This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moalic, Y.
Right arrow Articles by Jestin, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moalic, Y.
Right arrow Articles by Jestin, A.

 Previous Article  |  Next Article 

Journal of Virology, November 2006, p. 10980-10988, Vol. 80, No. 22
0022-538X/06/$08.00+0     doi:10.1128/JVI.00904-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Porcine Endogenous Retrovirus Integration Sites in the Human Genome: Features in Common with Those of Murine Leukemia Virus{triangledown}

Yann Moalic, Yannick Blanchard,* Hélène Félix, and André Jestin

Laboratoire de Génétique Virale et Biosecurité, AFSSA, BP53, 22440 Ploufragan, France

Received 3 May 2006/ Accepted 10 August 2006


arrow
ABSTRACT
 
Porcine endogenous retroviruses (PERV) are a major concern when porcine tissues and organs are used for xenotransplantation. PERV has been shown to infect human cells in vitro, highlighting a potential zoonotic risk. No pathology is associated with PERV in its natural host, but the pathogenic potential might differ in the case of cross-species transmission and can only be inferred from knowledge of related gammaretroviruses. We therefore investigated the integration features of the PERV DNA in the human genome in vitro in order to further characterize the risk associated with PERV transmission. In this study, we characterized 189 PERV integration site sequences from human HEK-293 cells. Data showed that PERV integration was strongly enhanced at transcriptional start sites and CpG islands and that the frequencies of integration events increased with the expression levels of the genes, except for the genes with the highest levels of expression, which were disfavored for integration. Finally, we extracted genomic sequences directly flanking the integration sites and found an original 8-base statistical palindromic consensus sequence [TG(int)GTACCAGC]. All these results show similarities between PERV and murine leukemia virus integration site selection, suggesting that gammaretroviruses have a common pattern of integration and that the mechanisms of target site selection within a retrovirus genus might be similar.


arrow
INTRODUCTION
 
Sequences of porcine endogenous retrovirus (PERV) have been integrated into the genomes of all pig strains (38), and approximately 50 copies of replication-competent PERV exist (1, 39). According to their tropism (38, 44), three infectious subgroups can be distinguished: PERV-A and PERV-B, which infect both human and pig cells in vitro (39), and PERV-C, which infects only pig cells (39, 44).

Since swine are a potential source of organs for xenotransplantation, the risk of PERV transmission is a major concern. The breeding of specific-pathogen-free swine has eliminated many pathogens likely to be transmitted with pig grafts, but this does not apply to endogenous retroviruses which are inherited as part of the germ line (3, 9, 22, 38, 44). PERV transmission from swine to humans would be a zoonosis that would convert PERV from an endogenous status in swine to an exogenous status in humans. Endogenous retroviruses are considered in the "not too harmful" category of retroviruses (10), as most of them do not cause disease in their natural hosts. Could the loss of endogenous-PERV status in humans be associated with a pathogenic potential similar to that associated with exogenous gammaretroviruses, close relatives of PERV, such as feline leukemia virus, murine leukemia virus (MLV), and gibbon ape leukemia virus, which are able to induce tumors and immunodeficiencies in the infected host (1, 24, 30, 39), or will the PERV remain in the "not too harmful" category?

The propensity for genetic drift during replication of retroviruses has been shown previously (10), and two examples of such drift are currently known to exist for PERV. In pig cells, replicating PERV-C is able to recombine with the envelope sequence of endogenous PERV-A to produce A/C recombinants, which can infect human cells with greater efficiency (37, 40, 50-52). In human cells, serial passage of PERV can induce an increase in PERV production due to adaptation associated with long terminal repeat (LTR) extension (14, 15, 41). A similar adaptation, previously described for feline leukemia virus and MLV, is associated with increasing tumorigenic potential (2, 45, 56). These gammaretroviruses do not encode an oncogene directly responsible for their malignant potential. Tumor induction is instead consecutive to the process of insertional activation, in which proviral integration is responsible for the activated expression of a flanking proto-oncogene.

No genome-wide analysis of PERV integration in human cells has been available until now, although such information is essential to any risk appraisal of pig xenografts. Several genome-wide studies of retroviral DNA integration have recently been carried out on the complete human genome sequence (12, 21, 32, 34, 43, 54). These studies highlighted differences between retroviruses that originated from different genera (4, 7, 53).

Our laboratory estimated the risk associated with the PERV insertional profile in the human genome by characterizing the PERV integration sites 15 days after the infection of HEK-293 human cells.


arrow
MATERIALS AND METHODS
 
Cell culture and PERV infection. Human cells (HEK-293) were infected with PERV particles produced in vitro from PK-15 pig cells according to previously described procedures (25, 39). Briefly, the cultured HEK-293 cells were exposed for 4 h to the 0.45-µm-filtered supernatant of PK-15 cells in the presence of 0.8 µg/ml polybrene (hexadimethrine bromide; Sigma). The cells were then washed in growth medium and subcultured every 3 to 4 days. The growth medium was minimum essential medium completed with 10% fetal calf serum, penicillin (100 units/ml), and streptomycin (100 µg/ml). At each passage, half of the cells were conserved in TRIzol reagent (Invitrogen) and stored at –80°C for nucleic acid extraction (RNA and DNA).

Cloning of integration sites. The ligation-mediated PCR protocol used to clone the host-virus junctions was similar to that described previously (54), with two major modifications: first, the cloning of infected-cell DNA was carried out on day 15 postinfection, and second, a biotin-streptavidin purification was added after the first PCR step due to the very high number of false-positive clones observed (i.e., with no integration events) (20, 21, 42).

Genomic DNA was harvested from the infected cells with phenol-chloroform and cleaved with the restriction enzyme MseI. A double-strand linker was ligated at each digested end (GTAATACGACTCACTATAGGGCTCCGCTTAAG and PO4-TAGTCCCTTAAGCGGAG-NH2), and the products were cleaved with EaeI to prevent the amplification of internal viral fragments from the 5' LTR. The first round of PCR was performed with one linker-specific (GTAATACGACTCACTATAGGGC) oligonucleotide and one LTR-specific (biotin-TGCGTGGTGTACGACTGTG) oligonucleotide. The latter was biotinylated at its 5' end to concentrate the fragments of interest after the first round of PCR (29, 42, 49) on streptavidin-coated beads (streptavidin magnetic particles; Roche) with a magnetic particle separator (Roche). The second round of PCR was then performed using a second set of primers, one bound to the LTR (TTGGAATAAAAATCCTCTTGCTGT) and the other bound to the linker (AGGGCTCCGCTTAAGGGAC). Nested PCR amplicons were purified on membrane (MinElute PCR purification kit; QIAGEN) and cloned with a TOPO TA cloning kit (Invitrogen). Clones were sequenced on an ABI Prism 3100-Avant genetic analyzer (Applied Biosystems).

Mapping PERV integration sites. PERV integration sites were mapped to the human genome with the BLAT program (Human Genome Project working draft May 2004 freeze [hg17]; University of California, Santa Cruz, Calif.) as described previously (32, 43, 54). An integration sequence site was judged to be authentic only if it (i) contained the end of the 3' PERV LTR (CA) junction, (ii) showed >95% sequence identity, and (iii) yielded a unique best hit to the human genome in the BLAT ranking. A total of 189 unique PERV integration site sequences were mapped. Integration was judged to have occurred in a transcription unit (TU) only if the target sequence was located within the boundaries of one of the RefSeq genes (National Center for Biotechnology Information Reference Sequence Project). In this project, sequences are considered genes on the basis of human mRNAs and their translation products rather than on gene prediction programs.

Microarray analysis. The expression levels of the PERV target genes were based on a public HEK-293 microarray data set (GEO data set numbers GSM21381 and GSM21382) (57). These data sets were from the Affymetrix HG-U133A microarrays, which assay 22,215 probe sets. All probe sets were accepted and analyzed.

Analysis of base frequency around the integration sites. The base frequencies around the integration sites were calculated as described previously (23, 55). For each integration site sequence, the sequence flanking the site of viral joining was extracted to produce a 40-base sequence. All these sequences were then aligned at the integration site (between base –1 and base 0) and numbered in relation to the distance from integration (between offset –20 and offset 19). These sequences represented the genomic sequence before the LTR of the virus was inserted between offsets –1 and 0. A global base frequency was calculated for all the offsets and for all the sequences present in the set. The base frequencies observed at each offset were then compared to the global base frequencies, and the P values for any differences were determined by {chi}2 analysis.

Bioinformatic analysis. PERL (Practical Extraction and Report Language) was used to analyze the microarray data. A set of scripts was created to determine the expression level of the entire gene targeted by integration and to compare transcription profiles between all the genes present on the array and the target genes. A random-number generator was therefore used to generate 10,000 random data sets.

This language was also used to compute the frequencies of bases surrounding the integration site.

All scripts are available on request.


arrow
RESULTS
 
PERV integration site sequence capture, cloning, and mapping in the human genome. The HEK-293 cell line is, of all the human cell lines investigated, the most efficiently infected by PERV (13, 51). This cell line also exhibits an increase in infectious titer after each passage (14, 15, 41). We therefore selected this cell line for investigation of the PERV integration sites in the human genome. Despite the apparent suitability of the HEK-293 cells, our first attempt to clone the PERV integration site failed or gave extremely poor results before day 15 postinfection. We therefore had to adapt the original cloning technique described by Wu et al. (54). A Biotin streptavidin primer tag selection was applied to the PERV LTR-specific primer after the ligation-mediated PCR to ensure cloning of the PERV integration sites on day 15 postinfection, and this modification led to an efficient enrichment of PERV-positive amplicons. One hundred eighty-nine unique integration sites were successfully cloned using this strategy. The 15 days of cell culture necessary between the infection and an efficient cloning of the integration sites was a source of concern, as it might possibly introduce a bias in the integration profile. This point has been addressed by Lewinski et al. (27), who showed that a 15-day selection of HeLA cells resistant to puromycin (after an infection by puromycin-transducing MLV or human immunodeficiency virus [HIV]) had no influence on any of the integration site features except for gene density, a genome feature that will not be considered in this study.

The integration events were mapped on the draft of the human genome (48) (May 2004 freeze [hg17]; http://genome.ucsc.edu/), and their distribution on the human chromosomes is shown in Fig. 1. All chromosomes were targeted by PERV integration. However, the integration sites were not uniformly distributed throughout the chromosome set. Although the biggest chromosomes displayed more PERV integration events, the correlation with chromosome size was low (r = 0.589) (data not shown). Two parameters need to be considered here. First, the HEK-293 cell line is subject to the chromosomal abnormalities typical of transformed cells, and some chromosomes (17, 22, and X) are therefore overrepresented (data from ATCC). These chromosomes displayed relatively high frequencies of integration events. Second, transcription intensity varies between chromosomes and within different regions of a chromosome (33), and this may influence the distribution of integration events, as has been shown for some retroviruses (21, 32). For example, the weak PERV integration frequencies in chromosomes 13 and 14 correlated with the low transcriptional intensities deduced by expressed sequence tag counts, whereas the relatively high integration frequency in chromosome 19 paralleled the strong transcriptional intensity. Although some chromosomes displayed more integration events, we did not observe any integration hotspots for PERV like those described by Schroder et al. (43) for HIV-1. This might, however, be related to the relatively low number of integration sites recorded and does not formally exclude the possible existence of integration hot spots for PERV.


Figure 1
View larger version (22K):
[in this window]
[in a new window]
  		FIG. 1. Map of PERV integration sites on human chromosomes.

PERV integration is favored near transcriptional start sites and CpG islands. The PERV integration profile on the human genome map appears to be correlated with the gene-transcriptional intensities of the chromosomes (33). We therefore began to determine the frequency of PERV integration sites in TUs, using the well-characterized human RefSeq gene annotation (May 2004 assembly, 24,847 genes; http://www.ncbi.nlm.nih.gov/RefSeq/) as a criterion. The results revealed that 43.9% (83 of 189) of the integration events occurred in TUs. This was higher than the estimated proportion of transcription units in the human genome (33%) and significantly different from the results for the computer-simulated random control, in which only 34.3% landed in RefSeq genes ({chi}2 test, P = 0.0054) (Table 1). Compared with results for other retroviruses, this percentage is closer to those for MLV (44.3%) and avian sarcoma/leukosis virus (ASLV; 44.4% and 48%) than to those for HIV-1 (68.1% and 74.1%) or simian immunodeficiency virus (SIV; 75. 8%).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Frequency of integration sites in transcription units and transcription start sitesa

In order to facilitate comparison with other retroviruses, integration within ±5 kb of transcriptional start sites and within ±5 kb of CpG islands was then investigated. With 33.9% of integration events within transcriptional start sites (±5 kb) and 39% within CpG islands (±5 kb), PERV significantly exceeded the integration bias observed for MLV (24.7% and 28%, respectively) and other retroviruses (12, 34) (P < 1 x 10–4). The affinity for the immediate transcription start site area is particularly evident if we look at a 60-kb area around transcription start sites, where we can see a sharp decline of integration events beyond ±5 kb (Fig. 2A). If we focus on the TU (Fig. 2B), the integration bias in favor of gene promoter regions and the 5' end of the TU (as represented by the first eighth of the TU) is also clearly apparent (P < 1 x 10–4). Further, as described by Mitchell and coworkers for MLV (32), PERV integrations become more concentrated as the distance from CpG islands decreases: 28.5% of integration occurs within a ±1-kb window around CpG islands.


Figure 2
View larger version (23K):
[in this window]
[in a new window]
  		FIG. 2. Distribution of PERV integration sites. (A) Within a 60-kb window centered on transcription start sites. The percentage of PERV integration events was calculated for each 5-kb gap and compared with those of MLV and HIV integration events. (B) With respect to target transcription unit length and flanking region. Transcription units were divided into eight equal parts, and the percentage of integration events in each part was determined. As with MLV (Wu et al.) (53-55) and avian sarcoma virus, fixed 5-kb windows were used for the flanking regions. a, data set from Wu et al. (54); b, data set from Schroder et al. (43)

We also carried out an analysis of PERV integration frequency in repeated sequences, including short interspersed nuclear elements, long interspersed nuclear elements (LINEs), retrotransposons (DNA elements), and endogenous retroviruses (LTR elements) (Table 2). None of these elements favored PERV integration. As for MLV, two of them, LINEs and Alu elements, actually disfavored PERV integration, with significantly lower integration events than those for the matched random controls (P < 9.2 x 10–3 and P < 1.98 x 10–2, respectively).


View this table:
[in this window]
[in a new window]
  		TABLE 2. Percentages of integration events in sequence features of DNAa

According to these results, PERV integration appeared to be (i) favored near the promoter regions of transcription units and (ii) disfavored in the LINE and Alu human repeated sequences.

Transcriptional activity differences between target genes. We then analyzed the HEK-293 microarray data set deposited in GEO (GSM21381 and GSM21382) (57) to see whether selection of the PERV integration site was correlated with gene transcriptional activity, as previously described for other retroviruses (32, 43). We also reanalyzed the published transcriptional profiling data from uninfected HeLa cells (46) in order to compare PERV with MLV, which shows a similar integration profile in genes. One hundred nineteen of the 189 PERV integration events studied were used to assess the influence of transcriptional activity on integration. Eighty-three integration sites were located within genes, and 36 were in a 5-kb window upstream of the genes. Ninety-three of the 119 genes were represented on the Affymetrix U133A chips, which include 22,215 probe sets. These probe sets were used to evaluate the transcription profiling of the genes targeted by integration. In the first part of the analysis, we compared the median expression level of the probes representing the targeted genes to that of all the probes on the gene chips and found that the level of PERV-targeted gene expression was only 1.42-fold higher (t test, P = 0.0822). This was then more carefully investigated by assigning all the transcripts assayed on the chips to eight equal bins of increasing expression signal values and determining the frequency of the target transcripts in each bin (Fig. 3A). Comparison with a 10,000 in silico random draw indicated that the distribution of PERV integration events in the different bins was statistically varied ({chi}2 test, P = 0.01). A preference for bins with more expressed genes (bins 5, 6, and 7) was observed (P = 0.0066), except for the bin with the highest expression (bin 8), which showed no increase in integration (P = 0.116). For MLV, we observed a similar distribution, except that genes with the highest expression (bin 8) did not seem significantly disfavored. Finally, we investigated the influence of gene expression on the more accurate insertion localization of PERV and MLV within the gene. This was done by dividing each gene into two parts, one consisting of the start site and the sequence surrounding the transcriptional start sites (±5 kb) (5' part) and the other consisting of the rest of the TU (i.e., the TU excluding the transcription start site [+5 kb]). The relative proportions were then calculated for each bin. Significant biases in distribution between the different bins were observed for PERV and MLV ({chi}2 test, P = 0.03 and P < 0.0001, respectively). In the more actively expressed genes (bins 6, 7, and 8), the proportions of integration events progressively increased around the transcriptional start sites (5' part) (Fig. 3B) and conversely decreased in the remaining part of the TUs (3' part). For MLV, the decreases in the percentages of integration events observed for bins 7 and 8 were exclusively due to decreases in the integration events in the so-called 3' part of the TUs and did not affect the 5' upstream promoter regions of these genes.


Figure 3
View larger version (40K):
[in this window]
[in a new window]
  		FIG. 3. Effects of gene activity on integration frequency and localization. Expression levels were assayed using Affymetrix HU133A microarray or Affymetrix HU95A microarray data sets. All genes on the chips were divided into eight bins according to their relative levels of expression. (A) The genes targeted by PERV, MLV, and 10,000 in silico random target genes were assigned to the corresponding expression bins and summed, and then the data were plotted as the percentages of all the integration sites in genes on the array. P values were determined using the chi-square test. (B) Relationship between distribution of the PERV and MLV integration sites within genes and gene activity. In each bin, the integration events were separated into two categories according to their localization within the gene: near transcriptional start sites (±5 kb) or in TUs without the start site (+5 kb).

Primary sequences surrounding integration sites. The PERV integration site was further characterized by looking at the base frequencies directly surrounding the integration sites in the human genome. All 189 integration sites were selected, and the 20 bases flanking both the 5' and the 3' ends at the site of viral joining were extracted (with the same orientation as that of the virus) and aligned at the integration sites (between bases –1 and 0). The global frequencies for A, C, G, and T were calculated across all offsets for the 189 sequences. The distribution of the base frequencies was 27.3%, 22.8%, 22.3%, and 27.5% for A, C, G, and T, respectively. This differed slightly from the expected frequencies of 30%, 20%, 20%, and 30% for A, C, G, and T, respectively, in the human genome. The base frequencies for each offset between –20 and 19 were compared with the global base frequencies by {chi}2 analysis. As previously described for MLV, HIV-1, SIV, and ASLV (23, 55), significant base preferences were revealed, and a strong pattern between bases –4 and 8 was observed (Fig. 4A): [-3]STG(int)GTACCAGC[7] (written according to standard International Union of Biochemistry mixed base codes). Compared to those for other retroviral integration site patterns (Table 3), the PERV palindromic consensus sequence is original. In this statistical consensus sequence, some bases were found to appear at frequencies up to twofold higher than expected, yielding P values as low as 10–18. When we investigated this frequency distribution more carefully, a striking symmetry with an 8-bp palindrome extending from offset –2 to offset 5 was apparent (Fig. 4B). The symmetrical axis at insertion sites had already been characterized for MLV, HIV-1, SIV, and ASLV and also revealed palindromic consensus sequences centered on the duplicated target site (23, 55). The position of this symmetrical axis between offsets 1 and 2 corresponds to the center of the 4-bp duplication target site sequence induced by the integration machinery of PERV. Indeed, in the porcine genome, a 4-base sequence was observed at each extremity of the PERV proviral genomes (35).


Figure 4
View larger version (29K):
[in this window]
[in a new window]
  		FIG. 4. Base frequency distribution at PERV integration sites. Integration occurs between positions –1 and 0 on the top strand. (A) The base composition of the top DNA strand at each position flanking the integration site was calculated. Bold positions indicate base frequencies that were statistically higher than that of the global position (left column). P values in italics were obtained by {chi}2 analysis comparing observed base frequencies with the expected frequencies. (B) Comparison of the observed integration preferences with the expected preferences. The x axis shows the offset for each base from the integration site. The vertical line, between offsets 1 and 2, indicates the expected axis of symmetry based on the characteristic 4-base spacing between the sites of PERV DNA integration. The y axis represents the percentage of expected frequency observed for each base (27.3% for A, 22.8% for C, 22.3% for G, and 27.5% for T). The horizontal line is drawn at 100% of the expected frequency.


View this table:
[in this window]
[in a new window]
  		TABLE 3. Patterns of genomic sequences surrounding retroviral integration sitesa

This analysis highlighted a strong palindromic consensus sequence at the integration target sites of PERV. This consensus sequence differs from other retroviral consensus sequences studied.


arrow
DISCUSSION
 
In this study, we report the characterization of PERV integration sites in the human genome after infection of HEK-293 cells in vitro. Random integration of retroviruses within the host genome has long been hypothesized, and it is only with the recent high-throughput data studies that the nonrandom nature of some retrovirus integration has been clearly demonstrated (4).

The aim of our work was to assess the risk of insertion mutation associated with PERV integration in the case of possible transmission to humans following pig-to-human xenotransplantation.

Our results revealed a strong preference for integration of the PERV DNA genome around the transcriptional start sites and near CpG islands of transcriptional active genes in the chromosome. In addition, analysis of the 40-bp sequences surrounding the PERV integration sites revealed an original 8-base-pair statistical palindromic consensus sequence.

The first surveys of genome-wide integration showed that the integration site profiles differed between retroviruses (32, 43, 54), and the hypothesis of a virus-specific integration profile determinism was suggested (53). Our results, along with those of other high-throughput integration studies, suggest that this integration profile determinism would be genus specific rather than virus specific. Three lines of evidence support this hypothesis. First, the PERV integration profile highlighted similarities to MLV in integration target site selection (for our results, see reference 54), as both viruses are phylogenically related (24) and members of the gammaretrovirus genus. Second, HIV-1 and SIV, which belong to the lentivirus genus, show highly similar patterns of integration (12, 43), and third, two other unique patterns of integration site features were obtained with avian sarcoma virus and foamy virus, members of two additional retrovirus genera, the alpharetrovirus (32, 34) and the spumavirus (36, 47), respectively. In addition, although the integration profiles of other retrovirus genera have as yet been poorly characterized, the preliminary data for deltaretroviruses (human T-cell leukemia virus type 1) (26) and betaretroviruses (Jaagsiekte sheep retrovirus) (11) suggest genus specificity.

The variability of integration profiles can be explained from models incorporating the interactions between preintegration complexes (PICs) and different cellular cofactors for target site selection (5, 17, 53). The enhanced integration of gammaretrovirus close to the transcription initiation start site and CpG island might be mediated through interaction of PICs with transcription factors, the CpG island-interacting proteins, and/or other factors involved in transcription (17, 53).

Our PERV integration data suggest that the integration strategies are specific to each retrovirus genus, although analysis of the transcriptional activity of preinfected cells revealed some common constraints between all the retroviruses studied. Integration site selection seemed to show a preference for actively transcribed regions, which represent a more accessible chromatin region (12, 32, 34, 43, 54), although a low level of integration in the most actively transcribed genes was also observed for all these retroviruses. This suggests that the integration complexes are regularly denied access to the most actively transcribed DNA. This has been demonstrated experimentally in an assay of ASLV retroviral integration with a quail inducible metallothionein gene. In this assay, integration was inversely correlated with gene expression level (31). The PERV integration profile followed this pattern (decreased integration in actively transcribed genes, bin 8), although a closer examination of integration suggests that, in the most actively transcribed genes (Fig. 3B), PERV integration tended to occur near the transcriptional start site and regulatory region (CpG) rather than in the remainder of the TU. Actually, the numbers of integrations in the regulatory region in bins 5, 6, 7, and 8 were relatively constant whereas they increased in the TUs of bins 5 and 6 and decreased in the TUs of bins 7 and 8. These results corroborate those of De Palma and coworkers, who demonstrated that MLV vectors integrate preferentially in the vicinity of a highly active promoter, in comparison to HIV vectors (16), and suggest that the inhibition of integration within TUs might be related to steric hindrance resulting from highly active transcription.

The identification of genome-wide features favoring retroviral integration has been enhanced by the high-throughput identification of the integration sites of retroviruses. This has permitted fine characterization of the host DNA at the integration site (23, 55) and has highlighted some strong interactions between host DNA and PICs, including viral integrase (IN) and the two DNA viral ends, before integration. On computing the base preferences surrounding PERV integration, we found an original 8-base statistical palindromic consensus sequence. The absence of an absolute consensus sequence suggests that the recognition of cellular target DNA sequences is controlled by a host DNA tertiary structure compatible to binding rather than by specific primary sequence recognition (18, 55), although DNA sequences do participate in tertiary structure recognition. In contrast to HIV-1 and SIV, which have highly similar statistical palindromic compositions, MLV does not share a palindromic consensus sequence with PERV (Table 3) (55). One possible explanation would be that the two lentiviruses are phylogenetically closer than PERV and MLV. This hypothesis is supported by the sequence alignment of IN protein, which shows greater identity between HIV-1 and SIV (89%) than between PERV and MLV (79%). The tetrameral form of the IN complex has been shown to stably lock onto the viral DNA ends and catalyze integration (28), which strengthens the hypothesis of a symmetrical structure matching a symmetrical target site sequence (18, 23, 55). Nevertheless, both LTRs might also play a role in primary sequence selection within the complex (23). The statistically significant deviation (from the average base frequency distribution) observed at positions 6 and 7 (the first two positions following the 3' end of the palindromic consensus sequence) has not been observed for other retroviruses. It might be the reflection of a stronger interaction between the 3' LTR and the target DNA. Bushman and Craigie have shown, in vitro, that the covalent joining of each viral DNA end to target DNA occurs sequentially (28), the U5 ends (3' LTR) joining first (6).

The data reported here indicate that PERV integration, like that of MLV, occurs preferentially near the transcriptional start site. Recently, MLV-vector integration near the promoter region has contributed to activation of the LMO2 proto-oncogene in human patients and induced leukemia during a gene therapy trial (8, 19). Our results imply that in the case of PERV zoonosis occurring during xenotransplantation, the risk of insertion associated with integration of the PERV DNA genome might be similar to that associated with MLV and MLV-derived vectors.


arrow
ACKNOWLEDGMENTS
 
This work was supported by a grant from Région Bretagne (P3681/5662).

We thank P. Chardon, F. Lefevre, and C. Pineau for helpful discussions.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Laboratoire de Génétique Virale et Biosecurité, AFSSA, BP53, 22440 Ploufragan, France. Phone: 33 02 96 01 62 97. Fax: 33 02 96 01 62 83. E-mail: y.blanchard{at}afssa.fr. Back

{triangledown} Published ahead of print on 23 August 2006. Back


arrow
REFERENCES
 
    1
  1. Akiyoshi, D. E., M. Denaro, H. Zhu, J. L. Greenstein, P. Banerjee, and J. A. Fishman. 1998. Identification of a full-length cDNA for an endogenous retrovirus of miniature swine. J. Virol. 72:4503-4507.[Abstract/Free Full Text]
    2. 2
  2. Athas, G. B., P. Lobelle-Rich, and L. S. Levy. 1995. Function of a unique sequence motif in the long terminal repeat of feline leukemia virus isolated from an unusual set of naturally occurring tumors. J. Virol. 69:3324-3332.[Abstract]
    3. 3
  3. Bosch, S., C. Arnauld, and A. Jestin. 2000. Study of full-length porcine endogenous retrovirus genomes with envelope gene polymorphism in a specific-pathogen-free Large White swine herd. J. Virol. 74:8575-8581.[Abstract/Free Full Text]
    4. 4
  4. Bushman, F., M. Lewinski, A. Ciuffi, S. Barr, J. Leipzig, S. Hannenhalli, and C. Hoffmann. 2005. Genome-wide analysis of retroviral DNA integration. Nat. Rev. Microbiol. 3:848-858.[CrossRef][Medline]
    5. 5
  5. Bushman, F. D. 2003. Targeting survival: integration site selection by retroviruses and LTR-retrotransposons. Cell 115:135-138.[CrossRef][Medline]
    6. 6
  6. Bushman, F. D., and R. Craigie. 1991. Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA. Proc. Natl. Acad. Sci. USA 88:1339-1343.[Abstract/Free Full Text]
    7. 7
  7. Cereseto, A., and M. Giacca. 2004. Integration site selection by retroviruses. AIDS Rev. 6:13-21.[Medline]
    8. 8
  8. Check, E. 2002. A tragic setback. Nature 420:116-118.[CrossRef][Medline]
    9. 9
  9. Clemenceau, B., S. Lalain, L. Martignat, and P. Sai. 1999. Porcine endogenous retroviral mRNAs in pancreas and a panel of tissues from specific pathogen-free pigs. Diabetes Metab. 25:518-525.[Medline]
    10. 10
  10. Coffin, J. M., S. H. Hughes, and H. E. Varmus. 1997. Retroviruses. Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
    11. 11
  11. Cousens, C., J. V. Bishop, A. W. Philbey, C. A. Gill, M. Palmarini, J. O. Carlson, J. C. DeMartini, and J. M. Sharp. 2004. Analysis of integration sites of Jaagsiekte sheep retrovirus in ovine pulmonary adenocarcinoma. J. Virol. 78:8506-8512.[Abstract/Free Full Text]
    12. 12
  12. Crise, B., Y. Li, C. Yuan, D. R. Morcock, D. Whitby, D. J. Munroe, L. O. Arthur, and X. Wu. 2005. Simian immunodeficiency virus integration preference is similar to that of human immunodeficiency virus type 1. J. Virol. 79:12199-12204.[Abstract/Free Full Text]
    13. 13
  13. Czauderna, F., N. Fischer, K. Boller, R. Kurth, and R. R. Tonjes. 2000. Establishment and characterization of molecular clones of porcine endogenous retroviruses replicating on human cells. J. Virol. 74:4028-4038.[Abstract/Free Full Text]
    14. 14
  14. Denner, J., V. Specke, J. Schwendemann, and S. J. Tacke. 2001. Porcine endogenous retroviruses (PERVs): adaptation to human cells and attempts to infect small animals and non-human primates. Ann. Transplant. 6:25-33.[Medline]
    15. 15
  15. Denner, J., V. Specke, U. Thiesen, A. Karlas, and R. Kurth. 2003. Genetic alterations of the long terminal repeat of an ecotropic porcine endogenous retrovirus during passage in human cells. Virology 314:125-133.[CrossRef][Medline]
    16. 16
  16. De Palma, M., E. Montini, F. R. de Sio, F. Benedicenti, A. Gentile, E. Medico, and L. Naldini. 2005. Promoter trapping reveals significant differences in integration site selection between MLV and HIV vectors in primary hematopoietic cells. Blood 105:2307-2315.[Medline]
    17. 17
  17. Engelman, A. 2005. The ups and downs of gene expression and retroviral DNA integration. Proc. Natl. Acad. Sci. USA 102:1275-1276.[Free Full Text]
    18. 18
  18. Grandgenett, D. P. 2005. Symmetrical recognition of cellular DNA target sequences during retroviral integration. Proc. Natl. Acad. Sci. USA 102:5903-5904.[Free Full Text]
    19. 19
  19. Hacein-Bey-Abina, S., C. Von Kalle, M. Schmidt, M. P. McCormack, N. Wulffraat, P. Leboulch, A. Lim, C. S. Osborne, R. Pawliuk, E. Morillon, R. Sorensen, A. Forster, P. Fraser, J. I. Cohen, G. de Saint Basileqq, I. Alexander, U. Wintergerst, T. Frebourg, A. Aurias, D. Stoppa-Lyonnet, S. Romana, I. Radford-Weiss, F. Gross, F. Valensi, E. Delabesse, E. Macintyre, F. Sigaux, J. Soulier, L. E. Leiva, M. Wissler, C. Prinz, T. H. Rabbitts, F. Le Deist, A. Fischer, and M. Cavazzana-Calvo. 2003. LMO2-associated clonal T cell proliferation in two patients after gene therapy for SCID-X1. Science 302:415-419.[Abstract/Free Full Text]
    20. 20
  20. Hanawa, H., P. Hematti, K. Keyvanfar, M. E. Metzger, A. Krouse, R. E. Donahue, S. Kepes, J. Gray, C. E. Dunbar, D. A. Persons, and A. W. Nienhuis. 2004. Efficient gene transfer into rhesus repopulating hematopoietic stem cells using a simian immunodeficiency virus-based lentiviral vector system. Blood 103:4062-4069.[Abstract/Free Full Text]
    21. 21
  21. Hematti, P., B. K. Hong, C. Ferguson, R. Adler, H. Hanawa, S. Sellers, I. E. Holt, C. E. Eckfeldt, Y. Sharma, M. Schmidt, C. von Kalle, D. A. Persons, E. M. Billings, C. M. Verfaillie, A. W. Nienhuis, T. G. Wolfsberg, C. E. Dunbar, and B. Calmels. 2004. Distinct genomic integration of MLV and SIV vectors in primate hematopoietic stem and progenitor cells. PLoS Biol. 2:e423.[CrossRef][Medline]
    22. 22
  22. Herring, C., G. Quinn, R. Bower, N. Parsons, N. A. Logan, A. Brawley, K. Elsome, A. Whittam, X. M. Fernandez-Suarez, D. Cunningham, D. Onions, G. Langford, and L. Scobie. 2001. Mapping full-length porcine endogenous retroviruses in a large white pig. J. Virol. 75:12252-12265.[Abstract/Free Full Text]
    23. 23
  23. Holman, A. G., and J. M. Coffin. 2005. Symmetrical base preferences surrounding HIV-1, avian sarcoma/leukosis virus, and murine leukemia virus integration sites. Proc. Natl. Acad. Sci. USA 102:6103-6107.[Abstract/Free Full Text]
    24. 24
  24. Klymiuk, N., M. Muller, G. Brem, and B. Aigner. 2002. Characterization of porcine endogenous retrovirus gamma pro-pol nucleotide sequences. J. Virol. 76:11738-11743.[Abstract/Free Full Text]
    25. 25
  25. Kuddus, R. H., C. R. Gandhi, K. K. Rehman, F. Guo, S. C. Watkins, L. A. Valdivia, and J. J. Fung. 2003. Some morphological, growth, and genomic properties of human cells chronically infected with porcine endogenous retrovirus (PERV). Genome 46:858-869.[Medline]
    26. 26
  26. Leclercq, I., F. Mortreux, M. Cavrois, A. Leroy, A. Gessain, S. Wain-Hobson, and E. Wattel. 2000. Host sequences flanking the human T-cell leukemia virus type 1 provirus in vivo. J. Virol. 74:2305-2312.[Abstract/Free Full Text]
    27. 27
  27. Lewinski, M. K., M. Yamashita, M. Emerman, A. Ciuffi, H. Marshall, G. Crawford, F. Collins, P. Shinn, J. Leipzig, S. Hannenhalli, C. C. Berry, J. R. Ecker, and F. D. Bushman. 2006. Retroviral DNA integration: viral and cellular determinants of target-site selection. PLoS Pathog. 2:e60.[CrossRef][Medline]
    28. 28
  28. Li, M., M. Mizuuchi, T. R. Burke, and R. Craigie. 2006. Retroviral DNA integration: reaction pathway and critical intermediates. EMBO J. 25:1295-1304.[CrossRef][Medline]
    29. 29
  29. Mangiapan, G., M. Vokurka, L. Schouls, J. Cadranel, D. Lecossier, J. van Embden, and A. J. Hance. 1996. Sequence capture-PCR improves detection of mycobacterial DNA in clinical specimens. J. Clin. Microbiol. 34:1209-1215.[Abstract]
    30. 30
  30. Martin, J., E. Herniou, J. Cook, R. W. O'Neill, and M. Tristem. 1999. Interclass transmission and phyletic host tracking in murine leukemia virus-related retroviruses. J. Virol. 73:2442-2449.[Abstract/Free Full Text]
    31. 31
  31. Maxfield, L. F., C. D. Fraize, and J. M. Coffin. 2005. Relationship between retroviral DNA-integration-site selection and host cell transcription. Proc. Natl. Acad. Sci. USA 102:1436-1441.[Abstract/Free Full Text]
    32. 32
  32. Mitchell, R. S., B. F. Beitzel, A. R. Schroder, P. Shinn, H. Chen, C. C. Berry, J. R. Ecker, and F. D. Bushman. 2004. Retroviral DNA integration: ASLV, HIV, and MLV show distinct target site preferences. PLoS Biol. 2:E234.[CrossRef][Medline]
    33. 33
  33. Mungall, A. J., S. A. Palmer, S. K. Sims, C. A. Edwards, J. L. Ashurst, L. Wilming, M. C. Jones, R. Horton, S. E. Hunt, C. E. Scott, J. G. Gilbert, M. E. Clamp, G. Bethel, S. Milne, R. Ainscough, J. P. Almeida, K. D. Ambrose, T. D. Andrews, R. I. Ashwell, A. K. Babbage, C. L. Bagguley, J. Bailey, R. Banerjee, D. J. Barker, K. F. Barlow, K. Bates, D. M. Beare, H. Beasley, O. Beasley, C. P. Bird, S. Blakey, S. Bray-Allen, J. Brook, A. J. Brown, J. Y. Brown, D. C. Burford, W. Burrill, J. Burton, C. Carder, N. P. Carter, J. C. Chapman, S. Y. Clark, G. Clark, C. M. Clee, S. Clegg, V. Cobley, R. E. Collier, J. E. Collins, L. K. Colman, N. R. Corby, G. J. Coville, K. M. Culley, P. Dhami, J. Davies, M. Dunn, M. E. Earthrowl, A. E. Ellington, K. A. Evans, L. Faulkner, M. D. Francis, A. Frankish, J. Frankland, L. French, P. Garner, J. Garnett, M. J. Ghori, L. M. Gilby, C. J. Gillson, R. J. Glithero, D. V. Grafham, M. Grant, S. Gribble, C. Griffiths, M. Griffiths, R. Hall, K. S. Halls, S. Hammond, J. L. Harley, E. A. Hart, P. D. Heath, R. Heathcott, S. J. Holmes, P. J. Howden, K. L. Howe, G. R. Howell, E. Huckle, S. J. Humphray, M. D. Humphries, A. R. Hunt, C. M. Johnson, A. A. Joy, M. Kay, S. J. Keenan, A. M. Kimberley, A. King, G. K. Laird, C. Langford, S. Lawlor, D. A. Leongamornlert, M. Leversha, C. R. Lloyd, D. M. Lloyd, J. E. Loveland, J. Lovell, S. Martin, M. Mashreghi-Mohammadi, G. L. Maslen, L. Matthews, O. T. McCann, S. J. McLaren, K. McLay, A. McMurray, M. J. Moore, J. C. Mullikin, D. Niblett, T. Nickerson, K. L. Novik, K. Oliver, E. K. Overton-Larty, A. Parker, R. Patel, A. V. Pearce, A. I. Peck, B. Phillimore, S. Phillips, R. W. Plumb, K. M. Porter, Y. Ramsey, S. A. Ranby, C. M. Rice, M. T. Ross, S. M. Searle, H. K. Sehra, E. Sheridan, C. D. Skuce, S. Smith, M. Smith, L. Spraggon, S. L. Squares, C. A. Steward, N. Sycamore, G. Tamlyn-Hall, J. Tester, A. J. Theaker, D. W. Thomas, A. Thorpe, A. Tracey, A. Tromans, B. Tubby, M. Wall, J. M. Wallis, A. P. West, S. S. White, S. L. Whitehead, H. Whittaker, A. Wild, D. J. Wiley, T. E. Wilmer, J. M. Wood, P. W. Wray, J. C. Wyatt, L. Young, R. M. Younger, D. R. Bentley, A. Coulson, R. Durbin, T. Hubbard, J. E. Sulston, I. Dunham, J. Rogers, and S. Beck. 2003. The DNA sequence and analysis of human chromosome 6. Nature 425:805-811.[CrossRef][Medline]
    34. 34
  34. Narezkina, A., K. D. Taganov, S. Litwin, R. Stoyanova, J. Hayashi, C. Seeger, A. M. Skalka, and R. A. Katz. 2004. Genome-wide analyses of avian sarcoma virus integration sites. J. Virol. 78:11656-11663.[Abstract/Free Full Text]
    35. 35
  35. Niebert, M., C. Rogel-Gaillard, P. Chardon, and R. R. Tonjes. 2002. Characterization of chromosomally assigned replication-competent gamma porcine endogenous retroviruses derived from a large white pig and expression in human cells. J. Virol. 76:2714-2720.[Abstract/Free Full Text]
    36. 36
  36. Nowrouzi, A., M. Dittrich, C. Klanke, M. Heinkelein, M. Rammling, T. Dandekar, C. von Kalle, and A. Rethwilm. 2006. Genome-wide mapping of foamy virus vector integrations into a human cell line. J. Gen. Virol. 87:1339-1347.[Abstract/Free Full Text]
    37. 37
  37. Oldmixon, B. A., J. C. Wood, T. A. Ericsson, C. A. Wilson, M. E. White-Scharf, G. Andersson, J. L. Greenstein, H. J. Schuurman, and C. Patience. 2002. Porcine endogenous retrovirus transmission characteristics of an inbred herd of miniature swine. J. Virol. 76:3045-3048.[Abstract/Free Full Text]
    38. 38
  38. Patience, C., W. M. Switzer, Y. Takeuchi, D. J. Griffiths, M. E. Goward, W. Heneine, J. P. Stoye, and R. A. Weiss. 2001. Multiple groups of novel retroviral genomes in pigs and related species. J. Virol. 75:2771-2775.[Abstract/Free Full Text]
    39. 39
  39. Patience, C., Y. Takeuchi, and R. A. Weiss. 1997. Infection of human cells by an endogenous retrovirus of pigs. Nat. Med. 3:282-286.[CrossRef][Medline]
    40. 40
  40. Ritzhaupt, A., L. J. Van Der Laan, D. R. Salomon, and C. A. Wilson. 2002. Porcine endogenous retrovirus infects but does not replicate in nonhuman primate primary cells and cell lines. J. Virol. 76:11312-11320.[Abstract/Free Full Text]
    41. 41
  41. Scheef, G., N. Fischer, U. Krach, and R. R. Tonjes. 2001. The number of a U3 repeat box acting as an enhancer in long terminal repeats of polytropic replication-competent porcine endogenous retroviruses dynamically fluctuates during serial virus passages in human cells. J. Virol. 75:6933-6940.[Abstract/Free Full Text]
    42. 42
  42. Schmidt, M., P. Zickler, G. Hoffmann, S. Haas, M. Wissler, A. Muessig, J. F. Tisdale, K. Kuramoto, R. G. Andrews, T. Wu, H. P. Kiem, C. E. Dunbar, and C. von Kalle. 2002. Polyclonal long-term repopulating stem cell clones in a primate model. Blood 100:2737-2743.[Abstract/Free Full Text]
    43. 43
  43. Schroder, A. R., P. Shinn, H. Chen, C. Berry, J. R. Ecker, and F. Bushman. 2002. HIV-1 integration in the human genome favors active genes and local hotspots. Cell 110:521-529.[CrossRef][Medline]
    44. 44
  44. Takeuchi, Y., C. Patience, S. Magre, R. A. Weiss, P. T. Banerjee, P. Le Tissier, and J. P. Stoye. 1998. Host range and interference studies of three classes of pig endogenous retrovirus. J. Virol. 72:9986-9991.[Abstract/Free Full Text]
    45. 45
  45. Thomas, C. Y., M. A. Coppola, C. A. Holland, and A. C. Massey. 1990. Oncogenicity and U3 region sequences of class II recombinant MuLVs of CWD mice. Virology 176:166-177.[CrossRef][Medline]
    46. 46
  46. Tian, B., Y. Zhang, B. A. Luxon, R. P. Garofalo, A. Casola, M. Sinha, and A. R. Brasier. 2002. Identification of NF-kappaB-dependent gene networks in respiratory syncytial virus-infected cells. J. Virol. 76:6800-6814.[Abstract/Free Full Text]
    47. 47
  47. Trobridge, G. D., D. G. Miller, M. A. Jacobs, J. M. Allen, H. P. Kiem, R. Kaul, and D. W. Russell. 2006. Foamy virus vector integration sites in normal human cells. Proc. Natl. Acad. Sci. USA 103:1498-1503.[Abstract/Free Full Text]
    48. 48
  48. Venter, J. C., M. D. Adams, E. W. Myers, P. W. Li, R. J. Mural, G. G. Sutton, H. O. Smith, M. Yandell, C. A. Evans, R. A. Holt, J. D. Gocayne, P. Amanatides, R. M. Ballew, D. H. Huson, J. R. Wortman, Q. Zhang, C. D. Kodira, X. H. Zheng, L. Chen, M. Skupski, G. Subramanian, P. D. Thomas, J. Zhang, G. L. Gabor Miklos, C. Nelson, S. Broder, A. G. Clark, J. Nadeau, V. A. McKusick, N. Zinder, A. J. Levine, R. J. Roberts, M. Simon, C. Slayman, M. Hunkapiller, R. Bolanos, A. Delcher, I. Dew, D. Fasulo, M. Flanigan, L. Florea, A. Halpern, S. Hannenhalli, S. Kravitz, S. Levy, C. Mobarry, K. Reinert, K. Remington, J. Abu-Threideh, E. Beasley, K. Biddick, V. Bonazzi, R. Brandon, M. Cargill, I. Chandramouliswaran, R. Charlab, K. Chaturvedi, Z. Deng, V. Di Francesco, P. Dunn, K. Eilbeck, C. Evangelista, A. E. Gabrielian, W. Gan, W. Ge, F. Gong, Z. Gu, P. Guan, T. J. Heiman, M. E. Higgins, R. R. Ji, Z. Ke, K. A. Ketchum, Z. Lai, Y. Lei, Z. Li, J. Li, Y. Liang, X. Lin, F. Lu, G. V. Merkulov, N. Milshina, H. M. Moore, A. K. Naik, V. A. Narayan, B. Neelam, D. Nusskern, D. B. Rusch, S. Salzberg, W. Shao, B. Shue, J. Sun, Z. Wang, A. Wang, X. Wang, J. Wang, M. Wei, R. Wides, C. Xiao, C. Yan, A. Yao, J. Ye, M. Zhan, W. Zhang, H. Zhang, O. Zhao, L. Zheng, F. Zhong, W. Zhong, S. Zhu, S. Zhao, D. Gilbert, S. Baumhueter, G. Spier, C. Carter, A. Cravchik, T. Woodage, F. Ali, H. An, A. Awe, D. Baldwin, H. Baden, M. Barnstead, I. Barrow, K. Beeson, D. Busam, A. Carver, A. Center, M. L. Chang, L. Curry, S. Danaher, L. Davenport, R. Desilets, S. Dietz, K. Dodson, L. Doup, S. Ferriera, N. Garg, A. Gluecksmann, B. Hart, J. Haynes, C. Haynes, C. Heiner, S. Hladun, D. Hostin, J. Houck, T. Howland, C. Ibegwam, J. Johnson, F. Kalush, L. Kline, S. Koduru, A. Love, F. Mann, D. May, S. McCawley, T. McIntosh, J. Johnson, F. Kalush, L. Kline, S. Koduru, A. Love, F. Mann, D. May, S. McCawley, T. McIntosh, I. McMullen, M. Moy, L. Moy, B. Murphy, K. Nelson, C. Pfannkoch, E. Pratts, V. Puri, H. Qureshi, M. Reardon, R. Rodriguez, Y. H. Rogers, D. Romblad, B. Ruhfel, R. Scott, C. Sitter, M. Smallwood, E. Stewart, R. Strong, E. Suh, R. Thomas, N. N. Tint, S. Tse, C. Vech, G. Wang, J. Wetter, S. Williams, M. Williams, S. Windsor, E. Winn-Deen, K. Wolfe, J. Zaveri, K. Zaveri, J. F. Abril, R. Guigo, M. J. Campbell, K. V. Sjolander, B. Karlak, A. Kejariwal, H. Mi, B. Lazareva, T. Hatton, A. Narechania, K. Diemer, A. Muruganujan, N. Guo, S. Sato, V. Bafna, S. Istrail, R. Lippert, R. Schwartz, B. Walenz, S. Yooseph, D. Allen, A. Basu, J. Baxendale, L. Blick, M. Caminha, J. Carnes-Stine, P. Caulk, Y. H. Chiang, M. Coyne, C. Dahlke, A. Mays, M. Dombroski, M. Donnelly, D. Ely, S. Esparham, C. Fosler, H. Gire, S. Glanowski, K. Glasser, A. Glodek, M. Gorokhov, K. Graham, B. Gropman, M. Harris, J. Heil, S. Henderson, J. Hoover, D. Jennings, C. Jordan, J. Jordan, J. Kasha, L. Kagan, C. Kraft, A. Levitsky, M. Lewis, X. Liu, J. Lopez, D. Ma, W. Majoros, J. McDaniel, S. Murphy, M. Newman, T. Nguyen, N. Nguyen, M. Nodell, S. Pan, J. Peck, M. Peterson, W. Rowe, R. Sanders, J. Scott, M. Simpson, T. Smith, A. Sprague, T. Stockwell, R. Turner, E. Venter, M. Wang, M. Wen, D. Wu, M. Wu, A. Xia, A. Zandieh, and X. Zhu. 2001. The sequence of the human genome. Science 291:1304-1351.[Abstract/Free Full Text]
    49. 49
  49. Wang, Z., P. J. Troilo, X. Wang, T. G. Griffiths, S. J. Pacchione, A. B. Barnum, L. B. Harper, C. J. Pauley, Z. Niu, L. Denisova, T. T. Follmer, G. Rizzuto, G. Ciliberto, E. Fattori, N. L. Monica, S. Manam, and B. J. Ledwith. 2004. Detection of integration of plasmid DNA into host genomic DNA following intramuscular injection and electroporation. Gene Ther. 11:711-721.[CrossRef][Medline]
    50. 50
  50. Wilson, C. A., S. Wong, J. Muller, C. E. Davidson, T. M. Rose, and P. Burd. 1998. Type C retrovirus released from porcine primary peripheral blood mononuclear cells infects human cells. J. Virol. 72:3082-3087.[Abstract/Free Full Text]
    51. 51
  51. Wilson, C. A., S. Wong, M. VanBrocklin, and M. J. Federspiel. 2000. Extended analysis of the in vitro tropism of porcine endogenous retrovirus. J. Virol. 74:49-56.[Abstract/Free Full Text]
    52. 52
  52. Wood, J. C., G. Quinn, K. M. Suling, B. A. Oldmixon, B. A. Van Tine, R. Cina, S. Arn, C. A. Huang, L. Scobie, D. E. Onions, D. H. Sachs, H. J. Schuurman, J. A. Fishman, and C. Patience. 2004. Identification of exogenous forms of human-tropic porcine endogenous retrovirus in miniature Swine. J. Virol. 78:2494-2501.[Abstract/Free Full Text]
    53. 53
  53. Wu, X., and S. M. Burgess. 2004. Integration target site selection for retroviruses and transposable elements. Cell. Mol. Life Sci. 61:2588-2596.[CrossRef][Medline]
    54. 54
  54. Wu, X., Y. Li, B. Crise, and S. M. Burgess. 2003. Transcription start regions in the human genome are favored targets for MLV integration. Science 300:1749-1751.[Abstract/Free Full Text]
    55. 55
  55. Wu, X., Y. Li, B. Crise, S. M. Burgess, and D. J. Munroe. 2005. Weak palindromic consensus sequences are a common feature found at the integration target sites of many retroviruses. J. Virol. 79:5211-5214.[Abstract/Free Full Text]
    56. 56
  56. Yoshimura, F. K., T. Wang, and M. Cankovic. 1999. Sequences between the enhancer and promoter in the long terminal repeat affect murine leukemia virus pathogenicity and replication in the thymus. J. Virol. 73:4890-4898.[Abstract/Free Full Text]
    57. 57
  57. Zagranichnaya, T. K., X. Wu, A. M. Danos, and M. L. Villereal. 2005. Gene expression profiles in HEK-293 cells with low or high store-operated calcium entry: can regulatory as well as regulated genes be identified? Physiol. Genomics 21:14-33.[Abstract/Free Full Text]

Journal of Virology, November 2006, p. 10980-10988, Vol. 80, No. 22
0022-538X/06/$08.00+0     doi:10.1128/JVI.00904-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Moalic, Y., Felix, H., Takeuchi, Y., Jestin, A., Blanchard, Y. (2009). Genome Areas with High Gene Density and CpG Island Neighborhood Strongly Attract Porcine Endogenous Retrovirus for Integration and Favor the Formation of Hot Spots. J. Virol. 83: 1920-1929 [Abstract] [Full Text]  
  • Kim, S., Kim, N., Dong, B., Boren, D., Lee, S. A., Das Gupta, J., Gaughan, C., Klein, E. A., Lee, C., Silverman, R. H., Chow, S. A. (2008). Integration Site Preference of Xenotropic Murine Leukemia Virus-Related Virus, a New Human Retrovirus Associated with Prostate Cancer. J. Virol. 82: 9964-9977 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moalic, Y.
Right arrow Articles by Jestin, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moalic, Y.
Right arrow Articles by Jestin, A.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»