka66S, pOka66G102A, or pOka66S250P. The T cells were fixed and stained at 48 or 72 h postinfection (hpi) with antibodies to VZV proteins, CD3, and active caspase-3. Cells were gated on CD3-positive T cells and divided into VZV-positive and VZV-negative populations. Bars represent the percentage of caspase-3-positive cells in each category. One asterisk indicates a significant difference from the pOka value at the same time point (P < 0.05).


arrow
DISCUSSION
 
VZV ORF66 protein is representative of the serine/threonine kinases that are unique to the alphaherpesviruses and, as such, shares highly conserved residues with HSV-1 US3 and related proteins in the simian varicella virus, PRV, equine herpesvirus 1, and bovine herpesvirus 1 alphaherpesviruses (12, 29, 46). The characteristic T-cell tropism of VZV, which allows the transfer of infectious virus from respiratory mucosal sites of inoculation to skin during primary VZV infection, depends on ORF66 protein expression (23-25, 30, 31, 40). These ORF66 kinase mutagenesis experiments, using the pOka66G102A mutant, now demonstrate that VZV T-cell tropism in differentiated human T cells in vivo requires ORF66 kinase function. This requirement was independent of the well-documented effect of ORF66 kinase activity on IE62 cytoplasmic localization at late times after infection of cultured cells in vitro, since IE62 was directed to the cytoplasm in T cells infected with pOka66G102A or the pOka66S stop codon mutant. The ORF66 kinase activity also was necessary for VZV interference with apoptosis of infected T cells. In contrast, disrupting the ORF66 kinase function with the G102A mutation had limited consequences for VZV replication in skin xenografts in vivo.

Conserved motifs within the kinase domains of serine/threonine kinases have three roles, including binding and orientation of the phosphate donor, binding and orientation of the substrate, and transfer of the phosphate to the acceptor hydroxyl residue of the substrate (14). In these experiments, eight individual point mutations were introduced into ORF66 that were designed to disrupt 5 of the 12 conserved kinase motifs in ORF66 protein (Fig. 1A). Our observations showed that mutations of ATP binding/phosphate anchor functions, near the start of the kinase domain, and APE motifs, at the C terminus, either did not interfere with recovery of infectious recombinants from pOka cosmids or allowed generation of recombinants when intact ORF66 was inserted into the genome along with the ORF66 mutation. In contrast, viruses with mutations in the central catalytic core were difficult to recover from cosmid transfections, suggesting interference of the mutant protein with VZV replication.

The region N-terminal to the kinase domain in the US3/ORF66 homologues has no identified function or recognizable functional domain and is not well conserved between the alphaherpesviruses. Truncated forms of the PRV and HSV-1 US3 proteins share the protein kinase domain with the longer isoform and have kinase activity (39, 46). The N-terminal region of HSV US3 is 97 amino acids longer than that of ORF66, and its short isoform is still 20 amino acids longer than the ORF66 N-terminal sequence. The long isoform of PRV US3, which contains 19 more amino acids in its N terminus than ORF66, also initiates from a position 55 amino acids downstream from its start site, which would be near the position of the stop codon insertion in ORF66 that makes the pOka66S mutant. This insertion contains four stop codons (TGATAATGACCGTCACATATTTAG, stop codons underlined), making translation of the full-length protein unlikely. While we considered the possibility that a truncated ORF66 protein initiated from downstream of the stop codon insertion, Northern blot analysis of ORF66 transcripts indicated that this was not the case.

The G102A mutation is within the glycine-rich loop (GxGxxG) of subdomain I, typically an integral part of the ATP-binding site (16). Glycine residues provide minimal steric interference and maximal conformational flexibility of this loop (16). ORF66, like its alphaherpesvirus homologues, does not have a Gly in the first position of this motif (ORF66 residue 100), which is Gly in more than 94% of kinases. We targeted the second glycine residue, G102 in ORF66, for mutagenesis because it is conserved in more than 99% of kinases (16). In protein kinase A, the substitution of this glycine residue had a severe effect on the kinetics of phosphoryl transfer and increased the ATPase rate (16). Disrupting this motif blocked ORF66 protein kinase activity, as shown by inhibition of autophosphorylation. Since the absence of IE62 phosphorylation by ORF66 kinase results in its nuclear retention in melanoma cells in vitro, the fact that IE62 was restricted to the nuclei of cells infected with pOka66G012A suggests that the G102A mutation also blocked IE62 phosphorylation.

In the ATP-binding region, the K122 residue in subdomain II is completely invariant in viral and cellular protein kinases. The ORF66 residue K122 is predicted to be essential for ATP binding and is necessary for ORF66 effects on IE62 localization in vitro (21). In in vitro studies, mutation of this residue abolishes the effect of ORF66 on IE62 localization and phosphorylation. Our replacement of K122 with asparagine (K122N) or arginine (K122R) impaired direct recovery of infectious virus from VZV cosmids.

Similarly, the P251S mutation, made in the highly conserved APE motif in subdomain VIII, also impaired direct recovery of infectious virus from cosmids. This motif is SPE in ORF66 protein and corresponds to PPE in the kinase domain of ORF47 protein; both sequences fit the APE motif consensus. This motif, along with upstream sequences within this subdomain, is thought to be important for the tertiary structure of the kinase domain. Although a P-S mutation in the APE motif, changing PPE to PSE in the ORF47 protein, had no effect on ORF47 kinase function or VZV infectivity (5), the P251 residue in ORF66 protein appears to be critical. Mutation of the serine residue of this motif, however, was compatible with recovery of infectious virus (pOka66S250P) and did not result in any differences from pOka in growth or autophosphorylation. This observation is consistent with the fact that the Ser250 mutation to Pro is conservative and is usually an equally acceptable residue in this position.

The three mutations affecting the center catalytic region/activation subdomain of the ORF66 kinase domain, D206N, E210D, or D224N, were also associated with diminished recovery of infectious VZV from cosmids. The observation that some ORF66 kinase domain mutants have the capacity to reduce the recovery of infectious virus from cosmids suggests that they may exert a dominant negative effect, as has been described for some cellular kinases (8, 13, 17, 41, 47). The analysis of these mutants will be a subject of future investigation.

Recovery of the pOka66G102A virus and its characterization as a kinase-deficient mutant enabled us to examine the contribution of ORF66 kinase activity to VZV infection in vitro and in skin and T cells in vivo. Disrupting the G102 kinase domain residue was sufficient to account for the phenotypic differences between pOka and pOka66S, notably, the adverse impact of blocking ORF66 protein on VZV T-cell tropism. The pattern of slightly diminished pOka66G102A virulence in skin was the same as pOka66S, suggesting that its kinase activity is the important ORF66 protein function that is missing in pOka66S. However, the small decrease in growth of pOka66S and pOka66G102A in skin suggests that ORF66 kinase function contributes only minimally to the pathogenesis of cutaneous lesion formation by VZV. It is possible that a cellular kinase may substitute for ORF66 kinase functions in skin or that ORF47 is sufficient for most functions in differentiated human epidermal cells in vivo. IE62 was retained in nuclei of melanoma cells infected with G102A, as it is in pOka66S-infected cells, which is predicted to prevent IE62 incorporation into virions. However, the ORF66 mutants produced VZ virions with no detectable morphological differences from pOka virions. Judging from the relatively efficient growth of these viruses in skin in vivo, incorporation of IE62 into the virion tegument may not be important during cutaneous infection. Mislocalization of IE62 protein in the absence of ORF66 kinase activity could be less significant in skin, because VZV pathogenesis at this site appears to depend primarily on fusion of epidermal cells. Our prior work with ORF47 stop codon and kinase-defective mutants demonstrated cell-to-cell spread of VZV, and the capacity to infect skin was preserved even when very few intact virions were made (4).

While ORF66 protein is more or less dispensable in skin and has no impact on VZ virion assembly in fibroblasts, it is necessary for virion formation in T cells in vivo. Virion numbers in nuclei and cytoplasm of pOka66S-infected T cells were reduced by 91% and 80% in T cells (40). The reduced growth of pOka66G102A in T cells indicates that ORF66 kinase activity is required for typical VZV T-cell tropism. This mutation confers a phenotype similar to pOka66S. However, although ORF66 protein and its kinase activity are clearly necessary, it is not yet clear what ORF66 function accounts for its requirement in T cells, but not in skin. Whereas persistent nuclear localization of IE62 and the likely failure to incorporate IE62 into VZ virions might have no consequences in skin, this effect could alter VZV replication in differentiated T cells in vivo. However, IE62 was not mislocalized in T cells infected with either pOka66G102A or pOka66S, suggesting that its NLS was masked effectively. ORF66 protein containing the G102A mutation might retain IE62 binding, as we observed with ORF47 kinase-defective mutants (5), and mask the NLS even if its phosphorylating capacity were blocked, but this cannot be the case in pOka66S-infected T cells, suggesting that IE62 phosphorylation by another kinase or an alternate mechanism accounts for IE62 localization to the cytoplasm in T cells. Although IE62 can still be found in the cytoplasm of T cells despite the absence of ORF66 protein, possibly through phosphorylation by a compensating cellular kinase, that cellular kinase may not replace the important role of ORF66 protein in tegument formation. In any case, even though cytoplasmic IE62 is available for incorporation into virions and colocalizes with gE, virion formation in T cells infected in vivo was still significantly impaired in the absence of ORF66 kinase activity.

Although the effect of blocking ORF66 kinase function does not appear to result in IE62 mislocalization, the specific kinase activity mediated by ORF66 protein may be needed to phosphorylate some other viral or cellular target, which cannot be complemented by ORF47 or a cellular kinase in T cells. Since ORF66 protein is a VZV tegument component, it is possible that this protein is necessary for efficient assembly and release of virions from T cells. In contrast to skin, these processes appear to be necessary for VZV T-cell tropism because VZV-infected T cells do not undergo cell-to-cell fusion (23). Alternatively, the experiments with pOka66G102A suggest that the kinase activity of ORF66 protein is important for delaying apoptosis of VZV-infected T cells. Thus, the absence of ORF66 kinase activity could explain or contribute to the reduced virion formation observed in pOka66S-infected T cells. An HSV-1 US3 kinase-negative mutant in which the invariant lysine residue in the ATP-binding region was substituted with alanine (US3-K220A) also demonstrated that its kinase activity was required to block apoptosis (38). Preventing apoptosis could be an important function of the ORF66 kinase and may explain the reduced growth phenotype of the pOka66S mutant in T cells in vivo, because triggering apoptosis early in infected cells limits the amount of time available for virion production and release.

In summary, ORF66 protein kinase function is required for the proper localization of IE62 in VZV-infected fibroblasts and for optimal growth of VZV in skin. Although IE62 localization was not altered, disruption of the highly conserved kinase motif residue G102 resulted in significantly impaired growth and VZ virion formation in T cells, which explains why ORF66 protein is a critical determinant of VZV tropism for T cells.


arrow
ACKNOWLEDGMENTS
 
This work was supported by grants AI053846 and AI20459 (A.M.A.) from the National Institute of Allergy and Infectious Diseases and a Stanford Graduate Fellowship from the Susan P. Markey Foundation (A.S.-N.).

We thank Nafisa Ghori (Stanford University) for assistance with transmission electron microscopy and Cheryl Stoddard (Gladstone Institute, University of California, San Francisco) for providing the SCID-hu (thy/liv) mice.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: G312, Department of Pediatrics, Stanford University School of Medicine, 300 Pasteur Dr., Stanford, CA 94305-5208. Phone: (650) 725-6555. Fax: (650) 725-8040. E-mail: anne.s.nutt{at}gmail.com. Back

{triangledown} Published ahead of print on 13 September 2006. Back


arrow
REFERENCES
 
    1
  1. Abendroth, A., I. Lin, B. Slobedman, H. Ploegh, and A. M. Arvin. 2001. Varicella-zoster virus retains major histocompatibility complex class I proteins in the Golgi compartment of infected cells. J. Virol. 75:4878-4888.[Abstract/Free Full Text]
  2. 2
  3. Arvin, A. 2001.Varicella-zoster virus, p. 2731-2767. In D. M. Knipe and P. M. Howley (ed.), Fields virology, 4th ed. Lippincott Williams & Wilkins, Philadelphia, Pa.
  4. 3
  5. Baiker, A., C. Bagowski, H. Ito, M. Sommer, L. Zerboni, K. Fabel, J. Hay, W. Ruyechan, and A. M. Arvin. 2004. The immediate-early 63 protein of varicella-zoster virus: analysis of functional domains required for replication in vitro and for T-cell and skin tropism in the SCID-hu model in vivo. J. Virol. 78:1181-1194.[Abstract/Free Full Text]
  6. 4
  7. Besser, J., M. Ikoma, K. Fabel, M. H. Sommer, L. Zerboni, C. Grose, and A. M. Arvin. 2004. Differential requirement for cell fusion and virion formation in the pathogenesis of varicella-zoster virus infection in skin and T cells. J. Virol. 78:13293-13305.[Abstract/Free Full Text]
  8. 5
  9. Besser, J., M. H. Sommer, L. Zerboni, C. P. Bagowski, H. Ito, J. Moffat, C.-C. Ku, and A. M. Arvin. 2003. Differentiation of varicella-zoster virus ORF47 protein kinase and IE62 protein binding domains and their contributions to replication in human skin xenografts in the SCID-hu mouse. J. Virol. 77:5964-5974.[Abstract/Free Full Text]
  10. 6
  11. Chee, M. S., G. L. Lawrence, and B. G. Barrell. 1989. Alpha-, beta-, and gammaherpesviruses encode a putative phosphotransferase. J. Gen. Virol. 70:1151-1160.[Abstract/Free Full Text]
  12. 7
  13. Chen, W. S., C. S. Lazar, M. Poenie, R. Y. G. Tsien, G. N., and M. G. Rosenfeld. 1987. Requirement for intrinsic protein tyrosine kinase in the immediate and late actions of the EGF receptor. Nature 328:820-823.[CrossRef][Medline]
  14. 8
  15. Clemens, M. J., and A. Elia. 1997. The double-stranded RNA-dependent protein kinase PKR: structure and function. J. Interferon Cytokine Res. 17:503-524.[Medline]
  16. 9
  17. Cohrs, R., D. H. Gilden, P. R. Kinchington, E. Grinfeld, and P. G. Kennedy. 2003. Varicella-zoster virus gene 66 transcription and translation in latently infected human ganglia. J. Virol. 77:6660-6665.[Abstract/Free Full Text]
  18. 10
  19. Eisfeld, A. J., S. E. Turse, S. A. Jackson, E. C. Lerner, and P. R. Kinchington. 2006. Phosphorylation of the varicella-zoster virus (VZV) major transcriptional regulatory protein IE62 by the VZV open reading frame 66 protein kinase. J. Virol. 80:1710-1723.[Abstract/Free Full Text]
  20. 11
  21. Reference deleted.
  22. 12
  23. Fletcher, T. M., and W. L. Gray. 1993. DNA sequence and genetic organization of the unique short (Us) region of the simian varicella virus genome. Virology 193:762-773.[CrossRef][Medline]
  24. 13
  25. Foskett, S. M., R. Ghose, D. N. Tang, D. E. Lewis, and A. P. Rice. 2001. Antiapoptotic function of Cdk9 (TAK/P-TEFb) in U937 promonocytic cells. J. Virol. 75:1220-1228.[Abstract/Free Full Text]
  26. 14
  27. Hanks, S. K., and T. Hunter. 1995. Protein kinases 6. The eukaryotic protein kinase superfamily: kinase (catalytic) domain structure and classification. FASEB J. 9:576-596.[Abstract]
  28. 15
  29. Hanks, S. K., A. M. Quinn, and T. Hunter. 1988. The protein kinase family: conserved features and deduced phylogeny of the catalytic domains. Science 241:42-52.[Abstract/Free Full Text]
  30. 16
  31. Hemmer, W., M. McGlone, I. Tsigelny, and S. Taylor. 1997. Role of the glycine triad in the ATP-binding site of cAMP-dependent protein kinase. J. Biol. Chem. 272:16946-16954.[Abstract/Free Full Text]
  32. 17
  33. Hubbard, S. R. 2004. Oncogenic mutations in B-Raf: some losses yield gains. Cell 116:764-766.[CrossRef][Medline]
  34. 18
  35. Kato, A., M. Yamamoto, T. Ohno, H. Kodaira, Y. Nishiyama, and Y. Kawaguchi. 2005. Identification of proteins phosphorylated directly by the Us3 protein kinase encoded by herpes simplex virus 1. J. Virol. 79:9325-9331.[Abstract/Free Full Text]
  36. 19
  37. Kenyon, T. K., J. Lynch, J. Hay, W. Ruyechan, and C. Grose. 2001. Varicella-zoster virus ORF47 protein serine kinase: characterization of a cloned, biologically active phosphotransferase and two viral substrates, ORF62 and ORF63. J. Virol. 75:8854-8858.[Abstract/Free Full Text]
  38. 20
  39. Kinchington, P. R., K. Fite, A. Seman, and S. E. Turse. 2001. Virion association of IE62, the varicella-zoster virus (VZV) major transcriptional regulatory protein, requires expression of the VZV open reading frame 66 protein kinase. J. Virol. 75:9106-9113.[Abstract/Free Full Text]
  40. 21
  41. Kinchington, P. R., K. Fite, and S. E. Turse. 2000. Nuclear accumulation of IE62, the varicella-zoster virus (VZV) major transcriptional regulatory protein, is inhibited by phosphorylation mediated by the VZV open reading frame 66 protein kinase. J. Virol. 74:2265-2277.[Abstract/Free Full Text]
  42. 22
  43. Knighton, D. R., J. H. Zheng, L. F. Ten Eyck, V. A. Ashford, N. H. Xuong, S. S. Taylor, and J. M. Sowadski. 1991. Crystal structure of the catalytic subunit of cyclic adenosine monophosphate-dependent protein kinase. Science 253:407-414.[Abstract/Free Full Text]
  44. 23
  45. Ku, C. C., J. Besser, A. Abendroth, C. Grose, and A. M. Arvin. 2005. Varicella-zoster virus pathogenesis and immunobiology: new concepts emerging from investigations with the SCID-hu mouse model. J. Virol. 79:2651-2658.[Free Full Text]
  46. 24
  47. Ku, C. C., J. A. Padilla, C. Grose, E. C. Butcher, and A. M. Arvin. 2002. Tropism of varicella-zoster virus for human tonsillar CD4+ T lymphocytes that express activation, memory, and skin homing markers. J. Virol. 76:11425-11433.[Abstract/Free Full Text]
  48. 25
  49. Ku, C. C., L. Zerboni, H. Ito, B. S. Graham, M. Wallace, and A. M. Arvin. 2004. Varicella-zoster virus transfer to skin by T cells and modulation of viral replication by epidermal cell interferon-alpha. J. Exp. Med. 200:917-925.[Abstract/Free Full Text]
  50. 26
  51. Leung-Tack, P., J.-C. Audonnet, and M. Riviere. 1994. The complete DNA sequence and the genetic organization of the short unique region (Us) of the bone herpesvirus type 1 (ST strain). Virology 199:409-421.[CrossRef][Medline]
  52. 27
  53. Mallory, S., M. Sommer, and A. M. Arvin. 1997. Mutational analysis of the role of glycoprotein I in varicella-zoster virus replication and its effects on glycoprotein E conformation and trafficking. J. Virol. 71:8279-8288.[Abstract]
  54. 28
  55. Matsuzaki, A., Y. Yamauchi, A. Kato, F. Goshima, Y. Kawaguchi, T. Yoshikawa, and Y. Nishiyama. 2005. US3 protein kinase of herpes simplex virus type 2 is required for the stability of the UL46-encoded tegument protein and its association with virus particles. J. Gen. Virol. 86:1979-1985.[Abstract/Free Full Text]
  56. 29
  57. McGeoch, D. J., and A. J. Davison. 1986. Alphaherpesviruses possess a gene homologous to the protein kinase gene family of eukaryotes and retroviruses. Nucleic Acids Res. 14:1765-1777.[Abstract/Free Full Text]
  58. 30
  59. Moffat, J. F., M. D. Stein, H. Kaneshima, and A. M. Arvin. 1995. Tropism of varicella-zoster virus for human CD4+ and CD8+ T lymphocytes and epidermal cells in SCID-hu mice. J. Virol. 69:5236-5242.[Abstract]
  60. 31
  61. Moffat, J. F., L. Zerboni, M. H. Sommer, T. C. Heineman, J. I. Cohen, H. Kaneshima, and A. M. Arvin. 1998. The ORF47 and ORF66 putative protein kinases of varicella-zoster virus determine tropism for human T cells and skin in the SCID-hu mouse. Proc. Natl. Acad. Sci. USA 95:11969-11974.[Abstract/Free Full Text]
  62. 32
  63. Montini, E., G. Andolfi, A. Caruso, G. Buchner, S. M. Walpole, M. Mariani, G. Consalex, D. Trump, A. Ballabio, and B. Franco. 1998. Identification and characterization of a novel serine-threonine kinase gene from the Xp22 region. Genomics 51:427-433.[CrossRef][Medline]
  64. 33
  65. Moriuchi, M., H. Moriuchi, S. E. Straus, and J. I. Cohen. 1994. Varicella-zoster virus (VZV) virion-associated transactivator open reading frame 62 protein enhances the infectivity of VZV DNA. Virology 200:297-300.[CrossRef][Medline]
  66. 34
  67. Munger, J., A. V. Chee, and B. Roizman. 2001. The US3 protein kinase blocks apoptosis induced by the d120 mutant of herpes simplex virus 1 at a premitochondrial stage. J. Virol. 75:5491-5497.[Abstract/Free Full Text]
  68. 35
  69. Murata, T., F. Goshima, T. Daikoku, H. Takakuwa, and Y. Nishiyama. 2000. Expression of herpes simplex virus type 2 US3 affects the Cdc42/Rac pathway and attenuates c-Jun N-terminal kinase activation. Genes Cells 5:1017-1027.[Abstract]
  70. 36
  71. Ng, T. I., L. Keenan, P. R. Kinchington, and C. Grose. 1994. Phosphorylation of varicella-zoster virus open reading frame (ORF) 62 regulatory product by viral ORF47-associated protein kinase. J. Virol. 68:1350-1359.[Abstract/Free Full Text]
  72. 37
  73. Niizuma, T., L. Zerboni, M. Sommer, H. Ito, S. Hinchliffe, and A. M. Arvin. 2003. Construction of varicella-zoster virus recombinants from parent Oka cosmids and demonstration that ORF65 protein is dispensable for infection of human skin and T cells in the SCID-hu mouse model. J. Virol. 77:6062-6065.[Abstract/Free Full Text]
  74. 38
  75. Ogg, P. D., P. J. McDonell, B. J. Ryckman, C. M. Knudson, and R. J. Roller. 2004. The HSV-1 Us3 protein kinase is sufficient to block apoptosis induced by overexpression of a variety of Bcl-2 family members. Virology 319:212-224.[CrossRef][Medline]
  76. 39
  77. Poon, A. P. W., and B. Roizman. 2005. Herpes simplex virus 1 ICP22 regulates the accumulation of a shorter mRNA and of a truncated Us3 protein kinase that exhibits altered functions. J. Virol. 79:8470-8479.[Abstract/Free Full Text]
  78. 40
  79. Schaap, A., J. F. Fortin, M. Sommer, L. Zerboni, S. Stamatis, C. C. Ku, G. P. Nolan, and A. Arvin. 2005. T cell tropism and the role of ORF66 protein in the pathogenesis of varicella-zoster virus infection. J. Virol. 79:12921-12933.[Abstract/Free Full Text]
  80. 41
  81. Shamah, S. M., and C. D. Stiles. 1995. Transdominant negative mutations. Methods Enzymol. 254:565-576.[Medline]
  82. 42
  83. Smith, R. F., and T. F. Smith. 1989. Identification of new protein kinase-related genes in three herpesviruses, herpes simplex virus, varicella-zoster virus, and Epstein-Barr virus. J. Virol. 63:450-455.[Abstract/Free Full Text]
  84. 43
  85. Sommer, M. H., E. Zagha, O. K. Serrano, C. C. Ku, L. Zerboni, A. Baiker, R. Santos, M. Spengler, J. Lynch, C. Grose, W. Ruyechan, J. Hay, and A. M. Arvin. 2001. Mutational analysis of the repeated open reading frames, ORFs 63 and 70 and ORFs 64 and 69, of varicella-zoster virus. J. Virol. 75:8224-8239.[Abstract/Free Full Text]
  86. 44
  87. Stevenson, D., K. L. Colman, and A. J. Davison. 1994. Characterization of the putative protein kinases specified by varicella-zoster virus genes 47 and 66. J. Gen. Virol. 75:317-326.[Abstract/Free Full Text]
  88. 45
  89. Reference deleted.
  90. 46
  91. van Zijl, M., H. van der Gulden, N. de Wind, A. Gielkens, and A. Berns. 1990. Identification of two genes in the unique short region of pseudorabies virus; comparison with herpes simplex virus and varicella-zoster virus. J. Gen. Virol. 71:1747-1755.[Abstract/Free Full Text]
  92. 47
  93. Wan, P. T. C., M. J. Garnett, S. M. Roe, S. Lee, D. Niculescu-Duvaz, V. M. Good, C. G. Project, C. M. Jones, C. J. Marshall, C. J. Springer, D. Barford, and R. Marais. 2004. Mechanism of activation of the RAF-ERK signaling pathway by oncogenic mutations of B-RAF. Cell 116:855-867.[CrossRef][Medline]


Journal of Virology, December 2006, p. 11806-11816, Vol. 80, No. 23
0022-538X/06/$08.00+0     doi:10.1128/JVI.00466-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Erazo, A., Yee, M. B., Osterrieder, N., Kinchington, P. R. (2008). Varicella-Zoster Virus Open Reading Frame 66 Protein Kinase Is Required for Efficient Viral Growth in Primary Human Corneal Stromal Fibroblast Cells. J. Virol. 82: 7653-7665 [Abstract] [Full Text]  
  • Eisfeld, A. J., Yee, M. B., Erazo, A., Abendroth, A., Kinchington, P. R. (2007). Downregulation of Class I Major Histocompatibility Complex Surface Expression by Varicella-Zoster Virus Involves Open Reading Frame 66 Protein Kinase-Dependent and -Independent Mechanisms. J. Virol. 81: 9034-9049 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schaap-Nutt, A.
Right arrow Articles by Arvin, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schaap-Nutt, A.
Right arrow Articles by Arvin, A. M.