This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guo, F.
Right arrow Articles by Kleiman, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guo, F.
Right arrow Articles by Kleiman, L.

 Previous Article  |  Next Article 

Journal of Virology, December 2006, p. 11710-11722, Vol. 80, No. 23
0022-538X/06/$08.00+0     doi:10.1128/JVI.01038-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Inhibition of Formula-Primed Reverse Transcription by Human APOBEC3G during Human Immunodeficiency Virus Type 1 Replication{triangledown}

Fei Guo,1 Shan Cen,1,2 Meijuan Niu,1 Jenan Saadatmand,1,2 and Lawrence Kleiman1,2,3*

Lady Davis Institute for Medical Research and McGill AIDS Centre, Jewish General Hospital,1 Departments of Medicine,2 Microbiology & Immunology, McGill University, Montreal, Quebec, Canada H3T 1E23

Received 20 June 2006/ Accepted 15 September 2006


arrow
ABSTRACT
 
Cells are categorized as being permissive or nonpermissive according to their ability to produce infectious human immunodeficiency virus type 1 (HIV-1) lacking the viral protein Vif. Nonpermissive cells express the human cytidine deaminase APOBEC3G (hA3G), and Vif has been shown to bind to APOBEC3G and facilitate its degradation. Vif-negative HIV-1 virions produced in nonpermissive cells incorporate hA3G and have a severely reduced ability to produce viral DNA in newly infected cells. While it has been proposed that the reduction in DNA production is due to hA3G-facilitated deamination of cytidine, followed by DNA degradation, we provide evidence here that a decrease in the synthesis of the DNA by reverse transcriptase may account for a significant part of this reduction. During the infection of cells with Vif-negative HIV-1 produced from 293T cells transiently expressing hA3G, much of the inhibition of early (≥50% reduction) and late (≥95% reduction) viral DNA production, and of viral infectivity (≥95% reduction), can occur independently of DNA deamination. The inhibition of the production of early minus-sense strong stop DNA is also correlated with a similar inability of tRNA3Lys to prime reverse transcription. A similar reduction in tRNA3Lys priming and viral infectivity is also seen in the naturally nonpermissive cell H9, albeit at significantly lower levels of hA3G expression.


arrow
INTRODUCTION
 
Vif (virion infectivity factor) is a 190- to 240-amino-acid protein that is encoded by all of the lentiviruses except for equine infectious anemia virus (10, 11, 14, 16, 26, 32, 35, 47-49, 51, 53). Vif is required for the production of infectious human immunodeficiency virus type 1 (HIV-1) in certain "nonpermissive" cell types, such as primary T lymphocytes, macrophages, and some T-cell lines, including H9 and MT2, but is not required in other "permissive" cell types, such as 293T, SupT1, and Jurkat cells (11, 14, 51). The ability of Vif-negative viruses to replicate in target cells is determined by the cell producing the virus (14, 53). Thus, Vif-deficient viruses produced from nonpermissive cells are impaired in their ability to replicate in target cells.

Nonpermissive human cells contain a protein called human APOBEC3G (hA3G), and Vif-negative HIV-1 produced in nonpermissive cells packages hA3G during assembly to a much larger extent than Vif-positive virions (36, 46). Vif is able to bind to hA3G (38) and can reduce both the cellular expression of APOBEC3G and its incorporation into virions (27). The reduction in cellular expression has been attributed to both the inhibition of hA3G translation and its degradation in the cytoplasm by Vif (50), and evidence suggests that the Vif interaction with cytoplasmic hA3G facilitates, through its additional binding to a Cul5E3 ligase, the ubiquination of hA3G and its degradation (58).

Vif-negative viruses containing hA3G produce a severely reduced viral DNA content in newly infected cells. Most investigations have detected a reduction in the ability to produce strong stop (SS) viral DNA in Vif-negative virions exposed to hA3G. The range in the reduction of initial DNA production that has been reported has varied from 84% (17) to 66% (36) to approximately 50% (35, 39), although one report noted no decrease in initial viral DNA production (15). Reports of the stage at which the initial viral DNA production is blocked have also varied. Quantitative PCR analyses of endogenous reverse transcriptase (RT) transcripts have shown reduced production of both early and late reverse transcripts in some cases (17, 38), while another report showed reduction of only the later RT transcripts (34).

How does hA3G affect viral DNA content? hA3G belongs to an APOBEC superfamily containing at least 10 members which share a cytidine deaminase motif, including APOBEC1 and activation-induced cytidine deaminase (AID), which have been shown to deaminate C in RNA (23) and DNA (41), respectively. hA3G does not appear to be able to edit RNA (36, 57, 60). However, because the minus-strand cDNA that is made in newly infected cells contains 1 to 2% of cytosines mutated to uracil (19, 31, 36, 60), it has been suggested that hA3G's anti-HIV-1 activity stems from its ability to form dU by deaminating dC in the minus-strand cDNA, thereby facilitating the DNA's degradation by the DNA repair system. For example, DNA glycosylases such as UNG2, a uracil DNA glycosylase packaged into HIV-1 (45, 56), can recognize an altered base, and remove the base by cleavage of the glycosidic bond. The abasic site can be cleaved by apurinic/apyrimidinic endonuclease (APE1), resulting in either a 5'-deoxyribose phosphate group that is a substrate for DNA repair enzymes or in the degradation of the DNA (12). Replacement of dC by dU can also result in altered codon usage (57). Nevertheless, the inhibition of synthesis of DNA by hA3G, rather than the hA3G-facilitated degradation of synthesized DNA, has yet to be ruled out. The initiation of reverse transcription in HIV-1 requires tRNA3Lys as a primer, and this tRNA is packaged into the virus during its assembly. tRNA3Lys is annealed to a region near the 5' end of the viral RNA termed the primer binding site (PBS) and is used to prime the reverse transcriptase-catalyzed synthesis of minus-strand strong stop (-SS) cDNA, the first step in reverse transcription. We previously reported that Vif-negative HIV-1 virions produced from the nonpermissive H9 cell line have a >50% reduction in tRNA3Lys-primed reverse transcription compared with Vif-positive virions (10). At that time, the association of hA3G expression with the nonpermissive cell type was not known. In this report, we show that this reduction in tRNA3Lys priming is due to hA3G and is correlated with a similar reduction in the ability to synthesize -SS viral DNA. Furthermore, this inhibition can occur in the absence of RNA or DNA deamination.


arrow
MATERIALS AND METHODS
 
Plasmid construction, cell transfections, and virus purification. BH10 is a simian virus 40-based vector that contains full-length wild-type HIV-1 proviral DNA. The construction of BH10.Vif- and pAPOBEC3G was described previously (8). BH10Env- and BH10Env-Vif- viruses were constructed by placing two stop codons immediately after the Env start codon in BH10 and BH10Vif- DNA. BH10Env- and BH10Env-Vif- viruses were pseudotyped with G protein of vesicular stomatitis virus (VSV-G) envelope by cotransfection of 293T cells with expression vector DNAs encoding VSV-G envelope protein (pLV/VSV-G; Invitrogen) and BH10Env- or BH10Env-Vif-. The culture of HEK-293T cells, their transfection with these plasmids using Lipofectamine 2000 (Invitrogen, Carlsbad, California), and the isolation of virions 48 h posttransfection from the cell supernatant were done as previously described (8). Viral p24 was measured with a commercial kit available for p24 antigen capture (Abbott Laboratories). The 293 cell line stably transfected with a plasmid expressing hA3G (293A3G) was a gift from Xiao-Fang Yu (Johns Hopkins University). Culture of SupT1, H9, and MT2 cells and their infection with HIV-1 produced from 293T cells were as previously described (8). The construction of all mutant plasmids except hA3G 105-245 has been previously described (8). To construct mutant hA3G 105-245, cDNA sequence coding for amino acids 105 to 245 of hA3G was PCR amplified using the following primers: {Delta}1-104, 5'-TAAGTCGAATTCATGGCCACGTTCCTGGCCGAG; {Delta}246-384, 5'-TAGAAGCTCGAGTCAAGCGTAATCTGGAACATCGTATGGATACTGGTTGCATAGAAAGCC. This fragment was cloned into the EcoRI and XhoI sites of the pcDNA3.1 V5/His A vector.

Viral RNA isolation and quantification. Total viral RNA was extracted from viral pellets by the guanidinium isothiocyanate procedure and dissolved in 5 mM Tris buffer, pH 7.5. As previously described (9), hybridization to dot blots of total viral RNA was carried out with 5'-32P-end-labeled DNA probes complementary to either the 3'-terminal 18 nucleotides of tRNA3Lys (5'-TGGCGCCCGAACAGGGAC) or to the 5' end of the HIV-1 genomic RNA, upstream of the PBS (5'-CTGACGCTCTCGCACCC).

tRNA3Lys priming of reverse transcription. Total viral RNA isolated from virus produced in transfected 293T cells was used as the source of a primer tRNA-template complex in an in vitro reverse transcription reaction and used to measure the amount of extendable tRNA3Lys annealed to viral RNA, as previously described (9). Briefly, total virus RNA was incubated at 37°C in 20 µl of RT buffer (50 mM Tris-HCl [pH 7.5], 60 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol) containing 50 ng of purified HIV RT, 10 U of RNasin, and various deoxynucleotide triphosphates. To measure the ability of annealed tRNA3Lys to be extended by six deoxyribonucleotides, the RT reaction mixture contained 200 µM dCTP, 200 µM dTTP, 5 µCi of [{alpha}-32P]dGTP (0.16 µM), and 50 µM ddATP. Reaction products were resolved using one-dimensional (1D) 6% polyacrylamide gel electrophoresis (PAGE) (9). As a control, human placental tRNA3Lys was annealed to synthetic viral genomic RNA. The tRNA3Lys was purified from human placenta as previously described (24), using standard chromatography procedures (sequentially, DEAE-Sephadex A-50, reverse-phase chromatography [RPC-5], and Porex C4) and, finally, 2D-PAGE. Synthetic HIV-1 genomic RNA (497 bases) was made as previously described (21) from AccI-linearized plasmid pHIV-PBS (2) with the MEGAscript transcription system (Ambion). The synthetic genomic RNA comprises the complete R, U5 region, the PBS, leader, and part of the Gag coding region. In addition to dot blot analysis for determining the amount of viral RNA used in each RT reaction mixture, the relative amounts of viral RNA in the reaction mixtures were also determined by measuring the ability of a DNA annealed at room temperature to the viral RNA to prime synthesis of a 6-base deoxynucleoside triphosphate extension, using the same reaction conditions as for measuring Formula priming. The 30-mer DNA primer used was complementary to BH10 DNA nucleotides 801 to 830 (5'-TCTAATTCTCCCCCGCTTAATACTGACGCT), which are nucleotides 13 to 42 of the Gag coding region, and the 6-base extension, starting with nucleotide 800, is CTCGCA.

Protein analysis. Cellular and viral proteins were extracted with RIPA buffer (10 mM Tris, pH 7.4, 100 mM NaCl, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate [SDS], 1% NP-40, 2 mg/ml aprotinin, 2 mg/ml leupeptin, 1 mg/ml pepstatin A, 100 mg/ml phenylmethylsulfonyl fluoride). The cell and viral lysates were analyzed by SDS-PAGE (10% acrylamide), followed by blotting onto nitrocellulose membranes (Amersham Pharmacia). Western blots were probed with monoclonal antibodies that are specifically reactive with HIV-1 capsid (Zepto Metrocs Inc.), hA3G (NIH AIDS Research and Reference Reagent Program), hemagglutinin (HA; Santa Cruz Biotechnology, Inc.), and ß-actin (Sigma), or with Vif-specific polyclonal antiserum 2221 (NIH AIDS Research and Reference Reagent Program). Detection of proteins was performed by enhanced chemiluminescence (NEN Life Sciences Products), using as secondary antibodies anti-mouse (for hA3G, capsid, HA, and ß-actin) and anti-rabbit (for Vif) antibodies, both obtained from Amersham Life Sciences. Bands in Western blots were quantitated using the UN-SCAN-IT gel automated digitizing system.

Real-time PCR quantitation of newly synthesized HIV-1 DNA. Equal amounts of DNase-treated virions (100 ng p24) were used to infect 1 x 106 SupT1 cells in a volume of 1.5 ml on ice. Following 1-h incubation on ice, the cells with bound viruses were washed twice with phosphate-buffered saline, and aliquots of 1 x 105 cells were plated into six-well plates containing complete RPMI 1640 medium prewarmed to 37°C and incubated at 37°C. At different time points postinfection, equal aliquots of cells were collected and washed with phosphate-buffered saline, and cellular DNA was extracted using the DNeasy tissue kit (QIAGEN). Using equal amounts of cellular genomic DNA (determined spectrophotometrically at an optical density of 260 nm), early (R-U5) and late (U5-gag) minus-strand reverse transcripts were quantitated by the Light Cycler Instrument (Roche Diagnostics GmbH) using the following primers: early RT forward, 5'-TTAGACCAGATCTGAGCCTGGGAG; early RT reverse, 5'-GGGTCTGAGGGATCTCTAGTTACC; late RT forward, 5'-TGTGTGCCCGTCTGTTGTGTGA; late RT reverse, 5'-GAGTCCTGCGTCGAGAGAGCT.

Sequencing of viral RNA and genomic DNA. RT-PCR was performed upon total viral RNA using SuperScript One-Step RT/PCR with Platinum Taq (Invitrogen Life Technologies). The primers were the following: forward primer (469-492), 5'CCAGATCTGAGCCTGGGAGCTC; reverse primer (764-789), 5'CTCCTTCTAGCCTCCGCTATC. The PCR products were inserted into the pCR4-TOPO vector (Invitrogen Life Technologies), and individual clones were sequenced.

The sequencing of viral genomic DNA was performed as follows. Viral supernatants from transfected 293T cells were filtered through 0.45-µm filters and treated with DNase at 20 IU/ml for 1 h at 37°C to prevent proviral DNA carryover. Ten ng viral p24 was used to infect 2 x 105 Sup-T1 cells in a volume of 1.5 ml RPMI medium. After 4 h of incubation, the infected cells were washed twice with phosphate-buffered saline and plated into six-well plates. Complete RPMI 1640 medium prewarmed to 37°C was added to the infection mixture. Cultured cells were collected 24 h postinfection, and DNA was extracted using a DNeasy tissue kit (QIAGEN Inc.). PCR was performed with Platinum Taq polymerase (Invitrogen Life Technologies). The primers were as follows: forward (469 to 492), 5'-CCAGATCTGAGCCTGGGAGCTC; reverse (764 to 789), 5'-CTCCTTCTAGCC TCCGCTAGTC. The PCR products were cloned into pCR4-TOPO vector (Invitrogen Life Technologies), and individual clones were sequenced.

HIV-1 infectivity and MAGI assay. Viruses produced from 293T cells transfected with pAPOBEC3G and HIV-1 proviral DNA were harvested as previously described (13). Measurement of single-round infectivity used the multinuclear-activation galactosidase indicator (MAGI) assay (13, 29). In the MAGI assay, CD4-positive HeLa cells containing the ß-galactosidase gene fused to the HIV-1 long terminal repeat are infected with equal amounts of HIV-1 (equal amounts of p24). Infected cells will have the ß-galactosidase gene expressed, and such cells can be detected using an appropriate substrate for the enzyme, such as 5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside, whose metabolism will turn the cells blue. The number of blue cells is a measure of viral infectivity.


arrow
RESULTS
 
Relative incorporation of genomic RNA and tRNA3Lys, and also relative amount of tRNA3Lys-primed initiation of reverse transcription, in Vif-positive and Vif-negative HIV-1 produced from nonpermissive cell lines H9 and MT2 and from the permissive cell line MT4. In the experiments shown in Fig. 1, the objective was to determine if Vif-negative viruses produced from nonpermissive cells have a reduced ability to initiate reverse transcription compared to either Vif-positive viruses produced from the same cell type or in virions produced from the permissive cell type, MT4. It was necessary to allow only a single round of infection, since Vif-negative viruses produced from nonpermissive cells will nonproductively infect new target cells, resulting in loss of viruses from the medium. A second round of infection is prevented by removal of HIV-1 Env, while the first round of infection can be facilitated by pseudotyping with the VSV envelope protein. Thus, the permissive cell line 293T was first cotransfected with DNA coding for either BH10Env- or BH10Env-Vif- and for pLP/VSV-G DNA coding for the VSV envelope protein. Equal amounts of these VSV-pseudotyped virions were then used to single-round infect either nonpermissive cells (H9 cells or MT2) or, as a control, the permissive cell line MT4. Total viral RNA that had been extracted from an equal number of purified viruses (determined by p24 antigen capture kit [Abbott Laboratories]) was dot blotted, and the amounts of viral genomic RNA and Formula present in each sample were analyzed by dot blot hybridization with labeled DNA probes specific for either viral genomic RNA or Formula, as previously described (9). The results, shown in Fig. 1B, were normalized to those values obtained for BH10Env- and indicated that for the BH10Env-Vif- virions, there is a 30 to 40% decrease in the amount of genomic RNA incorporated, independent of whether viruses are produced in nonpermissive or permissive cells, while no change in Formula packaging is observed. The consistency of the decrease in genomic RNA packaging in the different cell lines, and the lack of change in Formula packaging in these same cell lines, indicates the reproducibility and accuracy of these determinations, i.e., reproducible efficiencies of extraction of viral RNA from fixed amounts of viral p24 were obtained.


Figure 1
View larger version (19K):
[in this window]
[in a new window]
 
FIG. 1. Genomic RNA packaging, Formula packaging, and Formula priming in Vif-positive and Vif-negative HIV-1 produced from the nonpermissive cell lines H9 and MT2 and the permissive cell line MT4. A. The Formula/genomic RNA annealing complex. The first six deoxyribonucleotides incorporated during reverse transcription are underlined. B. (Left) Relative incorporation of viral genomic RNA and Formula into BH10Env- and BH10Env-Vif- produced in MT2, H9, or MT4 cells, as determined by dot blot hybridization with a probe specific for viral RNA or Formula. (Right) Relative priming from equal amounts of viral RNA isolated from BH10Env- and BH10Env-Vif- produced in MT2, H9, or MT4 cells, using either the annealed Formula present in the total viral RNA or an exogenous 30-mer DNA annealed in vitro as primer. The values were determined from the data in panel C. C. 1D-PAGE of radioactive reverse transcription products. (Left) The in vitro reverse transcription reaction, described in Materials and Methods, uses either purified Formula heat annealed in vitro to synthetic viral genomic RNA (lane 1) or total viral RNA, extracted from BH10Env- and BH10Env-Vif- produced in either MT2, H9, or MT4 cells, as the source of primer Formula/viral RNA template. (Right) A 30-mer DNA was annealed at room temperature to the same samples of total viral RNA, and initiation of reverse transcription from this DNA was measured using the same reaction conditions as for Formula-primed reverse transcription.

Formula-primed reverse transcription was measured using total viral RNA in an in vitro reverse transcription assay as the source of the primer Formula annealed to viral genomic RNA in vivo (9, 22). Several pieces of data previously obtained support the assumption that the isolated annealed primer Formula/viral RNA complex used reflects its annealed configuration in vivo. The Formula/genomic RNA complex is thermally stable, i.e., dissociating at temperatures only above 70°C (54), and the free Formula present in total viral RNA does not anneal to genomic RNA under reverse transcriptase conditions, even in the presence of nucleocapsid (9). Using this assay with total viral RNA samples isolated from virions containing wild-type or mutant Gag nucleocapsid has revealed different degrees of Formula annealing (20), which must reflect differences occurring in the viruses since the total viral RNA used in the reverse transcription reaction no longer contains these viral proteins. And, though deproteinized RNA is used in this assay, the continued presence of nucleocapsid protein is not required once nucleocapsid-induced effects upon Formula annealing have occurred (9).

Figure 1A shows the 3'-terminal 18 nucleotides of tRNA3Lys annealed to a complementary region near the 5' terminus of viral RNA known as the PBS. Also shown are the first six deoxynucleotides added to the 3' terminus of Formula during the initiation of reverse transcription, in the order 5'-CTGCTA-3'. Figure 1C, left panel, shows the 1D-PAGE resolution of radioactive Formula extended by 6 bases in the presence of dCTP, dTTP, ddATP, and 5 µCi of [{alpha}-32P]dGTP, as described in Materials and Methods. There is also a slower-moving tRNA extension product that may represent misincorporation at position 6 rather than ddATP, which would result in ddATP being incorporated at a later position in the DNA. Lane 1 represents purified human placental Formula heat annealed in vitro to synthetic viral genomic RNA, while the other lanes represent reactions using total viral RNA as the source of primer/template and contain equal amounts of genomic RNA, as determined by dot blot hybridization. The quantitation of the data measured only the faster-moving band, since an initial measuring of both bands did not give different results. These results are listed on the right side of the table in Fig. 1B. The data were normalized to BH10Env- and indicated that the RNA from Vif-negative virions produced from nonpermissive cells (MT2 or H9 cells) show a 40 to 60% reduction in the ability to extend Formula 6 bases, while the RNA from Vif-negative virions produced from the permissive MT4 cells shows a slight increase in priming ability. Thus, the reduction in the initiation of reverse transcription is not correlated with the reduction in viral RNA seen in Vif-negative viruses but rather with whether the cell producing the viruses is permissive or nonpermissive.

To determine that the variation in Formula priming is not due to variation in the amounts of viral genomic RNA used, equal amounts of viral genomic RNA, as determined from dot blot hybridizations, were also tested for their ability to extend by 6 bases a 30-mer DNA oligomer primer annealed at room temperature to the viral RNA (see Materials and Methods). The right-hand panels in Fig. 1B and C show that equal amounts of viral RNA in the reaction mixture, as determined by dot blot hybridization, produce equal amounts of DNA-primed extension products and demonstrate that the variation in Formula priming seen in the left-hand panel in Fig. 1C is not due to variation in the amount of viral RNA used.

Effect of hA3G expression in 293T cells on tRNA3Lys priming in HIV-1. Because the nonpermissive cells express hA3G and Vif induces hA3G degradation in the cytoplasm, hA3G is a candidate inhibitor of Formula priming of reverse transcription in Vif-negative virions. We therefore tested whether the coexpression of virus and hA3G in the permissive cell line 293T, which does not express hA3G, would also result in a reduction in the ability of Formula to prime reverse transcription. 293T cells were cotransfected with 2 µg of plasmid containing either BH10 or BH10Vif- DNA and 1 µg pcDNA3.1, either empty or containing DNA coding for hA3G. Thus, four types of viruses were produced: wild-type viruses (BH10) in the absence or presence of hA3G and Vif-negative viruses (BH10Vif-) in the absence or presence of hA3G. The protein composition of lysates of the different cells and of the extracellular virions produced from them is shown in the Western blots in Fig. 2A and B, respectively. Using aliquots of cell lysates containing equal amounts of ß-actin (Fig. 2A, panel 4), these results show that cells expressing BH10Vif- viral proteins contain the normal pattern of viral Gag and capsid proteins (Fig. 2A, panel 3) but lack Vif (Fig. 2A, panel 1). The reduction in the concentration of both cellular and viral hA3G in the presence of Vif is shown, respectively, in Fig. 2A, panel 2, and B, panel 1. The reduction in cellular expression has been attributed to both inhibition of hA3G translation and its Vif-facilitated degradation in the cytoplasm by proteosomes (50, 58). It can also be seen in Fig. 2B that viral hA3G migrates as two bands. This observation has been reported many times (8, 27, 34, 36-40, 55) and is due to the cleavage of hA3G by HIV-1 protease, since cleavage is not observed in either protease-negative HIV-1 or in the presence of protease inhibitors (data not shown). The effect of this hA3G cleavage on its activity is not known.


Figure 2
View larger version (24K):
[in this window]
[in a new window]
 
FIG. 2. Genomic RNA packaging, Formula packaging, and Formula priming in Vif-positive and Vif-negative HIV-1 produced from 293T cells in the presence or absence of hA3G. (A and B) Incorporation of protein. 293T cells were cotransfected with 2 µg of plasmid containing either BH10 or BH10Vif- DNA, and 1 µg pcDNA3.1, either empty or containing DNA coding for hA3G. Western blots of cell (A) or viral (B) lysates were normalized to ß-actin and p24, respectively. (A) Blots were probed with anti-Vif, anti-HA, anti-CA, and anti-ß-actin. (B) Blots were probed with anti-HA and anti-CA. (C) Data for incorporation of Formula probes specific for Formula and viral RNA. (D) Formula priming and 1D-PAGE of radioactive reverse transcription products. (Left) The in vitro reverse transcription reaction, described in Materials and Methods, using either purified Formula heat annealed in vitro to synthetic viral genomic RNA (lane 1) or total viral RNA (containing equal amounts of viral genomic RNA), extracted from the four types of virions as the source of primer Formula/viral RNA template. Quantitation of RT products by phosphorimaging is shown on the right. Bars: a, BH10 and pcDNA3.1; b, BH10Vif- and pcDNA3.1; c, BH10 and hA3G; d, BH10Vif- and hA3G.

We next examined the ability of either viral RNA or Formula to be selectively packaged into all four types of virions. Total viral RNA was extracted from equal amounts of virions (i.e., equal amounts of viral p24) and analyzed by dot blot hybridization with probes specific for Formula or viral genomic RNA, as previously described (9). Although the data in Fig. 1B showed that BH10Env-Vif- virions package approximately 30% less viral RNA than BH10Env- virions when produced in either nonpermissive MT2 or H9 cells, or the permissive MT4 cell line, the data in Fig. 2C show no difference in the incorporation of either Formula or genomic RNA in the different viral types produced from 293T cells expressing hA3G.

We next examined the ability of total viral RNA extracted from each of the four viral types to support reverse transcription. Equal amounts of total viral RNA (determined by dot blot hybridization of viral genomic RNA and confirmed by DNA priming, as described for Fig. 1) were used to extend annealed Formula by 6 bases in the in vitro reverse transcription assay described above for the experiments in Fig. 1. Figure 2D shows the radioactive Formula extended by 6 bases in the presence of ddATP and resolved by 1D-PAGE. Lane 1 represents purified human placental Formula heat annealed in vitro to synthetic viral genomic RNA, while lanes 2 through 5 show equal amounts of total viral RNA isolated from the four types of virions as the source of primer/template. These results, shown graphically on the right side of the panel, indicate that Formula priming remains unchanged for three of the viral types but is reduced 55% when Vif-negative virions are produced from 293T cells expressing hA3G (lane 5).

Inhibition of early and late viral DNA synthesis in cells infected with Vif-negative virions exposed to hA3G. We next determined if the hA3G-induced inhibition of Formula-primed reverse transcription was reflected in the synthesis of minus-strand strong stop DNA in infected cells. We examined the viral DNA content in the permissive T-lymphocyte cell line SupT1 infected with equal amounts of one of the four types of virions: BH10, with or without hA3G, and BH10Vif-, with or without hA3G. These viruses were produced as described for Fig. 2. Both early -SS DNA (R-U5) synthesis and late (U5-gag) DNA synthesis were monitored over the 24 h postinfection using real-time fluorescence-monitored PCR with equal amounts of cellular DNA, and the results are graphed in Fig. 3. The PCR-amplified regions of viral DNA examined are shown in panel A of Fig. 3. -SS PCR products reached a maximum concentration at 8 h postinfection (Fig. 3B), while late viral DNA production reached a maximum concentration at 12 h postinfection (Fig. 3C). As previously reported by others (17, 34, 36), we have found that in cells infected with Vif-negative HIV-1 exposed to hA3G, the -SS DNA synthesis is reduced to about 45% of that of wild-type viruses, while the production of late viral DNA sequences is reduced to 5% of that produced in wild-type viruses. After 8 h, the abundance of -SS DNA declined in cells infected by all viral types. This phenomenon has been previously reported (7) and is probably a result of viral DNA degradation by the cell, since it has been shown that most viral DNA synthesized in the cell is not converted into integrated proviral DNA (7, 17). The increased DNA in the cell culture after 18 h, seen for all viral types except Vif-negative virions exposed to hA3G, is probably due to new infections. This increase is highly reduced for Vif-negative HIV-1 exposed to hA3G, presumably because of reduced infectivity of the viruses due to deamination in the proviral DNA. Mutations in the proviral DNA caused by deamination will diminish integrated provirus formation (39), block translation start codons (57), and likely alter open reading frame codons, perturbing protein production and viral output and infectivity.


Figure 3
View larger version (27K):
[in this window]
[in a new window]
 
FIG. 3. Real-time PCR quantitation of newly synthesized HIV-1 DNA. DNA was extracted at different times postinfection from SupT1 cells infected with the four viral types: BH10, plus or minus hA3G, and BH10Vif-, plus or minus hA3G. Early (R-U5) and late (U5-gag) minus-strand cDNA production was monitored by real-time PCR, as described in Materials and Methods. (A) Arrows indicate the PCR primers used to detect early (U5a-R) and late (gag-U5b) minus-strand DNA. (B and C) Graphs on the right show the postinfection time course of production of viral early (B) and late (C) DNA in SupT1 cells infected with one of the four viral types. Data on the left were normalized to peak DNA production for BH10 in the absence of hA3G. Bars: a, BH10 and pcDNA3.1; b, BH10Vif- and pcDNA3.1; c, BH10 and hA3G; d, BH10Vif- and hA3G.

293T cells require greater expression of hA3G than is found in H9 cells to achieve similar reductions in viral tRNA3Lys priming and viral infectivity. In this section, we provide evidence that significantly more hA3G is required to inhibit both Formula priming and viral infectivity of BH10Vif- produced in 293T cells than is required to produce similar inhibition in BH10Vif- produced from H9 cells. We first determined the relative amounts of hA3G required in these two cell types to produce a similar inhibition of Formula priming of reverse transcription. As shown in Fig. 4, the inhibition of Formula priming in BH10Vif-negative viruses produced in 293T cells is dependent upon the amount of hA3G expressed in the cell and incorporated into the virus. Both wild-type and Vif-negative viruses were produced in the absence or presence of increasing amounts of hA3G. Western blot analysis of cell (Fig. 4A) or viral (Fig. 4B) lysates demonstrated that 293T cells cotransfected with both HIV-1 DNA and increasing amounts of pAPOBEC3G show increases in hA3G in the cell, and these increases are much larger when the viruses are not able to express Vif (Fig. 4A). Figure 4B shows that the amount of hA3G incorporated into the virus is proportional to the amount expressed in the cell.


Figure 4
View larger version (20K):
[in this window]
[in a new window]
 
FIG. 4. Effects of increasing amounts of hA3G upon Formula-primed reverse transcription and viral infectivity in wild-type and Vif-negative HIV-1 produced from 293T cells. (A and B) Western blots of cell (A) or viral (B) lysates. In panel A, blots were probed with anti-HA and anti-ß-actin. In panel B, blots were probed with anti-HA and anti-CA. (C, left) 1D-PAGE of radioactive reverse transcription products (Formula extended 6 bases, as described in Materials and Methods), using total viral RNA as the source of primer Formula/viral RNA template. (Right) Quantitation of RT products by phosphorimaging. (D) Western blots of lysates of BH10Env-, with or without Vif, produced in H9 cells and of lysates of BH10, with or without Vif, produced in 293T cells also transiently transfected with 1 µg pAPOBEC3G. Blots were probed with anti-hA3G and anti-CAp24. (E) Infectivity in HeLa-CD4+ cells of HIV-1 produced in 293T cells containing increasing amounts of hA3G, as measured in a MAGI assay.

Total viral RNA was isolated from these different virions, and the amount of Formula priming was measured using total viral RNA containing equal amounts of viral genomic RNA, as described for the experiments shown in Fig. 1 and 2. The left panel of Fig. 4C shows the 6-base-extended products resolved by 1D-PAGE. As in Fig. 2, the lower electrophoretic band, representing the 6-base-extended Formula, was quantitated by phosphorimaging (Bio-Rad), and the results, plotted in the right panel of Fig. 4C, show a direct correlation between the ability of hA3G to get into the virion and the inhibition of Formula priming of reverse transcription.

We have compared the relative amounts of hA3G present in H9-produced virions and in viruses produced in transiently transfected 293T cells that result in similar reductions in Formula priming. Figure 4D shows Western blots of lysates of Vif-positive or Vif-negative viruses produced from either infected H9 cells or transfected 293T cells cotransfected with 1 µg of pAPOBEC3G, which codes for hA3G containing an HA tag. A comparison of the hA3G/p24 ratios showed that the amount of viral hA3G required to produce a 55% reduction in Formula priming in 293T cells is approximately 15 times the amount of viral hA3G required to produce a 40 to 60% reduction in Formula priming in virions produced from H9 cells. Endogenous hA3G produced in H9 cells is untagged, while the hA3G produced in transiently or stably transfected 293T cells is C-terminally tagged with HA. However, we do not expect any difference in the affinity of anti-hA3G for tagged or untagged hA3G, since in Western blot assays, the antibody is reacting with a linear epitope in a denatured protein. In support of this, we have found, using Western blots probed with anti-hA3G, that the expression of tagged or untagged hA3G in 293T cells transfected with equal amounts of plasmid DNA for either molecule results in the same level of cytoplasmic expression of tagged or untagged hA3G (data not shown), indicating no difference in the affinity of antibody for these two types of molecules.

There is thus a greater ability of hA3G to inhibit Formula priming in the nonpermissive cell line H9 than in the transiently transfected 293T cells. This might reflect the fact that all the H9 cells are making hA3G, while both the number of transfected 293T cells expressing hA3G and the expression of hA3G/transfected cell might vary. We therefore transfected a 293 cell line stably expressing hA3G (generously donated by X. F. Yu [Johns Hopkins University]) with BH10Env- or BH10Vif-Env-. We also transfected DNA for these virions into 293T cells transiently expressing hA3G. The results, shown in Fig. 5, show no significant differences between 293T cells transiently or stably expressing hA3G and producing either BH10 or BH10Vif- with regard to the amount of hA3G packaged in the virions, the viral incorporation of both Formula and viral genomic RNA, and the inhibition of Formula priming. These results demonstrate that the expression of hA3G in 293T cells is not sufficient to produce the full nonpermissive phenotype found in H9 or MT2 cells. They also indicate that the reduced viral RNA packaging seen in Vif-negative virions produced from nonpermissive H9 and MT2 cells, and from the permissive MT4 cells (Fig. 1), is not related to the Env-minus phenotype used in those experiments.


Figure 5
View larger version (19K):
[in this window]
[in a new window]
 
FIG. 5. hA3G incorporation, Formula and genomic RNA packaging, and Formula priming in Vif-positive and Vif-negative HIV-1 produced from H9 cells, 293T cells transiently expressing hA3G, and a 293 cell line stably expressing APOBEC3G. Cells were transfected with DNA coding for either BH10Env- or BH10Vif-Env- as described in Materials and Methods. The cells included a 293 cell line stably expressing hA3G and 293T cells transiently expressing hA3G. H9 cells were also infected with BH10Env- or BH10Vif-Env- pseudotyped with VSV-G. (A) Western blots of lysates of BH10Env-, with or without Vif, produced from the different cell types. Blots were probed with anti-hA3G and anti-CAp24. (B) 1D-PAGE of radioactive reverse transcription products (Formula extended 6 bases, as described in Materials and Methods), using viral RNA extracted from the different types of virions as the source of primer Formula/viral RNA template. (C, left) Relative incorporation of viral genomic RNA and Formula into BH10Env- and BH10Env-Vif- produced in the three cell types, as determined by dot blot hybridization with a probe specific for viral RNA or Formula. (Right) Relative priming from equal amounts of viral RNA isolated from BH10Env- and BH10Env-Vif- produced in the three cell types, as determined from the data in panel B.

The effect of increased hA3G expression upon viral infectivity in Vif-positive and Vif-negative viruses, as measured by the MAGI assay, is shown in Fig. 4E. Comparison of these data to the graph in Fig. 4C shows that with increasing hA3G, viral infectivity decreases faster than Formula priming. This was expected, since, as shown in Fig. 3, late viral DNA production also decreases faster than early DNA production. Thus, for virions produced from 293T cells transiently transfected with 1 µg hA3G plasmid, late DNA production in newly infected cells drops to 5% that found for virions not containing hA3G, and this is reflected in a similar decrease in infectivity of these virions (Fig. 4E).

As shown in Fig. 4D, Vif-negative viruses produced from H9 cells contain approximately 6% of the amount of hA3G found in Vif-negative viruses produced from 293T cells transfected with 1 µg hA3G plasmid. The single-round viral infectivity of Vif-minus HIV-1 produced in H9 cells, as measured by the MAGI assay, has been reported to be reduced ≥99%, compared to the infectivity of Vif-positive virions (5, 6, 35). Using the MAGI assay, we have confirmed this observation (data not shown). It can also be seen in Fig. 4E that at the same estimated concentration of hA3G in transfected 293T cells as is found in H9 cells (using 0.06 µg pAPOBEC3G), viral infectivity is only reduced 50%. Thus, as with Formula priming, the inhibition of viral infectivity is produced more efficiently with endogenous hA3G in H9 cells than with exogenous hA3G expressed in transfected 293T cells.

hA3G-induced deamination of RNA or DNA is not required for the antiviral effects of hA3G. Previous works reported that neither HIV-1 RNA (36, 60) nor Formula (57) underwent hA3G-induced deamination. We have verified this conclusion (data not shown) for genomic RNA through sequencing of RT-PCR products representing viral RNA sequences starting at the C-15 in the R region and ending immediately after stem-loop 3 of the leader sequence, which represent any known sequences in viral RNA postulated to be involved in Formula annealing (30).

An investigation in which either zinc coordination motif in hA3G was inactivated with mutations has revealed that while only the C-terminal site is actively involved in DNA deamination, hA3G with an inactive C-terminal zinc coordination motif still retains most of its antiviral function (42). To further test the conclusion that deamination is not required for at least some of the antiviral effects of hA3G, 293T cells were cotransfected with BH10Vif- DNA and DNA coding for an N-terminal fragment, hA3G1-156, containing amino acids 1 to 156, or a C-terminal fragment of hA3G, hA3G105-384, containing amino acids 104 to 384. Each peptide contains one zinc coordination motif, and both peptides have been shown to be efficiently incorporated into HIV-1 (8). DNA was extracted from these cells, and PCR products representing the BH10 DNA sequence 492-764 (containing sequences starting in the C-15 in the R region and ending immediately after stem-loop 3 in the leader region) were sequenced and examined for mutations. Neither hA3G1-156 nor hA3G105-384 are capable of creating G-A deamination mutations in the BH10 DNA sequence 492-764. This inability to deaminate DNA is shown in Table 1. While viral packaging of wild-type hA3G produces a total of 31 G-A mutations in six clones sequenced, no G-A mutations are seen when virions package either hA3G1-156 or hA3G105-384. The relative infectivity of the different viral types was measured by the MAGI assay (29). As shown in Table 1, wild-type hA3G reduces infectivity of BH10Vif- virions >90%, while the N- and C-terminal fragments in the virions reduce viral infectivity >60% and 70%, respectively, of the infectivity achieved with BH10Vif- in the absence of hA3G.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Viral DNA hypermutation and antiviral activity of wild-type and mutant APOBEC3G

The abilities of mutant forms of hA3G to inhibit early and late DNA synthesis and Formula priming were examined next. The mutant forms of hA3G used are shown in Fig. 6A. These mutant species were previously used to map amino acids 104 to 156 as sequences containing the site in hA3G required for its incorporation into HIV-1 (8). The cellular expression and viral incorporation of these truncated species were also reported in that paper, except for hA3G104-246, which is also incorporated efficiently into virions (data not shown). Using real-time fluorescence-monitored PCR, as described for Fig. 3, the effects of expression of the mutant forms of hA3G upon both early minus-strand strong stop DNA synthesis (Fig. 6B) and late viral DNA synthesis (Fig. 6C) were monitored over 24 h postinfection, using the same time points postinfection as used for the experiment shown in Fig. 3. The results are shown graphically in Fig. 6B and C. Both hA3G1-156 and hA3G105-384 reduce early and late DNA synthesis, although not as strongly as the reductions due to full-length hA3G. hA3G105-384 has somewhat stronger inhibitory powers than hA3G1-156. If amino acids 104 to 156 are missing from the C-terminal fragment hA3G157-384, no inhibition of viral DNA synthesis is seen, presumably because this fragment is not incorporated into the virion (8). Also, hA3G missing both N- and C-terminal sequences containing the zinc coordination motifs (hA3G104-246) is not able to inhibit viral DNA synthesis, although it is incorporated into the virions.


Figure 6
View larger version (28K):
[in this window]
[in a new window]
 
FIG. 6. Viral early and late DNA production and Formula priming in SupT1 cells infected with BH10Vif- containing either wild-type or mutant hA3G. SupT1 cells were infected with BH10Vif- containing either no hA3G (a), wild-type hA3G (b), or mutant hA3G (c to f). (A) Graphic representation of the wild-type and mutant APOBEC3G variants tested. a, no hA3G; b, wild-type hA3G; c, hA3G105-384; d, hA3G157-384; e, hA3G1-156; f, hA3G104-246. The filled rectangles represent the two catalytic sites (zinc coordination units) in hA3G, and the numbers represent the amino acid positions. (B and C) Early and late viral DNA production. DNA was extracted at different times postinfection from SupT1 cells infected with the different viruses. Early (R-U5) and late (U5-gag) minus-strand cDNA production was monitored by real-time PCR, as described in Materials and Methods, using the same PCR primers as shown in Fig. 3A. Production of viral early DNA (B) and late DNA (C) in SupT1 cells infected with the different viruses was normalized to DNA production for BH10Vif- in the absence of hA3G (a). (D) Formula priming in BH10Vif- containing wild-type or mutant hA3G. Total viral RNA was extracted from BH10Vif- containing either no hA3G (a), wild-type hA3G (b), or mutant hA3G (c to f). Synthesis of the six-base-extended Formula in an in vitro reverse transcription reaction, using total viral RNA as the source of primer Formula/viral RNA template, is described in Materials and Methods. Formula extension was normalized to that obtained for BH10Vif- containing no hA3G.

Total viral RNA was isolated from these different virions, and Formula priming was measured as described for the experiment shown in Fig. 4C. The electrophoretic bands were quantitated by phosphorimaging (Bio-Rad), and the results, plotted in Fig. 6D, were normalized to that found for BH10Vif- lacking hA3G sequences. Both hA3G1-156 and hA3G105-384 inhibit Formula priming, although less so than full-length hA3G. The C-terminal fragment inhibits priming slightly more than the N-terminal fragment. Mutant hA3G unable to be incorporated into virions (hA3G157-384) shows no ability to inhibit Formula priming, nor does hA3G104-246, which lacks both N- and C-terminal regions. A comparison between panels B, C, and D of Fig. 6 shows a strong correlation between the abilities of wild-type and mutant hA3G to inhibit Formula priming and their abilities to inhibit early and late viral DNA synthesis.


arrow
DISCUSSION
 
In this work, we have shown that when Vif-negative viruses containing hA3G infect cells, a reduction of early and late viral DNA production and viral infectivity can occur independently of DNA deamination by hA3G (Fig. 6 and Table 1). N- or C-terminal fragments of hA3G missing either the N- or C-terminal zinc coordination units retain >70% of the ability of wild-type hA3G to inhibit Formula priming, early and late viral DNA synthesis, and viral infectivity. The incomplete inhibition of these processes by hA3G fragments missing either zinc coordination unit could indicate that some antiviral activity is the result of viral DNA deamination, but this could also be due to loss of other functions associated with either zinc coordination unit, such as nucleic acid binding. Other reports have also shown antiviral activity of hA3G against both HIV-1 (18, 42) and hepatitis B virus (52), independent of its cytidine deaminase activity, and a recent paper reported that hA3A inhibits retrotransposition by the intracisternal A particle retrotransposon in human cells without editing the intracisternal A particle reverse transcripts (4).

We have further shown a correlation between the inhibition of early viral DNA synthesis and the inhibition of tRNA3Lys priming, suggesting that the decreased early DNA production is due to decreased initiation of reverse transcription. Whether this is due to decreased Formula annealing to viral RNA or to an altered configuration of the Formula/viral RNA hybrid remains to be determined.

Because increasing viral hA3G causes a more rapid decrease in viral infectivity than in Formula priming alone (Fig. 4C and E), parameters other than the 50 to 55% decrease in initiation of reverse transcription must also be required to explain a 96% reduction in viral infectivity. The greater reduction in late DNA production could account for this decrease in viral infectivity. While the mechanism that inhibits late DNA production is not known, it does not appear to be dependent only, if at all, upon cytidine deamination (Table 1 and Fig. 6). In seeking a common mechanism by which both early and late DNA synthesis are reduced, one can consider that both Formula annealing to viral RNA and DNA strand transfers in reverse transcription are both facilitated by viral nucleocapsid protein (33). There is also general agreement that nucleocapsid (NC) sequences are required for the incorporation of hA3G into HIV-1, although a controversy remains whether this is due to a direct interaction between hA3G and NC (1, 8) or whether an RNA bridge between these two molecules is involved (28, 44, 59). Nevertheless, the possibility exists that early and late DNA synthesis are inhibited by an interaction between hA3G and the molecule that facilitates these reactions, nucleocapsid.

Current experimental data to support the role of hA3G deamination of DNA in either the degradation of viral DNA or in any other antiviral activity remain inconclusive. Since the deamination mutations in DNA result in the replacement of C with U, attempts have also been made to study the dependency on the antiviral effects of hA3G upon the enzymes involved in replacing the U lesion, which can lead to DNA degradation. For example, the cellular uracil DNA glycosylase, UNG2, is incorporated into HIV-1 by binding to both Vpr and integrase (45, 56). UNG2 is a major cellular enzyme that removes uracil from DNA, thereby leaving an abasic residue in the DNA phosphodiester backbone, which can be excised by an endonuclease. If no cDNA strand were present, this could lead to DNA degradation. Studies have been made to examine the effect of decreasing viral UNG2 upon the antiviral effects of hA3G, i.e., upon the A3G-induced reduction of viral DNA synthesis and viral infectivity, and the conclusions of these studies have been mixed. Thus, prevention of UNG2 incorporation into HIV-1 (using either small interfering RNA to UNG2 or a UNG inhibitor, UGI) was reported to reduce the antiviral effects of hA3G in one report (43). But, in a more recent report, using either the same UNG inhibitor UGI (but codon optimized to increase its expression) or using cells lacking endogenous UNG2 activity, the missing viral UNG2 had no effect on the antiviral effects of hA3G, i.e., in the presence of hA3G, viral infectivity and DNA transcripts were reduced equally with or without viral UNG2 (25). It is of course possible that other uracil DNA glycosylases can substitute for UNG2, but this has not been determined.

There is also no evidence that hA3G can deaminate RNA. However, other members of the APOBEC family do deaminate RNA (23), and recent work has provided evidence that a member of the rat APOBEC family, rat APOBEC 1, can deaminate both wild-type and Vif-negative HIV-1 genomic RNA and produce a strong decrease in viral infectivity (3). Nevertheless, others (36, 57, 60) and ourselves in this report have found no evidence for deamination of either viral RNA or Formula.

We have also presented evidence that the expression of hA3G in the permissive 293T cell line does not inhibit Formula priming or viral infectivity with the same efficiency as endogenous hA3G found in native nonpermissive H9 cells (Fig. 4). This suggests the presence of other "nonpermissive" factors in the H9 cells. One such factor might be hA3F, which is produced in H9 cells but not in 293T cells and which can also inhibit Formula priming (data not shown), but other factors that might together produce the nonpermisssive phenotype remain to be determined.


arrow
ACKNOWLEDGMENTS
 
This work was supported by grants from the National Institutes of Health (United States) and the Canadian Institutes for Health Research (Canada).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Lady Davis Institute for Medical Research, Jewish General Hospital, 3755 Cote St. Catherine Rd., Montreal, Quebec, Canada H3T 1E2. Phone: (514) 340-8260. Fax: (514) 340-7502. E-mail: lawrence.kleiman{at}mcgill.ca. Back

{triangledown} Published ahead of print on 13 September 2006. Back


arrow
REFERENCES
 
    1
  1. Alce, T. M., and W. Popik. 2004. APOBEC3G is incorporated into virus-like particles by a direct interaction with HIV-1 Gag nucleocapsid protein. J. Biol. Chem. 279:34083-34086.[Abstract/Free Full Text]
  2. 2
  3. Arts, E. J., X. Li, Z. Gu, L. Kleiman, M. A. Parniak, and M. A. Wainberg. 1994. Comparison of deoxyoligonucleotide and tRNA(Lys-3) as primers in an endogenous human immunodeficiency virus-1 in vitro reverse transcription/template-switching reaction. J. Biol. Chem. 269:14672-14680.[Abstract/Free Full Text]
  4. 3
  5. Bishop, K. N., R. K. Holmes, A. M. Sheehy, and M. H. Malim. 2004. APOBEC-mediated editing of viral RNA. Science 305:645.[Abstract/Free Full Text]
  6. 4
  7. Bogerd, H. P., H. L. Wiegand, B. P. Doehle, K. K. Lueders, and B. R. Cullen. 2006. APOBEC3A and APOBEC3B are potent inhibitors of LTR-retrotransposon function in human cells. Nucleic Acids Res. 34:89-95.[Abstract/Free Full Text]
  8. 5
  9. Borman, A. M., C. Quillent, P. Charneau, C. Dauguet, and F. Clavel. 1995. Human immunodeficiency virus type 1 Vif- mutant particles from restrictive cells: role of Vif in correct particle assembly and infectivity. J. Virol. 69:2058-2067.[Abstract]
  10. 6
  11. Bouyac, M., F. Rey, M. Nascimbeni, M. Courcoul, J. Sire, D. Blanc, F. Clavel, R. Vigne, and B. Spire. 1997. Phenotypically Vif- human immunodeficiency virus type 1 is produced by chronically infected restrictive cells. J. Virol. 71:2473-2477.[Abstract]
  12. 7
  13. Butler, S. L., M. S. Hansen, and F. D. Bushman. 2001. A quantitative assay for HIV DNA integration in vivo. Nat. Med. 7:631-634.[CrossRef][Medline]
  14. 8
  15. Cen, S., F. Guo, M. Niu, J. Saadatmand, J. Deflassieux, and L. Kleiman. 2004. The interaction between HIV-1 Gag and APOBEC3G. J. Biol. Chem. 279:33177-33184.[Abstract/Free Full Text]
  16. 9
  17. Cen, S., A. Khorchid, J. Gabor, L. Rong, M. A. Wainberg, and L. Kleiman. 2000. The role of Pr55gag and NCp7 in Formula genomic placement and the initiation step of reverse transcription in human immunodeficiency virus type 1. J. Virol. 74:10796-10800.[Abstract/Free Full Text]
  18. 10
  19. Dettenhofer, M., S. Cen, B. A. Carlson, L. Kleiman, and X. F. Yu. 2000. Association of human immunodeficiency virus type 1 Vif with RNA and its role in reverse transcription. J. Virol. 74:8938-8945.[Abstract/Free Full Text]
  20. 11
  21. Fisher, A. G., B. Ensoli, L. Ivanoff, M. Chamberlain, S. Petteway, L. Ratner, R. C. Gallo, and F. Wong-Staal. 1987. The sor gene of HIV-1 is required for efficient virus transmission in vitro. Science 237:888-893.[Abstract/Free Full Text]
  22. 12
  23. Fromme, J. C., and G. L. Verdine. 2004. Base excision repair. Adv. Protein Chem. 69:1-41.[Medline]
  24. 13
  25. Gabor, J., S. Cen, H. Javanbakht, M. Niu, and L. Kleiman. 2002. Effect of altering the Formula concentration in human immunodeficiency virus type 1 upon its annealing to viral RNA, Gag-Pol incorporation, and viral infectivity. J. Virol. 76:9096-9102.[Abstract/Free Full Text]
  26. 14
  27. Gabuzda, D. H., K. Lawrence, E. Langhoff, E. Terwilliger, T. Dorfman, W. A. Haseltine, and J. Sodroski. 1992. Role of Vif in replication of human immunodeficiency virus type 1 in CD4+ T lymphocytes. J. Virol. 66:6489-6495.[Abstract/Free Full Text]
  28. 15
  29. Gaddis, N. C., E. Chertova, A. M. Sheehy, L. E. Henderson, and M. H. Malim. 2003. Comprehensive investigation of the molecular defect in Vif-deficient human immunodeficiency virus type 1 virions. J. Virol. 77:5810-5820.[Abstract/Free Full Text]
  30. 16
  31. Gibbs, J. S., D. A. Regier, and R. C. Desrosiers. 1994. Construction and in vitro properties of SIVmac mutants with deletions in "nonessential" genes. AIDS Res. Hum. Retrovir. 10:607-616.[Medline]
  32. 17
  33. Goncalves, J., Y. Korin, J. Zack, and D. Gabuzda. 1996. Role of Vif in human immunodeficiency virus type 1 reverse transcription. J. Virol. 70:8701-8709.[Abstract]
  34. 18
  35. Hache, G., M. T. Liddament, and R. S. Harris. 2005. The retroviral hypermutation specificity of APOBEC3F and APOBEC3G is governed by the C-terminal DNA cytosine deaminase domain. J. Biol. Chem. 280:10920-10924.[Abstract/Free Full Text]
  36. 19
  37. Harris, R. S., K. N. Bishop, A. M. Sheehy, H. M. Craig, S. K. Petersen-Mahrt, I. N. Watt, M. S. Neuberger, and M. H. Malim. 2003. DNA deamination mediates innate immunity to retroviral infection. Cell 113:803-809.[CrossRef][Medline]
  38. 20
  39. Huang, Y., A. Khorchid, J. Wang, M. A. Parniak, J. Darlix, M. A. Wainberg, and L. Kleiman. 1997. Effect of mutations in nucleocapsid protein (NCp7) upon Pr160gag-pol and tRNALys incorporation into HIV-1. J. Virol. 71:4378-4384.[Abstract]
  40. 21
  41. Huang, Y., A. Shalom, Z. Li, J. Wang, J. Mak, M. A. Wainberg, and L. Kleiman. 1996. Effects of modifying the Formula anticodon on the initiation of human immunodeficiency virus type 1 reverse transcription. J. Virol. 70:4700-4706.[Abstract]
  42. 22
  43. Huang, Y., J. Wang, A. Shalom, Z. Li, A. Khorchid, M. A. Wainberg, and L. Kleiman. 1997. Primer Formula on the viral genome exists in unextended and two base- extended forms within mature human immunodeficiency virus type 1. J. Virol. 71:726-728.[Abstract]
  44. 23
  45. Jarmuz, A., A. Chester, J. Bayliss, J. Gisbourne, I. Dunham, J. Scott, and N. Navaratnam. 2002. An anthropoid-specific locus of orphan C to U RNA-editing enzymes on chromosome 22. Genomics 79:285-296.[CrossRef][Medline]
  46. 24
  47. Jiang, M., J. Mak, A. Ladha, E. Cohen, M. Klein, B. Rovinski, and L. Kleiman. 1993. Identification of tRNAs incorporated into wild-type and mutant human immunodeficiency virus type 1. J. Virol. 67:3246-3253.[Abstract/Free Full Text]
  48. 25
  49. Kaiser, S. M., and M. Emerman. 2006. Uracil DNA glycosylase is dispensable for human immunodeficiency virus type 1 replication and does not contribute to the antiviral effects of the cytidine deaminase APOBEC3G. J. Virol. 80:875-882.[Abstract/Free Full Text]
  50. 26
  51. Kan, N. C., G. Franchini, F. Wong-Staal, G. C. DuBois, W. G. Robey, J. A. Lautenberger, and T. S. Papas. 1986. Identification of HTLV-III/LAV sor gene product and detection of antibodies in human sera. Science 231:1553-1555.[Abstract/Free Full Text]
  52. 27
  53. Kao, S., M. A. Khan, E. Miyagi, R. Plishka, A. Buckler-White, and K. Strebel. 2003. The human immunodeficiency virus type 1 Vif protein reduces intracellular expression and inhibits packaging of APOBEC3G (CEM15), a cellular inhibitor of virus infectivity. J. Virol. 77:11398-11407.[Abstract/Free Full Text]
  54. 28
  55. Khan, M. A., S. Kao, E. Miyagi, H. Takeuchi, R. Goila-Gaur, S. Opi, C. L. Gipson, T. G. Parslow, H. Ly, and K. Strebel. 2005. Viral RNA is required for the association of APOBEC3G with human immunodeficiency virus type 1 nucleoprotein complexes. J. Virol. 79:5870-5874.[Abstract/Free Full Text]
  56. 29
  57. Kimpton, J., and M. Emerman. 1992. Detection of replication-competent and pseudotyped human immunodeficiency virus with a sensitive cell line on the basis of activation of an integrated ß-galactosidase gene. J. Virol. 66:2232-2239.[Abstract/Free Full Text]
  58. 30
  59. Kleiman, L., R. Halwani, and H. Javanbakht. 2004. The selective packaging and annealing of primer tRNALys3 in HIV-1. Curr. HIV Res. 2:163-175.[CrossRef][Medline]
  60. 31
  61. Lecossier, D., F. Bouchonnet, F. Clavel, and A. J. Hance. 2003. Hypermutation of HIV-1 DNA in the absence of the Vif protein. Science 300:1112.[Free Full Text]
  62. 32
  63. Lee, T. H., J. E. Coligan, J. S. Allan, M. F. McLane, J. E. Groopman, and M. Essex. 1986. A new HTLV-III/LAV protein encoded by a gene found in cytopathic retroviruses. Science 231:1546-1549.[Abstract/Free Full Text]
  64. 33
  65. Levin, J. G., J. Guo, I. Rouzina, and K. Musier-Forsyth. 2005. Nucleic acid chaperone activity of HIV-1 nucleocapsid protein: critical role in reverse transcription and molecular mechanism. Prog. Nucleic Acid Res. Mol. Biol. 80:217-286.[CrossRef][Medline]
  66. 34
  67. Li, J., M. J. Potash, and D. J. Volsky. 2004. Functional domains of APOBEC3G required for antiviral activity. J. Cell Biochem. 92:560-572.[CrossRef][Medline]
  68. 35
  69. Madani, N., and D. Kabat. 1998. An endogenous inhibitor of human immunodeficiency virus in human lymphocytes is overcome by the viral Vif protein. J. Virol. 72:10251-10255.[Abstract/Free Full Text]
  70. 36
  71. Mangeat, B., P. Turelli, G. Caron, M. Friedli, L. Perrin, and D. Trono. 2003. Broad antiretroviral defence by human APOBEC3G through lethal editing of nascent reverse transcripts. Nature 424:99-103.[CrossRef][Medline]
  72. 37
  73. Mangeat, B., P. Turelli, S. Liao, and D. Trono. 2004. A single amino acid determinant governs the species-specific sensitivity of APOBEC3G to Vif action. J. Biol. Chem. 279:14481-14483.[Abstract/Free Full Text]
  74. 38
  75. Mariani, R., D. Chen, B. Schrofelbauer, F. Navarro, R. Konig, B. Bollman, C. Munk, H. Nymark-McMahon, and N. R. Landau. 2003. Species-specific exclusion of APOBEC3G from HIV-1 virions by Vif. Cell 114:21-31.[CrossRef][Medline]
  76. 39
  77. Mehle, A., B. Strack, P. Ancuta, C. Zhang, M. McPike, and D. Gabuzda. 2004. Vif overcomes the innate antiviral activity of APOBEC3G by promoting its degradation in the ubiquitin-proteasome pathway. J. Biol. Chem. 279:7792-7798.[Abstract/Free Full Text]
  78. 40
  79. Navarro, F., B. Bollman, H. Chen, R. Konig, Q. Yu, K. Chiles, and N. R. Landau. 2005. Complementary function of the two catalytic domains of APOBEC3G. Virology 333:374-386.[CrossRef][Medline]
  80. 41
  81. Neuberger, M. S., R. S. Harris, J. Di Noia, and S. K. Petersen-Mahrt. 2003. Immunity through DNA deamination. Trends Biochem. Sci. 28:305-312.[CrossRef][Medline]
  82. 42
  83. Newman, E. N., R. K. Holmes, H. M. Craig, K. C. Klein, J. R. Lingappa, M. H. Malim, and A. M. Sheehy. 2005. Antiviral function of APOBEC3G can be dissociated from cytidine deaminase activity. Curr. Biol. 15:166-170.[CrossRef][Medline]
  84. 43
  85. Priet, S., N. Gros, J. M. Navarro, J. Boretto, B. Canard, G. Querat, and J. Sire. 2005. HIV-1-associated uracil DNA glycosylase activity controls dUTP misincorporation in viral DNA and is essential to the HIV-1 life cycle. Mol. Cell 17:479-490.[CrossRef][Medline]
  86. 44
  87. Schafer, A., H. P. Bogerd, and B. R. Cullen. 2004. Specific packaging of APOBEC3G into HIV-1 virions is mediated by the nucleocapsid domain of the gag polyprotein precursor. Virology 328:163-168.[CrossRef][Medline]
  88. 45
  89. Selig, L., S. Benichou, M. E. Rogel, L. I. Wu, M. A. Vodicka, J. Sire, R. Benarous, and M. Emerman. 1997. Uracil DNA glycosylase specifically interacts with Vpr of both human immunodeficiency virus type 1 and simian immunodeficiency virus of sooty mangabeys, but binding does not correlate with cell cycle arrest. J. Virol. 71:4842-4846.[Abstract]
  90. 46
  91. Sheehy, A. M., N. C. Gaddis, J. D. Choi, and M. H. Malim. 2002. Isolation of a human gene that inhibits HIV-1 infection and is suppressed by the viral Vif protein. Nature 418:646-650.[CrossRef][Medline]
  92. 47
  93. Simon, J. H., N. C. Gaddis, R. A. Fouchier, and M. H. Malim. 1998. Evidence for a newly discovered cellular anti-HIV-1 phenotype. Nat. Med. 4:1397-1400.[CrossRef][Medline]
  94. 48
  95. Simon, J. H., and M. H. Malim. 1996. The human immunodeficiency virus type 1 Vif protein modulates the postpenetration stability of viral nucleoprotein complexes. J. Virol. 70:5297-5305.[Abstract/Free Full Text]
  96. 49
  97. Sodroski, J., W. C. Goh, C. Rosen, A. Tartar, D. Portetelle, A. Burny, and W. Haseltine. 1986. Replicative and cytopathic potential of HTLV-III/LAV with sor gene deletions. Science 231:1549-1553.[Abstract/Free Full Text]
  98. 50
  99. Stopak, K., C. de Noronha, W. Yonemoto, and W. C. Greene. 2003. HIV-1 Vif blocks the antiviral activity of APOBEC3G by impairing both its translation and intracellular stability. Mol. Cell 12:591-601.[CrossRef][Medline]
  100. 51
  101. Strebel, K., D. Daugherty, K. Clouse, D. Cohen, T. Folks, and M. A. Martin. 1987. The HIV ‘A’ (sor) gene product is essential for virus infectivity. Nature 328:728-730.[CrossRef][Medline]
  102. 52
  103. Turelli, P., B. Mangeat, S. Jost, S. Vianin, and D. Trono. 2004. Inhibition of hepatitis B virus replication by APOBEC3G. Science 303:1829.[Free Full Text]
  104. 53
  105. von Schwedler, U., J. Song, C. Aiken, and D. Trono. 1993. Vif is crucial for human immunodeficiency virus type 1 proviral DNA synthesis in infected cells. J. Virol. 67:4945-4955.[Abstract/Free Full Text]
  106. 54
  107. Waters, L. C., and B. C. Mullin. 1977. Transfer RNA in RNA tumor viruses. Prog. Nucleic Acid Res. Mol. Biol. 20:131-160.[Medline]
  108. 55
  109. Wiegand, H. L., B. P. Doehle, H. P. Bogerd, and B. R. Cullen. 2004. A second human antiretroviral factor, APOBEC3F, is suppressed by the HIV-1 and HIV-2 Vif proteins. EMBO J. 23:2451-2458.[CrossRef][Medline]
  110. 56
  111. Willetts, K. E., F. Rey, I. Agostini, J. M. Navarro, Y. Baudat, R. Vigne, and J. Sire. 1999. DNA repair enzyme uracil DNA glycosylase is specifically incorporated into human immunodeficiency virus type 1 viral particles through a Vpr-independent mechanism. J. Virol. 73:1682-1688.[Abstract/Free Full Text]
  112. 57
  113. Yu, Q., R. Konig, S. Pillai, K. Chiles, M. Kearney, S. Palmer, D. Richman, J. M. Coffin, and N. R. Landau. 2004. Single-strand specificity of APOBEC3G accounts for minus-strand deamination of the HIV genome. Nat. Struct. Mol. Biol. 11:435-442.[CrossRef][Medline]
  114. 58
  115. Yu, X., Y. Yu, B. Liu, K. Luo, W. Kong, P. Mao, and X. F. Yu. 2003. Induction of APOBEC3G ubiquitination and degradation by an HIV-1 Vif-Cul5-SCF complex. Science 302:1056-1060.[Abstract/Free Full Text]
  116. 59
  117. Zennou, V., D. Perez-Caballero, H. Gottlinger, and P. D. Bieniasz. 2004. APOBEC3G incorporation into human immunodeficiency virus type 1 particles. J. Virol. 78:12058-12061.[Abstract/Free Full Text]
  118. 60
  119. Zhang, H., B. Yang, R. J. Pomerantz, C. Zhang, S. C. Arunachalam, and L. Gao. 2003. The cytidine deaminase CEM15 induces hypermutation in newly synthesized HIV-1 DNA. Nature 424:94-98.[CrossRef][Medline]


Journal of Virology, December 2006, p. 11710-11722, Vol. 80, No. 23
0022-538X/06/$08.00+0     doi:10.1128/JVI.01038-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Henriet, S., Mercenne, G., Bernacchi, S., Paillart, J.-C., Marquet, R. (2009). Tumultuous Relationship between the Human Immunodeficiency Virus Type 1 Viral Infectivity Factor (Vif) and the Human APOBEC-3G and APOBEC-3F Restriction Factors. Microbiol. Mol. Biol. Rev. 73: 211-232 [Abstract] [Full Text]  
  • Malim, M. H (2009). APOBEC proteins and intrinsic resistance to HIV-1 infection. Phil Trans R Soc B 364: 675-687 [Abstract] [Full Text]  
  • Chiu, Y.-L., Greene, W. C (2009). APOBEC3G: an intracellular centurion. Phil Trans R Soc B 364: 689-703 [Abstract] [Full Text]  
  • Tan, L., Sarkis, P. T. N., Wang, T., Tian, C., Yu, X.-F. (2009). Sole copy of Z2-type human cytidine deaminase APOBEC3H has inhibitory activity against retrotransposons and HIV-1. FASEB J. 23: 279-287 [Abstract] [Full Text]  
  • Wei, M., Yang, Y., Niu, M., Desfosse, L., Kennedy, R., Musier-Forsyth, K., Kleiman, L. (2008). Inability of Human Immunodeficiency Virus Type 1 Produced in Murine Cells To Selectively Incorporate Primer Formula. J. Virol. 82: 12049-12059 [Abstract] [Full Text]  
  • Bennett, R. P., Salter, J. D., Liu, X., Wedekind, J. E., Smith, H. C. (2008). APOBEC3G Subunits Self-associate via the C-terminal Deaminase Domain. J. Biol. Chem. 283: 33329-33336 [Abstract] [Full Text]  
  • Watashi, K., Khan, M., Yedavalli, V. R. K., Yeung, M. L., Strebel, K., Jeang, K.-T. (2008). Human Immunodeficiency Virus Type 1 Replication and Regulation of APOBEC3G by Peptidyl Prolyl Isomerase Pin1. J. Virol. 82: 9928-9936 [Abstract] [Full Text]  
  • Lee, Y. N., Malim, M. H., Bieniasz, P. D. (2008). Hypermutation of an Ancient Human Retrovirus by APOBEC3G. J. Virol. 82: 8762-8770 [Abstract] [Full Text]  
  • Armitage, A. E., Katzourakis, A., de Oliveira, T., Welch, J. J., Belshaw, R., Bishop, K. N., Kramer, B., McMichael, A. J., Rambaut, A., Iversen, A. K. N. (2008). Conserved Footprints of APOBEC3G on Hypermutated Human Immunodeficiency Virus Type 1 and Human Endogenous Retrovirus HERV-K(HML2) Sequences. J. Virol. 82: 8743-8761 [Abstract] [Full Text]  
  • Land, A. M., Ball, T. B., Luo, M., Pilon, R., Sandstrom, P., Embree, J. E., Wachihi, C., Kimani, J., Plummer, F. A. (2008). Human Immunodeficiency Virus (HIV) Type 1 Proviral Hypermutation Correlates with CD4 Count in HIV-Infected Women from Kenya. J. Virol. 82: 8172-8182 [Abstract] [Full Text]  
  • Nguyen, D. H., Hu, J. (2008). Reverse Transcriptase- and RNA Packaging Signal-Dependent Incorporation of APOBEC3G into Hepatitis B Virus Nucleocapsids. J. Virol. 82: 6852-6861 [Abstract] [Full Text]  
  • Knoepfel, S. A., Salisch, N. C., Huelsmann, P. M., Rauch, P., Walter, H., Metzner, K. J. (2008). Comparison of G-to-A Mutation Frequencies Induced by APOBEC3 Proteins in H9 Cells and Peripheral Blood Mononuclear Cells in the Context of Impaired Processivities of Drug-Resistant Human Immunodeficiency Virus Type 1 Reverse Transcriptase Variants. J. Virol. 82: 6536-6545 [Abstract] [Full Text]  
  • Gallois-Montbrun, S., Holmes, R. K., Swanson, C. M., Fernandez-Ocana, M., Byers, H. L., Ward, M. A., Malim, M. H. (2008). Comparison of Cellular Ribonucleoprotein Complexes Associated with the APOBEC3F and APOBEC3G Antiviral Proteins. J. Virol. 82: 5636-5642 [Abstract] [Full Text]  
  • Langlois, M.-A., Neuberger, M. S. (2008). Human APOBEC3G Can Restrict Retroviral Infection in Avian Cells and Acts Independently of both UNG and SMUG1. J. Virol. 82: 4660-4664 [Abstract] [Full Text]  
  • Dang, Y., Siew, L. M., Wang, X., Han, Y., Lampen, R., Zheng, Y.-H. (2008). Human Cytidine Deaminase APOBEC3H Restricts HIV-1 Replication. J. Biol. Chem. 283: 11606-11614 [Abstract] [Full Text]  
  • Bennett, R. P., Presnyak, V., Wedekind, J. E., Smith, H. C. (2008). Nuclear Exclusion of the HIV-1 Host Defense Factor APOBEC3G Requires a Novel Cytoplasmic Retention Signal and Is Not Dependent on RNA Binding. J. Biol. Chem. 283: 7320-7327 [Abstract] [Full Text]  
  • Iwatani, Y., Chan, D. S.B., Wang, F., Maynard, K. S., Sugiura, W., Gronenborn, A. M., Rouzina, I., Williams, M. C., Musier-Forsyth, K., Levin, J. G. (2007). Deaminase-independent inhibition of HIV-1 reverse transcription by APOBEC3G. Nucleic Acids Res 35: 7096-7108 [Abstract] [Full Text]  
  • Wiegand, H. L., Cullen, B. R. (2007). Inhibition of Alpharetrovirus Replication by a Range of Human APOBEC3 Proteins. J. Virol. 81: 13694-13699 [Abstract] [Full Text]  
  • Miyagi, E., Opi, S., Takeuchi, H., Khan, M., Goila-Gaur, R., Kao, S., Strebel, K. (2007). Enzymatically Active APOBEC3G Is Required for Efficient Inhibition of Human Immunodeficiency Virus Type 1. J. Virol. 81: 13346-13353 [Abstract] [Full Text]  
  • Wang, T., Tian, C., Zhang, W., Luo, K., Sarkis, P. T. N., Yu, L., Liu, B., Yu, Y., Yu, X.-F. (2007). 7SL RNA Mediates Virion Packaging of the Antiviral Cytidine Deaminase APOBEC3G. J. Virol. 81: 13112-13124 [Abstract] [Full Text]  
  • Li, X.-Y., Guo, F., Zhang, L., Kleiman, L., Cen, S. (2007). APOBEC3G Inhibits DNA Strand Transfer during HIV-1 Reverse Transcription. J. Biol. Chem. 282: 32065-32074 [Abstract] [Full Text]  
  • Guo, F., Cen, S., Niu, M., Yang, Y., Gorelick, R. J., Kleiman, L. (2007). The Interaction of APOBEC3G with Human Immunodeficiency Virus Type 1 Nucleocapsid Inhibits tRNA3Lys Annealing to Viral RNA. J. Virol. 81: 11322-11331 [Abstract] [Full Text]  
  • Niewiadomska, A. M., Tian, C., Tan, L., Wang, T., Sarkis, P. T. N., Yu, X.-F. (2007). Differential Inhibition of Long Interspersed Element 1 by APOBEC3 Does Not Correlate with High-Molecular-Mass-Complex Formation or P-Body Association. J. Virol. 81: 9577-9583 [Abstract] [Full Text]  
  • Henriet, S., Sinck, L., Bec, G., Gorelick, R. J., Marquet, R., Paillart, J.-C. (2007). Vif is a RNA chaperone that could temporally regulate RNA dimerization and the early steps of HIV-1 reverse transcription. Nucleic Acids Res 35: 5141-5153 [Abstract] [Full Text]  
  • Luo, K., Wang, T., Liu, B., Tian, C., Xiao, Z., Kappes, J., Yu, X.-F. (2007). Cytidine Deaminases APOBEC3G and APOBEC3F Interact with Human Immunodeficiency Virus Type 1 Integrase and Inhibit Proviral DNA Formation. J. Virol. 81: 7238-7248 [Abstract] [Full Text]  
  • Mbisa, J. L., Barr, R., Thomas, J. A., Vandegraaff, N., Dorweiler, I. J., Svarovskaia, E. S., Brown, W. L., Mansky, L. M., Gorelick, R. J., Harris, R. S., Engelman, A., Pathak, V. K. (2007). Human Immunodeficiency Virus Type 1 cDNAs Produced in the Presence of APOBEC3G Exhibit Defects in Plus-Strand DNA Transfer and Integration. J. Virol. 81: 7099-7110 [Abstract] [Full Text]  
  • Kinomoto, M., Kanno, T., Shimura, M., Ishizaka, Y., Kojima, A., Kurata, T., Sata, T., Tokunaga, K. (2007). All APOBEC3 family proteins differentially inhibit LINE-1 retrotransposition. Nucleic Acids Res 35: 2955-2964 [Abstract] [Full Text]  
  • Gallois-Montbrun, S., Kramer, B., Swanson, C. M., Byers, H., Lynham, S., Ward, M., Malim, M. H. (2007). Antiviral Protein APOBEC3G Localizes to Ribonucleoprotein Complexes Found in P Bodies and Stress Granules. J. Virol. 81: 2165-2178 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guo, F.
Right arrow Articles by Kleiman, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guo, F.
Right arrow Articles by Kleiman, L.