Previous Article | Next Article 
Journal of Virology, November 2006, p. 10942-10949, Vol. 80, No. 22
0022-538X/06/$08.00+0 doi:10.1128/JVI.00907-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Multivalent Sequence Recognition by Epstein-Barr Virus Zta Requires Cysteine 171 and an Extension of the Canonical B-ZIP Domain
Pu Wang,
Latasha Day, and
Paul M. Lieberman*
The Wistar Institute, Philadelphia, Pennsylvania 19104
Received 3 May 2006/
Accepted 24 August 2006

ABSTRACT
Epstein-Barr virus (EBV) immediate-early protein Zta is a member
of the basic-leucine zipper (B-ZIP) family of DNA binding proteins
that has an unusual capacity to recognize multiple DNA recognition
sites, including AP-1 and C/EBP binding sites. To better understand
the structure and function of Zta, we have mutagenized cysteine
residues within or adjacent to the B-ZIP domain. We found that
serine substitution for cysteine 171 (C171S), which lies outside
and amino terminal to the B-ZIP basic region, completely abrogates
Zta capacity to initiate lytic cycle replication. C171S disrupted
Zta transcription activation function of several EBV lytic cycle
promoters, including the BMRF1 gene (EA-D) and the other lytic
activator, Rta. Overexpression of Rta could not rescue the C171S
defect for transcription reactivation or viral DNA replication.
Zta C171S was defective for binding to these promoters in vivo,
as measured by chromatin immunoprecipitation assay. Purified
Zta C171S bound AP-1 sites similar to wild-type Zta, but it
was incapable of binding several degenerate Zta sites, including
a consensus C/EBP site. Zta truncation mutations reveal that
residues N terminal to the B-ZIP (amino acids 156 to 178) confer
C/EBP binding capacity to the otherwise AP-1-restricted DNA
recognition function. Comparison among viral orthologues of
Zta suggest that a conserved N-terminal extension of the consensus
B-ZIP domain is required for this multivalent DNA recognition
capacity of Zta and is essential for viral reactivation.

INTRODUCTION
Epstein-Barr virus (EBV) is a human lymphotropic herpesvirus
that contributes to the etiology of several lymphoid and epithelial
malignancies (reviewed in references
22 and
32). EBV exists
predominantly as a latent episome in B lymphocytes, but it periodically
enters a lytic replication cycle to produce progeny viral particles.
Lytic cycle reactivation can occur spontaneously or may be induced
by various signaling pathways linked to cell stress response
and B-cell differentiation (reviewed in reference
4). Lytic
cycle replication and associated gene products may contribute
directly and indirectly to EBV pathogenesis. In immunosuppressed
individuals, increased lytic infection has been directly linked
with oral hairy leukoplakia and indirectly linked with risk
of non-Hodgkins lymphomas (
16,
24). Detection of lytic antigens
correlates with risk of EBV-associated nasopharyngeal carcinoma
in areas where the virus is endemic (
13). Recent evidence also
indicates that lytic cycle gene products or viral replication
is required for EBV-associated tumorigenesis in mouse models
(
18,
19). Together, these findings suggest that lytic amplification
of infectious virus or viral gene products expressed during
latency contribute to EBV-associated pathogenesis.
The EBV lytic cycle can be initiated by ectopic expression of the immediate-early protein Zta (also referred to as BZLF1, ZEBRA, and EB1) (11, 12). Zta is a member of the basic leucine zipper (B-ZIP) family of DNA binding proteins with sequence similarity to C/EBP, c-jun, and c-fos (23). Zta binds multiple recognition sites, including AP-1 and C/EBP recognition sites, and activates transcription of both viral and cellular genes (10, 20, 28, 29). Zta functions as a DNA-bound transcription activator that can recruit cellular general transcription factors and coactivators to target promoters through an amino-terminal activation domain (14). Zta also functions as a lytic cycle replication factor by recruiting viral replication proteins to the origin of lytic replication (OriLyt) (26, 27, 33). Zta also modulates cellular functions, including transcription activation of cellular genes encoding transforming growth factor ß (10) and fatty acid synthase (25), inhibition of cell cycle progression (8, 9), and the disruption of the PML/ND10 (1, 5). Viruses lacking Zta are incapable of lytic cycle gene expression or DNA replication, indicating that Zta is essential for virus viability (15).
The Zta B-ZIP domain is essential for the multivalent DNA sequence recognition as well as for mediating interactions with numerous host cell proteins (1, 3, 17, 21, 36-39). In addition to recognizing diverse DNA sequences, Zta can recognize cytosine-methylated DNA sequences with higher affinity than unmethylated DNA (7). Recently, the three-dimensional structure of the Zta B-ZIP domain (amino acids 175 to 245) complexed to DNA was solved by X-ray crystallography (31). Important new insights were provided from this study, including the discovery of a novel hairpin-like fold in the C-terminal zipper region and a structural explanation for the diverse sequence recognition capability of Zta. However, some of the DNA binding properties of Zta were not apparent in the X-ray structure. For example, S186 plays a key role in the recognition of methylated cytosine (6), but this residue was mutated to alanine to improve increased resolution of the crystal structure. Similarly, the redox-sensitive cysteine 189 (C189), which we have shown is important for lytic cycle replication (35) and which can affect DNA binding specificity (34), was mutated to serine (31) in the solved structure. Consequently, the contribution of these critical residues to Zta structure and function remain elusive. In the studies presented here, we further explore the role of cysteine residues in Zta function and present evidence that a second cysteine at position 171 (C171) is essential for reactivation and for sequence recognition of C/EBP-like sites. These findings suggest that amino acid residues amino terminal to the consensus B-ZIP domain contribute to sequence recognition by a mechanism not revealed in the crystal structure, but they are nevertheless essential for lytic reactivation.

MATERIALS AND METHODS
Point mutations in Zta were generated by PCR mutagenesis using
the Quickchange site-directed mutagenesis kit (Stratagene).
Full-length Zta proteins with cysteine substitution mutations
were cloned into the BamHI site of a pQE8 bacterial expression
vector (QIAGEN). Zta truncation mutations N156 and N166 were
cloned into the NheI-HinDIII sites of pET28a. Zta N178 was cloned
into the BamHI site of pQE8. Zta wild type (wt), C171S, and
C132S were cloned as EcoRI-Sal1 fragments in p3XFLAG-myc-CMV24
vector (Sigma) for mammalian cell expression. Luciferase plasmids
for Zp, Rp, Hp, and Mp have been described previously (
14).
3
x AP-1/SV-LUC and 3
x C/EBP/SV-LUC were generated by cloning
the 3
x AP-1 oligonucleotide (5'GTACCACTGACTCATCACTGACTCATCACTGACTCATG)
or the 3
x C/EBP oligonucleotide (5'GTACCATTGCGCAATCATTGCGCAATCATTGCGCAATG)
into the Asp1/Nhe1 site of a pGL2 promoter (Invitrogen) which
contains the simian virus 40 early promoter region upstream
of the luciferase gene. Rta expression vector pRTS15 was a gift
from S. D. Hayward and contains the BRLF1 open reading frame
in a derivative of pSG5 (Stratagene). All of the methods for
this study have been described previously (
35). Sequences of
oligonucleotide probes for electrophoretic mobility shift assay
(EMSA) have been published previously (
31,
35).

RESULTS AND DISCUSSION
Identification of cysteine residues essential for lytic cycle replication.
A series of cysteine-to-serine mutations were introduced into
Zta (Fig.
1A). Previous studies demonstrated that combinations
of these cysteines were responsible for redox-sensitive DNA
binding but that no single cysteine could completely account
for this activity (
35). To further explore the molecular biology
of these cysteine residues in mediating Zta functions, we assayed
single cysteine-to-serine mutations at positions 189 and 222
as well as combined mutations at positions 189 and 222 (designated
189/222), 132/189/222, 171/189/222, and 132/171/189/222. These
cysteine substitution mutations were expressed as FLAG-tagged
proteins in ZKO-293 cells to determine their ability to stimulate
viral reactivation and lytic gene expression. ZKO-293 cells
contain a bacmid with the EBV genome lacking the Zta coding
sequence, and they are therefore well suited for Zta complementation
studies. We found that C189S, C222S, C189/222S, and C132/189/222S
activated EA-D and Rta in a manner indistinguishable from that
of wild-type Zta (Fig.
1B). In contrast, C171/189/222S and C132/171/189/222S
were significantly reduced for EA-D and Rta transcription activation
(Fig.
1B). These Zta mutants were then tested for their ability
to stimulate production of infectious virus (Fig.
1C) and amplification
of EBV genome DNA (Fig.
1D). We found the C189S was defective
for production of infectious virus and DNA amplification, consistent
with our previous report that this cysteine residue was critical
for viral lytic cycle replication (
35). We also observed that
C171/189/222S and C132/171/189/222S were reduced for production
of infectious virus (Fig.
1C) and completely defective for amplification
of genomic DNA (Fig.
1D). These findings indicate that combinations
of mutations containing C171S were highly defective for transcription
activation of some viral early genes and were incapable of lytic
cycle DNA replication.
Cysteine 171 is required for viral reactivation.
To determine if single-serine substitution mutations at C132
or C171 reduced Zta activity, we expressed C132S and C171S in
ZKO-293 cells (Fig.
2A) and assayed by Western blot for activation
of early lytic antigens EA-D and Rta. We found that C132S behaved
essentially like wild-type Zta, while C171S was defective for
activation of EA-D and Rta (Fig.
2A). This defect of C171S was
further validated by measuring the mRNA levels by reverse transcription-PCR
(Fig.
2B). C171S was incapable of stimulating EA-D or Rta mRNA
levels despite identical levels of Zta and glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) control mRNA in each reaction. We next
tested whether C132S or C171S could stimulate DNA amplification
of latently infected EBV in ZKO-293 cells (Fig.
2C). We found
that C132S stimulated viral DNA amplification at a level similar
to that of wt Zta (

40- to 50-fold relative to cellular actin
DNA), while C171S was incapable of stimulating viral DNA amplification
(Fig.
2C). Both C132S and C171S were expressed to similar levels
as wt Zta, as demonstrated by the Western blot shown in Fig.
2A (Zta panel). These findings indicate that C171S is incapable
of stimulating viral reactivation of gene expression and lytic
replication.
C171 is required for transcription activation of viral early promoters.
To further understand the mechanistic basis for the defect in
C171S reactivation function, we assayed the ability of C171S
and C132S to stimulate transcription activation of four lytic
cycle promoters using a luciferase reporter assay (Fig.
3).
We found that C171S was defective for activation of the BMRF1
(Mp), BHLF1 (Hp), BRLF1 (Rp), and BZLF1 (Zp) early region promoters,
while C132S behaved indistinguishably from wild-type Zta. In
particular, Zta C171S stimulated the Mp and Hp promoters to

14% of wt Zta and stimulated the Rp and Zp promoters to

25-
to 30% of the wt. Expression levels for Zta wt, C132S, and C171S
were nearly identical, indicating that these differences in
transcription activity were not attributable to differences
in protein expression levels. These findings indicate that C171S
is defective for transcription activation of all of the viral
early promoters tested but may also have more pronounced defects
at some subset of these promoters.
We next determined whether Zta C171S was defective for binding
to the target promoter regions of EBV DNA in vivo using real-time
PCR analysis of chromatin-immunoprecipitated (ChIP) DNA (Fig.
4A to D). We found that C171S was substantially reduced for
binding at all promoters tested relative to wt Zta. Binding
at BHLF1p and BHRF1p was reduced approximately six- to sevenfold
relative to wild-type Zta (Fig.
4A and B), while binding at
BMRF1p and BRLF1p was reduced only approximately twofold relative
to wt Zta (Fig.
4C and D). These findings suggest that C171S
impairs Zta DNA binding capabilities but has more penetrating
effects on the DNA binding at some sites (e.g., BHLF1) relative
to other sites (BMRF1p).
Since reactivation is strongly dependent on Rta coexpression,
and since C171S is defective for transcription activation of
Rta through the BRLF1 promoter, we tested whether overexpression
of Rta could rescue the C171S defect. Others have found that
Rta could rescue the reactivation defects in other Zta mutations,
especially the S186A mutation that is defective for binding
methylated DNA at the BRLF1 promoter (
2). An Rta expression
vector was cotransfected with or without Zta wt, C132S, or C171S
expression vectors and assayed for Zta, Rta, and EA-D expression
(Fig.
4E), as well as for viral DNA amplification (Fig.
4F)
in ZKO-293 cells. Short exposures of Western blots revealed
that EA-D levels were elevated by cotransfection of Rta with
Zta wt and Zta C131S but not significantly in the presence of
Zta C171S (Fig.
4E, middle panel). Longer exposure times indicate
that Rta coexpression does stimulate EA-D expression in the
presence of C171S but to a lesser extent than that of C131S
or wt Zta (Fig.
4E, top panel). We also noted that Rta levels
were consistently lower in the presence of Zta C171S, suggesting
that stabilizing interactions between Zta and Rta may also be
affected by mutations in Zta. Expression levels of Zta were
nearly identical for wt, C132S, and C171S, as were control levels
for cellular PCNA. We next asked whether the addition of Rta
was sufficient to rescue the defect in C171S in lytic DNA replication
(Fig.
4F). We found that Rta cotransfection had a slight stimulation
on the DNA replication of C132S but had no detectable effect
on C171S, which was indistinguishable from vector control, while
Zta wt stimulated viral DNA

70-fold. We conclude from these
studies that Rta cotransfection cannot rescue the defect of
C171S on lytic DNA replication or EA-D transcription activation.
These findings indicate that the defect in Zta C171S is not
limited to the expression of Rta through the transcription activation
of the BRLF1 promoter.
C171 is required for binding to C/EBP sites but not AP-1 sites.
The transcription activation defects at several different promoters (Fig. 3) and the failure of Zta C171S to bind BHLF1 and BHRF1 promoter regions by ChIP assay (Fig. 4A to D) suggest that C171S has a primary defect in DNA binding at some, but not necessarily all, recognition sites. Therefore, we assayed the DNA binding activity of purified Zta proteins for several different Zta recognition sites in vitro using electrophoretic mobility shift assay (EMSA). C171S, C132S, and wt Zta were expressed and purified from Escherichia coli and adjusted to identical protein concentrations (Fig. 5A). These proteins were assayed for DNA binding to several Zta recognition sequences. We found that C171S bound the BRLF1 ZRE2 site with affinity nearly identical to that of wild-type Zta and C132S (Fig. 5B). In contrast, Zta C171S was highly defective for binding the more degenerate recognition site ZRE3, also derived from the BRLF1 promoter, relative to Zta wt or C132S (Fig. 5C). A similar defect in Zta C171S was observed when tested for binding to the cytosine-methylated form of these ZRE3 sites (Fig. 5D), with no significant change in wt or C132S Zta. These findings suggest that C171S limits the variety of sites recognized by Zta. To further explore this possibility, we compared C171S with wt and C132S Zta for binding to 11-bp probes that contain only the AP-1 or C/EBP recognition sites as described in the crystallographic studies (31). We found that C171S bound the AP-1 site at levels similar to those of Zta wt and C132S (Fig. 5E). In striking contrast, C171S was incapable of binding the C/EBP site probe, while the wt and C132S Zta proteins bound with similar affinity to that of the AP-1 site (Fig. 5F). These findings indicate that C171S abrogates the C/EBP site recognition capability of Zta but has limited effect on the AP-1 binding activity.
To determine if this difference in DNA binding recognition correlated
with transcription activation function, we generated reporter
constructs with either 3
x AP-1 sites or 3
x C/EBP sites in the
pGL2 promoter construct, which places these test sequences immediately
upstream of the simian virus early promoter driving the luciferase
gene (Fig.
6A). We compared wt and C171S Zta expression vectors
for their ability to stimulate transcription from either 3
x AP-1/SV-LUC or 3
x C/EBP/SV-LUC in 293 cells. We found that Zta
C171S stimulated the AP-1-containing construct to levels

48%
of that of wt Zta (Fig.
6B and C). In contrast, C171S stimulated
the C/EBP-containing construct to only

13% of that of wt Zta
(Fig.
6B and C). These findings indicate that C171S was approximately
threefold more defective for transcription activation of the
C/EBP-containing promoter than the AP-1-containing promoter.
This activation correlates well with the difference in DNA binding
activity (Fig.
5E and F) and further supports our model that
C171S affects the DNA recognition capabilities of Zta.
Evidence for a conserved amino-terminal extension of the B-ZIP basic region required for multiple-sequence recognition.
A comparison of Zta proteins from the related cercopithecine
herpesvirus 15 and callitrichine herpesvirus 3 revealed a strong
conservation of the C171 residue as well as an additional stretch
of residues extending to amino acid 156 of Zta (Fig.
7A). To
test if this additional stretch of conserved amino acids contribute
to DNA binding recognition, we compared Zta proteins with N
termini initiating at amino acid 156 (N156), 166 (N166), or
178 (N178) (Fig.
7B). These proteins were expressed and purified
from
E. coli and adjusted for protein concentration by Coomassie
staining (Fig.
7C), and they were then assayed for their ability
to bind to the AP-1 or C/EBP 11-mer probes (Fig.
7D). We found
that the shortest derivative, N178, bound to AP-1 weakly and
did not bind to the C/EBP probe. The N166 truncation bound to
the AP-1 probe with high affinity (lanes 5 to 7) but did not
bind detectably to the C/EBP probe (lanes 15 to 17). In contrast,
the N156 truncation bound with high affinity to AP-1 (lanes
8 to 10) and nearly similar affinity to the C/EBP probe (lanes
18 to 20). These findings indicate that the amino acids N terminal
to the canonical basic region of the B-ZIP domain stimulate
binding to a C/EBP recognition site. Since the N156 truncation
did not bind C/EBP with the same affinity as the AP-1 site but
the full-length protein bound both sites with equal affinity
(Fig.
5E and F), it is likely that additional N-terminal amino
acids contribute further to the recognition of C/EBP and other
non-AP-1 consensus sites found throughout the viral and cellular
genome.
Conclusions.
In this work, we found that serine substitution for cysteine
171 disrupted the transcription activation and lytic cycle replication
function of Zta (Fig.
2). C171S was defective for binding to
viral target sequences at several viral promoters in vivo using
ChIP assay (Fig.
4A to D), and purified recombinant C171S was
defective for binding to a subset of target sites in vitro (Fig.
5). C171S in the context of full-length Zta protein bound to
AP-1-like sites with nearly equal affinity to wt Zta but did
not bind to several non-AP-1 consensus sites or to a consensus
C/EBP site. Truncation mutations revealed that amino acids N
terminal to the B-ZIP homology domain contribute to the C/EBP
site recognition more significantly than to the AP-1 site. X-ray
crystallography studies with a Zta truncation protein starting
at amino acid 175 showed detectable but reduced binding to C/EBP
sites relative to AP-1 sites (
31). These structural studies
are essentially consistent with our findings, although we now
propose that amino acids N terminal to the basic region contribute
significantly to multiple-sequence recognition. Additional structural
studies with Zta peptides extended in the amino-terminal direction
may be informative and may reveal a novel stabilization domain
similar to that observed at the C-terminal side of the zipper/dimerization
domain.
In addition to these structural implications, our data also indicate that multiple-sequence recognition by Zta is required for lytic cycle reactivation. While we cannot rule out that C171S eliminates some essential protein-protein interactions as well, our data are most consistent with the interpretation that multiple-site recognition properties of Zta are essential for completion of lytic cycle gene expression and DNA replication. Finally, it should be noted that regions amino terminal to other basic homology regions have been described, including the "cap 'n collar" motif of the MAF family of proteins, which contribute to DNA recognition during the oxidative stress response (30). We suspect that the region N terminal to the basic homology domain of Zta represents a conserved motif among Zta family members that is essential for multivalent DNA site recognition and other interactions required for lytic cycle activation.

ACKNOWLEDGMENTS
We thank H.-J. Delecluse for ZKO-293 cells and S. D. Hayward
for Rta expression vector pRTS15.
This work was supported by grants from the NIH (GM 54687 and CA86678), from the Wistar Cancer Center (NCI), and from the PA Settlement for Tobacco Research.

FOOTNOTES
* Corresponding author. Mailing address: The Wistar Institute, 3601 Spruce St., Philadelphia, Pennsylvania 19104-4268. Phone: (215) 898-9491. Fax: (215) 898-0663. E-mail:
lieberman{at}wistar.org.

Published ahead of print on 13 September 2006. 

REFERENCES
1 - Adamson, A. L., and S. Kenney. 2001. Epstein-Barr virus immediate-early protein BZLF1 is SUMO-1 modified and disrupts promyelocytic leukemia bodies. J. Virol. 75:2388-2399.[Abstract/Free Full Text]
2 - Adamson, A. L., and S. C. Kenney. 1998. Rescue of the Epstein-Barr virus BZLF1 mutant, Z(S186A), early gene activation defect by the BRLF1 gene product. Virology 251:187-197.[CrossRef][Medline]
3 - Aho, S., M. Buisson, T. Pajunen, Y. W. Ryoo, J. F. Giot, H. Gruffat, A. Sergeant, and J. Uitto. 2000. Ubinuclein, a novel nuclear protein interacting with cellular and viral transcription factors. J. Cell Biol. 148:1165-1176.[Abstract/Free Full Text]
4 - Amon, W., and P. J. Farrell. 2005. Reactivation of Epstein-Barr virus from latency. Rev. Med. Virol. 15:149-156.[CrossRef][Medline]
5 - Bell, P., P. M. Lieberman, and G. G. Maul. 2000. Lytic but not latent replication of Epstein-Barr virus is associated with PML and induces sequential release of nuclear domain 10 proteins. J. Virol. 74:11800-11810.[Abstract/Free Full Text]
6 - Bhende, P. M., W. T. Seaman, H. J. Delecluse, and S. C. Kenney. 2005. BZLF1 activation of the methylated form of the BRLF1 immediate-early promoter is regulated by BZLF1 residue 186. J. Virol. 79:7338-7348.[Abstract/Free Full Text]
7 - Bhende, P. M., W. T. Seaman, H. J. Delecluse, and S. C. Kenney. 2004. The EBV lytic switch protein, Z, preferentially binds to and activates the methylated viral genome. Nat. Genet. 36:1099-1104.[CrossRef][Medline]
8 - Cayrol, C., and E. Flemington. 1996. G0/G1 growth arrest mediated by a region encompassing the basic leucine zipper (bZIP) domain of the Epstein-Barr virus transactivator Zta. J. Biol. Chem. 271:31799-31802.[Abstract/Free Full Text]
9 - Cayrol, C., and E. K. Flemington. 1996. The Epstein-Barr virus bZIP transcription factor Zta causes G0/G1 cell cycle arrest through induction of cyclin-dependent kinase inhibitors. EMBO J. 15:2748-2759.[Medline]
10 - Cayrol, C., and E. K. Flemington. 1995. Identification of cellular target genes of the Epstein-Barr virus transactivator Zta: activation of transforming growth factor ßigh3 (TGF-ßigh3) and TGF-ß1. J. Virol. 69:4206-4212.[Abstract]
11 - Chevallier, G. A., E. Manet, P. Chavrier, C. Mosnier, J. Daillie, and A. Sergeant. 1986. Both Epstein-Barr virus (EBV)-encoded trans-acting factors, EB1 and EB2, are required to activate transcription from an EBV early promoter. EMBO J. 5:3243-3249.[Medline]
12 - Countryman, J., and G. Miller. 1985. Activation of expression of latent Epstein-Barr herpesvirus after gene transfer with a small cloned subfragment of heterogeneous viral DNA. Proc. Natl. Acad. Sci. USA 82:4085-4089.[Abstract/Free Full Text]
13 - Dardari, R., M. Khyatti, A. Benider, H. Jouhadi, A. Kahlain, C. Cochet, A. Mansouri, B. El Gueddari, A. Benslimane, and I. Joab. 2000. Antibodies to the Epstein-Barr virus transactivator protein (ZEBRA) as a valuable biomarker in young patients with nasopharyngeal carcinoma. Int. J. Cancer 86:71-75.[CrossRef][Medline]
14 - Deng, Z., C.-J. Chen, D. Zerby, H.-J. Delecluse, and P. M. Lieberman. 2001. Identification of acidic and aromatic residues in the Zta activation domain essential for Epstein-Barr virus reactivation. J. Virol. 75:10334-10347.[Abstract/Free Full Text]
15 - Feederle, R., M. Kost, M. Baumann, A. Janz, E. Drouet, W. Hammerschmidt, and H. J. Delecluse. 2000. The Epstein-Barr virus lytic program is controlled by the co-operative functions of two transactivators. EMBO J. 19:3080-3089.[CrossRef][Medline]
16 - Greenspan, J. S., D. Greenspan, E. T. Lennette, D. I. Abrams, M. A. Conant, V. Petersen, and U. K. Freese. 1985. Replication of Epstein-Barr virus within the epithelial cells of oral "hairy" leukoplakia, an AIDS-associated lesion. N. Engl. J. Med. 313:1564-1571.[Abstract]
17 - Gutsch, D. E., E. A. Holley-Guthrie, Q. Zhang, B. Stein, M. A. Blanar, A. S. Baldwin, and S. C. Kenney. 1994. The bZIP transactivator of Epstein-Barr virus, BZLF1, functionally and physically interacts with the p65 subunit of NF-
B. Mol. Cell. Biol. 14:1939-1948.[Abstract/Free Full Text] 18 - Hong, G. K., M. L. Gulley, W. H. Feng, H. J. Delecluse, E. Holley-Guthrie, and S. C. Kenney. 2005. Epstein-Barr virus lytic infection contributes to lymphoproliferative disease in a SCID mouse model. J. Virol. 79:13993-14003.[Abstract/Free Full Text]
19 - Hong, G. K., P. Kumar, L. Wang, B. Damania, M. L. Gulley, H. J. Delecluse, P. J. Polverini, and S. C. Kenney. 2005. Epstein-Barr virus lytic infection is required for efficient production of the angiogenesis factor vascular endothelial growth factor in lymphoblastoid cell lines. J. Virol. 79:13984-13992.[Abstract/Free Full Text]
20 - Kenney, S., J. Kamine, E. Holley-Guthrie, J. C. Lin, E. C. Mar, and J. Pagano. 1988. The Epstein-Barr virus (EBV) BZLF1 immediate-early gene product differentially affects latent versus productive EBV promoters. J. Virol. 63:1729-1736.
21 - Kenney, S. C., E. Holley-Guthrie, E. B. Quinlivan, D. Gutsch, Q. Zhang, T. Bender, J. F. Giot, and A. Sergeant. 1992. The cellular oncogene c-myb can interact synergistically with the Epstein-Barr virus BZLF1 transactivator in lymphoid cells. Mol. Cell. Biol. 12:136-146.[Abstract/Free Full Text]
22 - Kieff, E. 1996. Epstein-Barr virus and its replication, p. 2343-2396. In D. Knipe and P. M. Howley (ed.), Fields virology, 3rd ed., vol. 2. Lippincott-Raven Publishers, Philadelphia, Pa.
23 - Kouzarides, T., G. Packham, A. Cook, and P. J. Farrell. 1991. The BZLF1 protein of EBV has a coiled coil dimerisation domain without a heptad leucine repeat but with homology to the C/EBP leucine zipper. Oncogene 6:195-204.[Medline]
24 - Lau, R., J. Middeldorp, and P. J. Farrell. 1993. Epstein-Barr virus gene expression in oral hairy leukoplakia. Virology 195:463-474.[CrossRef][Medline]
25 - Li, Y., J. Webster-Cyriaque, C. C. Tomlinson, M. Yohe, and S. Kenney. 2004. Fatty acid synthase expression is induced by the Epstein-Barr virus immediate-early protein BRLF1 and is required for lytic viral gene expression. J. Virol. 78:4197-4206.[Abstract/Free Full Text]
26 - Liao, G., J. Huang, E. D. Fixman, and S. D. Hayward. 2005. The Epstein-Barr virus replication protein BBLF2/3 provides an origin-tethering function through interaction with the zinc finger DNA binding protein ZBRK1 and the KAP-1 corepressor. J. Virol. 79:245-256.[Abstract/Free Full Text]
27 - Liao, G., F. Y. Wu, and S. D. Hayward. 2001. Interaction with the Epstein-Barr virus helicase targets Zta to DNA replication compartments. J. Virol. 75:8792-8802.[Abstract/Free Full Text]
28 - Lieberman, P. M., and A. J. Berk. 1990. In vitro transcriptional activation, dimerization, and DNA-binding specificity of the Epstein-Barr virus Zta protein. J. Virol. 64:2560-2568.[Abstract/Free Full Text]
29 - Lieberman, P. M., J. M. Hardwick, J. Sample, G. S. Hayward, and S. D. Hayward. 1990. The Zta transactivator involved in induction of lytic cycle gene expression in Epstein-Barr virus-infected lymphocytes binds to both AP-1 and ZRE sites in target promoter and enhancer regions. J. Virol. 64:1143-1155.[Abstract/Free Full Text]
30 - Motohashi, H., T. O'Connor, F. Katsuoka, J. D. Engel, and M. Yamamoto. 2002. Integration and diversity of the regulatory network composed of Maf and CNC families of transcription factors. Gene 294:1-12.[CrossRef][Medline]
31 - Petosa, C., P. Morand, F. Baudin, M. Moulin, J. B. Artero, and C. W. Muller. 2006. Structural basis of lytic cycle activation by the Epstein-Barr virus ZEBRA protein. Mol. Cell 21:565-572.[CrossRef][Medline]
32 - Rickinson, A. B., and E. Kieff. 1996. Epstein-Barr Virus, p. 2397-2446. In D. Knipe and P. M. Howley (ed.), Fields virology, 3rd ed., vol. 2. Lippincott-Raven Publishers, Philadelphia, Pa.
33 - Sarisky, R. T., Z. Gao, P. M. Lieberman, E. D. Fixman, G. S. Hayward, and S. D. Hayward. 1996. A replication function associated with the activation domain of the Epstein-Barr virus Zta transactivator. J. Virol. 70:8340-8347.[Abstract]
34 - Schelcher, C., S. Valencia, H. J. Delecluse, M. Hicks, and A. J. Sinclair. 2005. Mutation of a single amino acid residue in the basic region of the Epstein-Barr virus (EBV) lytic cycle switch protein Zta (BZLF1) prevents reactivation of EBV from latency. J. Virol. 79:13822-13828.[Abstract/Free Full Text]
35 - Wang, P., L. Day, J. Dheekollu, and P. M. Lieberman. 2005. A redox-sensitive cysteine in Zta is required for Epstein-Barr virus lytic cycle DNA replication. J. Virol. 79:13298-13309.[Abstract/Free Full Text]
36 - Wu, F. Y., H. Chen, S. E. Wang, C. M. ApRhys, G. Liao, M. Fujimuro, C. J. Farrell, J. Huang, S. D. Hayward, and G. S. Hayward. 2003. CCAAT/enhancer binding protein alpha interacts with ZTA and mediates ZTA-induced p21(CIP-1) accumulation and G(1) cell cycle arrest during the Epstein-Barr virus lytic cycle. J. Virol. 77:1481-1500.[CrossRef][Medline]
37 - Wu, F. Y., S. E. Wang, H. Chen, L. Wang, S. D. Hayward, and G. S. Hayward. 2004. CCAAT/enhancer binding protein alpha binds to the Epstein-Barr virus (EBV) ZTA protein through oligomeric interactions and contributes to cooperative transcriptional activation of the ZTA promoter through direct binding to the ZII and ZIIIB motifs during induction of the EBV lytic cycle. J. Virol. 78:4847-4865.[Abstract/Free Full Text]
38 - Zerby, D., C.-J. Chen, E. Poon, D. Lee, R. Shiekhattar, and P. M. Lieberman. 1999. The amino-terminal C/H1 domain of CREB binding protein mediates Zta transcription activation of latent Epstein-Barr virus. Mol. Cell. Biol. 19:1617-1626.[Abstract/Free Full Text]
39 - Zhang, Q., D. Gutsch, and S. Kenney. 1994. Functional and physical interaction between p53 and BZLF1: implications for Epstein-Barr virus latency. Mol. Cell. Biol. 14:1929-1938.[Abstract/Free Full Text]
Journal of Virology, November 2006, p. 10942-10949, Vol. 80, No. 22
0022-538X/06/$08.00+0 doi:10.1128/JVI.00907-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Wiedmer, A., Wang, P., Zhou, J., Rennekamp, A. J., Tiranti, V., Zeviani, M., Lieberman, P. M.
(2008). Epstein-Barr Virus Immediate-Early Protein Zta Co-Opts Mitochondrial Single-Stranded DNA Binding Protein To Promote Viral and Inhibit Mitochondrial DNA Replication. J. Virol.
82: 4647-4655
[Abstract]
[Full Text]