Previous Article | Next Article ![]()
Journal of Virology, November 2006, p. 10419-10427, Vol. 80, No. 21
0022-538X/06/$08.00+0 doi:10.1128/JVI.00698-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Department of Biological Sciences,1 Department of Biochemistry, National University of Singapore, Singapore2
Received 6 April 2006/ Accepted 14 August 2006
|
|
|---|
|
|
|---|
WSSV belongs to a new virus family, Nimaviridae, under a new genus, Whispovirus, which shares low sequence homology with other DNA viruses (16, 24). WSSV is an enveloped virus with a 305-kb double-stranded circular DNA genome. Its genome was completely sequenced, with 180 predicted open reading frames (ORFs) (27). Most of these WSSV genes bear poor sequence homology with other known proteins, and thus the function of these genes cannot be predicted. However, a large amount of work has been carried out on the identification and characterization of WSSV structural proteins, including envelope and other capsid proteins. To date, a total of 39 structural proteins are known from WSSV (12, 23). A structure-based functional study is a promising approach to elucidate the function of such WSSV proteins. Besides the envelope and capsid proteins, nonstructural proteins are required for replication of the viral genome, production of the virus particle, and inhibition of the host cell functions. These proteins are therefore potential candidates for drug design and the development of vaccines.
Here we report, for the first time, the identification of a novel, nonstructural WSSV protein, VP9. We have demonstrated its abundance both at mRNA and protein levels. In addition, the presence of VP9 in WSSV-infected tissues detected by Western blotting and mass spectrometry was in agreement with immunoelectron microscopy results. Furthermore, in order to shed light on its presumptive function, both the X-ray and nuclear magnetic resonance (NMR) structures of VP9 were determined. In addition, we have studied the metal binding properties of VP9, using NMR titration and X-ray diffraction of Cd2+-bound crystals of VP9. Based on these studies, we propose that VP9 might recognize DNA in a manner similar to its structural homolog, the papillomavirus-1 E2 protein, and thus possibly acts as a transcriptional regulator of WSSV.
|
|
|---|
Cloning, expression, purification, and production of polyclonal antibody. Using specific primers 5' CGCGCGCATATGGCCACCTTCCAGACTGAC 3' and 3' CGCGGATCCTTATTCTGTTGTTGGCAC 5', gene vp9 was PCR amplified and ligated with pET15b through NdeI/BamHI restriction enzyme sites. The plasmid was transformed into Escherichia coli BL-21 cells (DE3; Novagen). The overexpressed VP9 protein was purified by a nickel-nitrilotriacetic acid column (QIAGEN) followed by on-column thrombin cleavage (Sigma). His tag-removed VP9 was further purified by ion exchange chromatography (Amersham) followed by gel filtration chromatography using a Superdex 30 column (Amersham). Fractions containing the native VP9 were pooled and concentrated to 20 mg ml1 using Amicon (Millipore). In addition, 15N- and 15N/13C-labeled VP9 were prepared in M9 medium with the addition of (15NH4)2SO4 for 15N labeling and (15NH4)2SO4 and [13C]glucose for 15N/13C double labeling, respectively. All samples used for NMR studies were dissolved in a buffer containing 20 mM sodium phosphate, pH 6.8, and Sigma cocktail proteinase inhibitor. In addition, anti-VP9 polyclonal antibodies were raised from the New Zealand White female rabbit, and the serum was purified by agarose A (Roche).
Western blot and immunoelectron microscopy analyses. Virus inocula were prepared (26) and injected intramuscularly into healthy crayfish (Cherax quadricarinatus). After 4 to 5 days, WSSV virions were purified by sucrose gradient centrifugation as described previously (11). Purified WSSV was further separated into envelope and nucleocapsid fractions (28). Gills and stomachs from moribund crayfish were homogenized separately in a lysis buffer (1% NP-40; 150 mM NaCl, 50 mM Tris, pH 8.0, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride). Ten micrograms of each sample was loaded onto a 10 to 20% gradient sodium dodecyl sulfate-polyacrylamide gel electrophoresis ready gel (Bio-Rad) followed by Western blot analysis. For Western blotting, three antibodies were used, including anti-ß-actin, anti-VP28, and anti-VP9. In addition, immunoelectron microscopy was carried to determine the location of VP9 on virions (28); for immunoelectron microscopy, three antibodies used included anti-VP28, anti-VP664, and anti-VP9. To reconfirm the authenticity of VP9, total tissue lysates were separated by performing a 10 to 20% gradient gel in parallel with the gel for Western blotting. A protein band at approximately 9 kDa was found and analyzed with in-gel tryptic digestion matrix-assisted laser desorption ionization-time of flight mass spectrometry analysis as described previously (21).
NMR experiments and NMR structure calculation. 1H, 15N, and 13C NMR data were acquired at 298 K on an 800 MHz Avance spectrometer (Bruker) or on a 500 MHz Avance spectrometer (Bruker) equipped with both an actively shielded cryoprobe and pulse field gradient units. The NMR experiments included 15N-edited heteronuclear single quantum coherence spectroscopy (HSQC), HNCACB, and CBCA (CO)NH for backbone assignments and three-dimensional total correlation spectroscopy (3D-TOCSY), three-dimensional nuclear overhauser enhancement spectroscopy (3D-NOESY), and HCCH-TOCSY for side chain assignments. All NMR data were processed with NMRPipe (7) and analyzed with NMRView (13). Structure calculation was performed with the program CYANA (9). Distance constraints were obtained from 1H/1H NOEs derived from 15N-NOESY and 13C-NOESY spectra. Hydrogen bond restraints were derived from HSQC-based hydrogen-deuterium exchange experiments. The phi and psi angle constraints were generated from the TALOS program (5). Ten conformers with the lowest final values of the DYANA target function were chosen to represent the most probable structures.
NMR titration experiments. To study the interaction between VP9 and various divalent metals, two-dimensional 1H-15N HSQC spectra of the 15N-labeled VP9 were measured at a concentration of 0.1 mM in the absence and presence of divalent metals, such as Zn2+, Cd2+, Ca2+, and Mg2+. The final ratio of the VP9 to metal was 1:4. The perturbed residues were assigned by superimposing the two 15N-HSQC spectra in the absence and the presence of different metals.
Crystallization and data collection.
Crystals of VP9 were obtained by using the hanging drop vapor diffusion method. Initial crystallization conditions were established by Hampton Research screens (HR screen II) and were further optimized. Best crystals were obtained with a reservoir solution consisting of 2 M sodium acetate, 100 mM morpholinepropanesulfonic acid, pH 6.3, 25 mM cadmium sulfate, and 3% glycerol. Crystals grew to approximate sizes of
0.2 by 0.2 by 0.1 mm3 over 7 days. Prior to mounting, crystals were briefly soaked for
20 s in a cryoprotectant solution consisting of a mixture of 50:50 mineral oil and paraffin oil, picked up in a nylon loop, and flash cooled at 100 K in a nitrogen gas cold stream (Oxford Cryosystems, Oxford, United Kingdom). Synchrotron data were collected at X12C beam-line, National Synchrotron Light Source, Brookhaven National Laboratory. Our aim was to collect a complete sulfur single wavelength anomalous diffraction (SAD) data set. A total of 1,080 frames (360° three times) were collected at 1.7-Å wavelength with an oscillation of 1.0° using a charge-coupled device detector to 2.3-Å resolution. Diffraction data were processed using the program HKL2000 (17). Crystals belonged to the space group P212121, with a = 73.23 Å, b = 76.97 Å, c = 78.24 Å, with four molecules forming an asymmetric unit. Subsequently, a high-resolution data set was collected up to 2.2 Å for phase extension and refinement.
Structure solution and refinement.
For phase determination, the resolution range of 2.6 to 20.0 Å was chosen. During phasing trials, a strong anomalous contribution from Cd2+ was identified with appropriate f' and f". Assignment as Cd2+ was consistent with the high concentration of CdSO4 that was essential for crystallization. This interpretation explains why SAD phasing around the S absorption edge was unsuccessful. Initial phase calculations were carried out with SOLVE (22). Subsequent heavy-atom refinement and density modification was carried out using SHARP (6). The resulting phase gave an overall figure of merit of 0.69. The starting electron density map was further improved by phase extension up to 2.35 Å using the program wARP, which was able to trace the main-chain atoms up to
38% of the model. The remaining parts of the model were built manually using the program O (14). Further cycles of model building alternating with refinement using the program CNS (2) resulted in a final model with an R factor of 0.225- (Rfree = 0.275) to 2.35-Å resolution with no
cutoff used during refinement. Noncrystallographic symmetry (NCS) restraints were used only during the initial stage of refinement. The VP9 model comprises 316 residues, 8 Cd2+ ions, and 125 water molecules in the asymmetric unit. The first well-ordered residue was Ala2. The last two residues and the first three residues of the linker region could not be traced in the electron density map and were not modeled. Validation of the model was done using PROCHECK (15).
PDB coordinates. The NMR structures and X-ray structure Protein Data Bank (PDB) coordinates of VP9 were deposited in the PDB under numbers 2GJI and 2GJ2, respectively.
|
|
|---|
![]() View larger version (11K): [in a new window] |
FIG. 1. Transcriptional analysis of WSSV by real-time RT-PCR. In this study, relative quantification was calculated using CT, where CT refers the difference between the cycle thresholds (CTs) of the target genes and the housekeeping gene ß-actin. CT for vp9 (wsv230) is colored in blue, dnapol (wsv514) in black, and vp28 (wsv421) in red.
|
![]() View larger version (100K): [in a new window] |
FIG. 2. Localization analysis of VP9 by Western blotting. (A) WSSV virions; (B) noninfected stomach; (C) noninfected gill; (D) WSSV-infected stomach; (E) WSSV-infected gills; (F) envelope fraction; (G) nucleocapsid fraction. Also shown are localization analyses by immunoelectron microscopy using (H) anti-VP28 (envelop protein) as a positive control, (I) anti-VP664 (nucleocapsid) as a positive control, and (J) anti-VP9, respectively.
|
1.194 Å for 74 C
atoms (Phe4 to Thr76), which indicated a good agreement between the two structures. It is worth mentioning that the NMR structure was determined in conditions free of metal ions, whereas the X-ray structure was determined with Cd2+ ions. The observed metal ion was located on the monomer interface of the dimer and also on the surface of the molecule. This suggested that the metal ion was not essential for the folding of VP9. The structure of VP9 revealed a ferredoxin fold, a well-known nucleotide recognition fold. The following structural description is based on the crystal structure.
X-ray.
The crystal structure of VP9 from WSSV was determined by the SAD method from synchrotron data and refined to a final R factor of 0.225 (Rfree = 0.275) at 2.35-Å resolution (Fig. 3). The VP9 model was refined with good stereochemical parameters (Table 1). The asymmetric unit consists of four molecules comprising 79 residues each from Ala2 to Thr80 and a total of 125 water molecules. The monomer of VP9 molecule adopts a mixed
/ß fold with overall dimensions of 32 Å by 25 Å by 20 Å. A total of six ß-strands and two
-helices are found per molecule. The anti-parallel ß-strands ß3
ß4
ß2
ß6
assemble into a single ß-sheet (ß-sheet I), which forms one face of the molecule. The ß-sheet II is rather small, consisting of only two ß-strands, ß1
ß5
. The two
-helices
1 and
2 as well as ß-sheet II are packed on the same side of ß-sheet I.
![]() View larger version (38K): [in a new window] |
FIG. 3. Crystal structure of VP9. Two dimers of one asymmetry unit with four cadmium ions (blue spheres) are shown. VP9 is shown as ribbons with the -helix in red, the ß-sheet in cyan, and the random coil and loop in gray.
|
|
View this table: [in a new window] |
TABLE 1. Data collection and refinement statistics
|
2-helix, and its connecting loop from each monomer.
NMR.
To assess whether the dimerization observed in crystal structure is relevant in solution, we have conducted extensive characterization by gel filtration, dynamic light scattering (DLS), analytic ultracentrifuge (AUC), and NMR relaxation measurements. The gel filtration and DLS results indicated that the apparent molecular mass was
16 kDa, while analytic ultracentrifuge and NMR relaxation studies estimated the apparent molecular mass to be
11 to 12 kDa. Moreover, only one set of HSQC peaks was observed for VP9 residues. These results imply that in solution, VP9 protein exists in fast exchange equilibrium between monomer and symmetric dimer.
Since in solution VP9 undergoes a fast exchange between monomer and symmetric dimmer, the solution structure of VP9 was also determined by heteronuclear, multidimensional NMR spectroscopy. Ten conformers with the lowest target function values were chosen to represent the most probable structures from 100 randomized starting models (Fig. 4). Assignment of backbone and side chain resonances was accomplished by a combination of double- and triple-resonance experiments. Briefly, backbone assignments were complete except for two proline residues. More than 92% of side chains were assigned. The final NMR structure of the full-length VP9 was calculated and refined with the CYANA program. This calculation was based on 1,572 manual and autoassigned distance restraints (548 intraresidue, 349 sequential, 212 medium range, and 463 long range) and 74 backbone dihedral-angle restraints (Table 2). The Ramachandran map indicated that the majority of the residues (84.9%) had angular averages in energetically most favorable regions, 15.1% in additional allowed regions, and none in the generously allowed or disallowed regions.
![]() View larger version (42K): [in a new window] |
FIG. 4. NMR structure of VP9. Shown are ten lowest energy structures of VP9 superimposed as ribbons with -helix in red, ß-sheet in cyan, and random coil and loop in gray.
|
|
View this table: [in a new window] |
TABLE 2. NMR structural statisticsd
|
Sequence and structural homology.
Blast searches revealed that VP9 has sequence homologies only with a few other WSSV proteins of unknown function. It exhibits a maximum identity of 43% with wsv234 and a minimum of 31% with wsv231 from WSSV. Searches for structurally similar proteins within the PDB were performed with the program DALI (10). Significant structural similarities were found with several nucleotide binding and metal transport/binding proteins. The highest structural similarity was observed between VP9 and bovine papillomavirus-1 E2 DNA-binding protein (PDB code 2BOP), yielding an rmsd of 3.0 Å for 63 C
atoms, with 17% sequence identity. This was followed by a metal transporting ATPase (PDB code, 1MWY; rmsd of 2.4 Å for 59 C
atoms, with 14.6% identity) and Atx1 metallochaperone (PDB code 1CC8; rmsd of 2.6 Å for 62 C
atoms; 13.4% identity). These structurally homologous proteins were superimposed with O program, and their conformational similarities and differences were examined. Except for
2 of VP9 and other small local structural differences, all the secondary structural elements were comparable and superimposable.
2 of VP9 was in a completely different disposition. The observed structural differences could be partly responsible for its functional specificity in WSSV.
Metal binding sites. In the electron density map of the native protein, there were eight strong peaks corresponding to metal ions (Fig. 5a). Based on the coordination, we have interpreted these peaks as Cd2+ ions. It is worth mentioning here that the Cd2+ ions were essential for crystallization; these metal ions must have been acquired during the crystallization process. The presence of tightly bound divalent metal ions has been previously reported for the structural homologs of VP9 (1, 18).
![]() ![]() View larger version (75K): [in a new window] |
FIG. 5. (a) Simulated annealing Fo-Fc omit map in the dimerization region of VP9. All three cadmium ions (green) and all atoms within 3.5 Å of cadmium ions were omitted prior to refinement and map calculation. The map was contoured at a level of 2.5 . This figure was prepared using the program Bobscript. (b) Stick representation for the cadmium coordination sphere. A yellow dashed line indicates the coordination bond. Cd2+ is in green and a water molecule is in red. Asp9, Cys46, and Glu31 from one monomer are shown in cyan, and the other monomer in magenta.
|
NMR metal titration. The binding interactions of VP9 with the four most common metal ions, Zn2+, Cd2+, Mg2+, and Ca2+, were studied. The results indicated that only Zn2+ and Cd2+ were able to bind with VP9. Therefore, we have monitored the binding interaction between 15N-labeled VP9 and zinc/cadmium. Figure 6a shows the binding profiles of VP9 with Zn2+. A detailed analysis of the HSQC titration resulted in the identification of 42 perturbed peaks that either disappeared or underwent chemical shifts. Peaks disappeared because of NMR resonance broadening, indicating that binding led to a significant increase in the conformational exchange on the microsecond-millisecond time scale. The pattern for cadmium was similar to that for zinc (Fig. 6b). However, there is no detectable interaction between VP9 with either magnesium or calcium (data not shown) compared to zinc/cadmium. Our data suggested that VP9 binds to both zinc and cadmium.
![]() View larger version (17K): [in a new window] |
FIG. 6. Dual 1H-15N HSQC spectra of VP9 in the absence (red) and presence (blue) of Zn-sulfate (a) and Cd-sulfate (b). Shown is a superimposition of the 1H-15N HSQC spectra of the free form of VP9 in red and in the complex with zinc sulfate/cadmium sulfate in blue at a ratio of about 1:4 at pH 6.72 and 298 K. Forty-two perturbed peaks that either disappeared or underwent chemical shifts refer to Asn56, Tyr43, Glu31, Glu72, Arg19, Met44, Leu12, Gln74, Val45, Gly50, Gly57, Leu11, Leu47, Lys35, Leu55, Glu21, Gly14, Thr6, Ile59, Ser36, Val13, Arg63, Asp40, Asp15, Met76, Thr52, Leu48, Cys46, Val78, Ala2, Thr80, Thr81, Ile77, Phe4, Asp7, Ala32, Phe10, Asp9, Leu64, Gln5, Glu61, and Leu62. Of 42 perturbed peaks, Asp9, Phe10, Glu31, Val45, Cys46, Leu47, and Leu48 were perturbed the most due to close locations to the metal binding sites.
|
-helices of the E2 dimer. The superposition of the VP9 and papillomavirus-1 E2 bound with the DNA fragment reveals a possible DNA binding mode of VP9. The specific DNA sequence for recognition by VP9 has not yet been established. A possible DNA recognition region is located at
1 (Thr17-Thr26) and the ß-turn (Ser36-Asp40). The helix
1 is highly conserved among all structural homologs of VP9. In the superimposed model, the side chains from Arg19 and Lys25 from
1 are facing the DNA. Figure 7 shows the DNA binding model for VP9. It shows only the monomer of VP9 superimposed with the monomer of the E2 DNA binding domain. In the E2 crystal structure, the DNA fragment binds with the dimer. However, in the case of VP9, the superimposed DNA fragment has to undergo a conformational change to engage with both monomers of the dimer. Similar conformational changes upon DNA binding were previously documented for several DNA protein complexes (8).
![]() View larger version (49K): [in a new window] |
FIG. 7. Proposed DNA binding model. Superimposition of E2 monomer (with DNA molecules) on VP9 monomer. DNA is shown in stick representation (blue), E2 in ribbon representation (red), and VP9 in ribbon representation (yellow). 1 of E2 and VP9 is highlighted in magenta and cyan, respectively, as shown in the box.
|
We are grateful for the funding support by MOE (Ministry of Education of Singapore) to Choy L. Hew.
Published ahead of print on 6 September 2006. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»