Previous Article | Next Article ![]()
Journal of Virology, January 2006, p. 883-890, Vol. 80, No. 2
0022-538X/06/$08.00+0 doi:10.1128/JVI.80.2.883-890.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Division of Immunology, Aichi Cancer Center Research Institute, Nagoya, Japan,1 Department of Internal Medicine II, Okayama University Graduate School of Medicine and Dentistry, Okayama, Japan,2 Department of Cell Therapy, Aichi Cancer Center Hospital, Nagoya, Japan3
Received 17 June 2005/ Accepted 19 October 2005
|
|
|---|
subunit and is accelerated by ip-LMP2, as revealed by gene expression experiments using an LMP2A222-230-specific CTL clone as a responder in enzyme-linked immunospot assays. The unequivocal involvement of all three components was confirmed by RNA interference gene silencing. Interestingly, the LMP2A222-230 epitope could be efficiently generated from incomplete EBV-LMP2A fragments that were produced by puromycin treatment or gene-engineered shortened EBV-LMP2A lacking some of its hydrophobic domains. In addition, epitope generation was increased by a single amino acid substitution from leucine to alanine immediately flanking the C terminus, this being predicted by a web-accessible program to increase the cleavage strength. Taken together, the data indicate that the generation of LMP2A222-230 is influenced not only by extrinsic factors such as immunoproteasomes but also by intrinsic factors such as the length of the EBV-LMP2A protein and proteasomal cleavage strength at specific positions in the source antigen. |
|
|---|
subunits, and the inner rings consist of seven different ß-type subunits. Enzymatic activity is mediated by three of the ß subunits, designated ß1 (Y/
), ß2 (Z/MC14), and ß5 (X/MB1) (33). Exposure of cells to gamma interferon (IFN-
) during immune responses alters the proteasome activity qualitatively and quantitatively with the induction of three newly synthesized immunoproteasome ß subunits, low-molecular-weight protein 2 (ip-LMP2) or ß1i, multicatalytic endopeptidase complex-like 1 (MECL-1) or ß2i, and ip-LMP7 or ß5i. These become incorporated interdependently and replace the three constitutive ß subunits in newly assembled immunoproteasomes (14, 22, 24). The expression of ip-LMP7 and/or ip-LMP2 is known to alter the proteasomal cleavage specificity for virus- and tumor-associated antigens (15, 39). Furthermore, the incorporation of ip-LMP7 is sufficient to alter cleavage properties of proteasomes although the role of its catalytic site remains unclear (8, 36, 38, 40). The expression of ip-LMP2 alone or with ip-LMP7 is also reported to change cleavage specificity (1, 19, 23), and effects of the two subunits have been observed in each subunit's knockout mice (4, 7, 45).
Besides its effects on immunoproteasomes, IFN-
up-regulates expression of the proteasome activator 28 (PA28), which consists of two different subunits,
and ß, that form a heptameric ring that binds to proteasomes and is thought to increase their rate of cleavage (39). Regarding contributions to epitope liberation, effects of the
subunit have been observed (10, 41) but findings are limited regarding the ß subunit (41). Elucidating differential effects of the three immunoproteasome subunits and two PA28 subunits is clearly important for a better understanding of generation of CTL epitopes.
Recently, defective ribosomal products (DRiPs) from newly synthesized proteins, which are rapidly ubiquitylated and degraded by proteasomes, were shown to be the main sources of antigenic peptides (29, 35, 48, 49); this suggests that antigen structures are critical for efficient processing by proteasomes. While almost every amino acid residue can serve as a cleavage site, there are certain preferences (25, 27, 44). Because the C terminus of the CTL epitope is precisely determined by the proteasome, cleavage strength at specific positions, such as that immediately flanking the C terminus of the epitope, really affects epitope generation (14, 34). In fact, mutation in the flanking region of epitopes has been shown to impair the processing by proteasomes (2, 37). Thus, structural features play an important role in epitope liberation and could influence the working of the five immunoproteasome-associated subunits.
We have previously shown the generation of an HLA-A*2402-restriced CTL epitope in the Epstein-Barr virus (EBV) latent membrane protein 2A (EBV-LMP2A), amino acids 222 to 230 (referred to as LMP2A222-230), to be dependent on IFN-
exposure (18). Differential expression of ip-LMP2, MECL-1, ip-LMP7, PA28
, and PA28ß in various combinations has allowed us to selectively address the role of each subunit in the processing of the epitope independently of other IFN-
-inducible proteins, and we have established that the generation of LMP2A222-230 is cooperatively controlled by interplay among ip-LMP2, ip-LMP7, and PA28
. Moreover, these observations were supported by the results of RNA interference experiments. We have now extended our studies to demonstrate that LMP2A structural factors influence epitope liberation in various target cells.
|
|
|---|
Cell lines. T2-A24 cells were cultured in RPMI 1640 medium (Sigma, St. Louis, MO) supplemented with 10% fetal calf serum, 2 mM L-glutamine, 50 U/ml penicillin, 50 µg/ml streptomycin, and 800 µg/ml of G418 (Invitrogen Corp., Carlsbad, CA). HLA-A*2402-positive LCLs and PT67 cells (BD Bioscience Clontech, Palo Alto, CA), retroviral packaging cell lines, were cultured in RPMI 1640 medium (Sigma, St. Louis, MO) supplemented with 10% fetal calf serum, 2 mM L-glutamine, 50 U/ml penicillin, 50 µg/ml streptomycin, and 50 µg/ml of kanamycin (referred to as LCL medium). HLA-A*2402-positive LCLs expressing short hairpin RNA (shRNA) were maintained in LCL medium in the presence of 0.8 µg/ml of puromycin. HEK293 T cells (referred to as 293T; American Type Culture Collection, Manassas, VA) and HLA-A*2402-positive dermal fibroblast cell lines were cultured in Dulbecco's modified Eagle's medium (Sigma) supplemented with 10% fetal calf serum, 2 mM L-glutamine, 50 U/ml penicillin, and 50 µg/ml streptomycin.
Expression vectors.
Plasmids expressing various lengths of EBV-LMP2A and EBNA3A, from full-length proteins to minimal epitopes, were constructed as described previously (16, 18). Full-length HLA-A*2402, ip-LMP2, ip-LMP7, MECL-1, PA28
, and PA28ß were amplified by reverse transcriptase (RT)-PCR from HLA-A*2402-positive LCLs, cloned into the pcDNA3.1(+) vector (Invitrogen Corp.), and sequenced. A plasmid containing a mutant EBV-LMP2A gene with alanine substituted for leucine at position 231 was constructed by PCR-based mutagenesis as described previously (16). This single amino acid substitution was intended to increase the proteasome cleavage strength, as predicted with the Prediction Algorithm for Proteasomal Cleavages I program (PAProC version 1.0; http://www.paproc.de/) (17, 26).
Transduction of 293T cells.
The plasmids encoding HLA-A*2402 and EBV-LMP2A and at least one of those expressing ip-LMP2, ip-LMP7, MECL-1, PA28
, or PA28ß were transfected into 293T cells using TransIT-293 transfection reagents (Mirus, Madison, WI). Briefly, 3 x 104 cells were transfected with 100 ng of each plasmid and 0.2 µl TransIT reagent per 100 ng DNA in various combinations in 96-well plates. After 24 h, these cells were used as stimulators in the enzyme-linked immunospot (ELISPOT) assay.
shRNA interference retrovirus vectors.
The following small interfering RNA targets were selected in this study: ip-LMP2, AAGUGAAGGAGGUCAGGUAUA; ip-LMP7, AGAUUAACCCUUACCUGCUTT; and PA28
, AAGCCAACUUGAGCAAUCUGA. shRNA constructs included a TTCAAGAGA-loop separating the sense and antisense sequences followed by a 5T termination signal. These constructs were synthesized as two cDNA oligonucleotides, annealed, and ligated between the BamHI and EcoRI sites of the RNAi-Ready pSIREN-RetroQ vector (BD Biosciences Clontech). In addition, oligonucleotides with sequences selected by the company (BD Biosciences Clontech) as a negative control for gene silencing were annealed and inserted into the same vector.
Retrovirus production and infection.
PT67 cells were plated on six-well culture plates, and a 4-µg aliquot of each retrovirus vector plasmid was transfected with Lipofectamine 2000 (Invitrogen Corp), according to the manufacturer's instructions. After culture in the presence of 2.5 µg/ml of puromycin for 14 days, the cells were incubated in medium without puromycin for another 48 h. The culture supernatant was collected, and debris was removed by centrifugation at 1,000 x g for 10 min. A total of 1 x 106 LCLs were suspended in 1 ml of the virus-containing culture supernatant in each well of a 12-well plate, and polybrene was added to a final concentration of 10 µg/ml. Plates were centrifuged at 1,000 x g at 32°C for 1 h and incubated at 37°C in a humidified incubator. The LCLs were then cultured in medium containing puromycin for 14 days. Expression of ip-LMP2, ip-LMP7, or PA28
in these LCLs was analyzed by Western blotting and RT-PCR for gene silencing.
Western blotting.
Western blotting was performed as described previously with slight modifications (42). Briefly, aliquots of 130 µg protein were applied to sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis, blotted onto Immobilon-P membranes (Millipore Corporation, Bedford, MA), blocked with phosphate-buffered saline containing 10% low-fat dry milk and 0.1% Tween 20 overnight at 4°C, and probed with rabbit polyclonal antibodies specific to ip-LMP2, ip-LMP7, and PA28
(Affinity, Mamhead, United Kingdom), followed by peroxidase-conjugated goat anti-rabbit immunoglobulin G (Zymed, San Francisco, CA). Proteins were visualized using an ECL Western blot detection system (Amersham Biosciences, Buckinghamshire, United Kingdom).
RT-PCR.
Total RNA was extracted from LCLs and reverse transcription was performed in 20-µl reactions containing random hexamers and 1-µg aliquots. The specific primer sets used to detect ip-LMP2, ip-LMP7, and PA28
were as follows: ip-LMP2 forward, 5'-GGTGGTGAACCGAGTGTTTGA-3'; ip-LMP2 reverse, 5'-GCCAAAACAAGTGGAGGTTCC-3'; ip-LMP7 forward, 5'-GATTGCAGCAGTGGATTCTCG-3'; ip-LMP7 reverse, 5'-GACATGGTGCCAAGCAGGTAA-3'; PA28
forward, 5'-ACCAAGACAGAGAACCTGCTCG-3'; and PA28
reverse, 5'-GGCCTTCAGATTGCTCAAGTTG-3'.
ELISPOT assays.
ELISPOT assays were performed as previously described (18). In brief, a MultiScreen-HA plate (Millipore) was coated with anti-human IFN-
monoclonal antibody (Endogen, Rockford, IL) and used as the assay plate. The following stimulator cells in 100 µl of LCL medium were seeded into the wells: (i) 293T cells cotransfected with plasmids expressing HLA-A*2402 and those expressing various lengths of EBV-LMP2A (in some experiments, cells were treated with puromycin at 1 µg/ml for 30 min); (ii) 293T cells cotransfected with plasmids encoding HLA-A*2402 and EBV-LMP2A and at least one of those two expressing ip-LMP2, ip-LMP7, MECL-1, PA28
, or PA28b; and (iii) LCLs transduced by retrovirus vectors expressing shRNA for either ip-LMP2, ip-LMP7, or PA28a.
LMP2A222-230-CTLs or LMP2A419-427-CTLs in 100 µl medium were introduced into each well and incubated for 20 h. To visualize spots, anti-human IFN-
polyclonal antibody (Endogen), horseradish peroxidase-conjugated goat anti-rabbit immunoglobulin G (Zymed) and substrate were used. All assays were performed in duplicate.
|
|
|---|
![]() View larger version (19K): [in a new window] |
FIG. 1. EBV-specific CTL recognition of target cells measured by the ELISPOT assay. The epitope LMP2A222-230 is not presented on 293T cells expressing full-length EBV-LMP2A while LMP2A419-427 is presented on these cells. LMP2A222-230-CTL is the clone specific for LMP2A222-230, and LMP2A419-427-CTL is a polyclonal CD8+ T-cell line specific to LMP2A419-427. 293T cells were cotransfected with plasmids expressing HLA-A*2402 and full-length EBV-LMP2A or pulsed with the epitope peptide. CD8+ T cells (200/well) were cultured with the indicated stimulators for 20 h. Data from one representative experiment out of three are shown. Each bar demonstrates the average number of spots in duplicate wells.
|
-treated fibroblasts transduced with full-length EBV-LMP2A were recognized by LMP2A222-230-CTL, showing LMP2A222-230 to be an IFN-
-dependent epitope. This suggested that IFN-
-induced immunoproteasome and PA28 subunits generate LMP2A222-230 in the target cells (18).
Generation of LMP2A222-230 requires the immunoproteasome subunit ip-LMP7 and PA28
and is enhanced by ip-LMP2.
To investigate whether immunoproteasome-associated molecules are involved in generating the LMP2A222-230 epitope, we examined the effect of each proteasome immunosubunit (ip-LMP2, ip-LMP7, and MECL-1) and PA28 subunit (PA28
and PA28ß) in 293T cells that dominantly have a standard proteasome. First, 293T cells were cotransfected with plasmids encoding HLA-A*2402, the full-length EBV-LMP2A, and immunoproteasome-associated molecules in various combinations, as shown in Fig. 2A. We then evaluated epitope liberation using the ELISPOT assay. Surprisingly, three molecules were found to be involved in the generation of LMP2A222-230: ip-LMP7 and PA28
subunits were required, and the ip-LMP2 subunit enhanced its recognition (Fig. 2A). We confirmed the expression of ip-LMP2, ip-LMP7, and PA28
by Western blotting (Fig. 2B).
![]() View larger version (27K): [in a new window] |
FIG. 2. Involvement of immunoproteasome and PA28 subunits in the generation of LMP2A222-230 as analyzed by the ELISPOT assay. (A) Generation of LMP2A222-230 requires three immunoproteasome-associated molecules. 293T cells were cotransfected with plasmids encoding HLA-A*2402, full-length EBV-LMP2A, and at least one immunoproteasome-associated molecule (ip-LMP2, ip-LMP7, MECL-1, PA28 , and PA28ß). LMP2A222-230-CTLs were cultured with stimulators for 20 h as described in Materials and Methods. Data from one representative experiment out of three are shown. Data are means plus or minus standard deviation (SD) of spots in duplicate wells. The arrows indicate noteworthy results. +, presence of immunoproteasome or subunit. (B) Expression of ip-LMP2, ip-LMP7, and PA28 in 293T cells transfected with corrresponding expression vectors. 293T cells were transfected with each of three plasmids or with all these vectors. Expression of each subunit was analyzed by Western blotting. "Single vector-transfected" represents the 293T cells transfected with each plasmid encoding ip-LMP2, ip-LMP7, or PA28 and "three vectors cotransfected" represents the 293T cells cotransfected with the three plasmids. Results of one representative experiment out of two are shown.
|
expression in LCLs by RNA interference decreases the generation of LMP2A222-230 in target cells.
LCLs predominantly have immunoproteasomes (24), and the LMP2A222-230-CTL have recognized HLA-A*2402-positive LCLs, as we reported previously (18). To examine whether ip-LMP2, ip-LMP7, or PA28
is most directly involved in the generation of LMP2A222-230, we evaluated the epitope liberation in LCLs in which the expression of each subunit was separately inhibited using a gene-silencing technique. HLA-A*2402-positive LCLs were infected with retrovirus vectors expressing shRNAs for ip-LMP2, ip-LMP7, or PA28
and assessed for the expression of each subunit by Western blotting (Fig. 3A, B, and C) and RT-PCR (data not shown). Then, generation of the LMP2A222-230 epitope was probed with epitope-specific CTL using the ELISPOT assay. As expected, epitope liberation was clearly decreased with the inhibition of ip-LMP2, ip-LMP7, or PA28
expression (Fig. 3A, B, and C), demonstrating definitive involvement of all three molecules in the generation of LMP2A222-230. To test whether the generation of IFN-
-independent EBV-LMP2 epitope was influenced in these LCLs transfected with shRNA expression vectors for ip-LMP2, ip-LMP7, or PA28
, we investigated the generation of LMP2A419-427 using the ELISPOT assay. We found that there were no significant differences in the processing of this epitope. (data not shown).
![]() View larger version (29K): [in a new window] |
FIG. 3. Generation of LMP2A222-230 is inhibited by RNA interference (RNAi) products targeting ip-LMP2 (A), ip-LMP7 (B), or PA28 (C) expression. Immunoproteasome-expressing HLA-A*2402-positive LCLs were infected with retrovirus vectors expressing shRNA for ip-LMP2, ip-LMP7, or PA28 . As a control stimulator, an LCL infected with a retrovirus vector expressing a nonsilencing shRNA was used. Inhibition of each subunit expression in shRNA-expressing LCLs was analyzed by Western blotting. LMP2A222-230-CTL (5 x 103 cells/well) was cultured with each shRNA-transduced LCL for 20 h. Results of one representative experiment out of two are shown. Data are means plus or minus SD of spots in duplicate wells. , absence of immunoproteasome or subunit; +, presence of immunoproteasome or subunit.
|
were treated with puromycin for 30 min to generate short-lived premature proteins (6, 13, 47). We then analyzed the generation of LMP2A222-230 by ELISPOT assay. As shown in Fig. 4A, puromycin treatment remarkably augmented LMP2A222-230-CTL recognition on the cells expressing ip-LMP7 and PA28
. Interestingly, puromycin was capable of substituting either effect of ip-LMP7 and PA28
.
![]() View larger version (16K): [in a new window] |
FIG. 4. Generation of LMP2A222-230 from incomplete and shortened EBV-LMP2A as analyzed by ELISPOT assay. (A) LMP2A222-230-CTL recognition of puromycin-treated (1 µg/ml for 30 min) or untreated target cells expressing EBV-LMP2A. 293T cells, cotransfected with plasmids encoding HLA-A*2402, full-length EBV-LMP2A, ip-LMP7, and/or PA28, were cultured with LMP2A222-230-CTL (1 x 104 cells/well) for 20 h. For Ip-LMP7 and PA28 lanes, "+" indicates the presence of the immunoproteasome or subunit. (B) The length and structure of the truncated EBV-LMP2A fragments. Numbers of transmembrane domains (TDs) following LMP2A222-230 in the fragments are shown; e.g., +3TD indicates fragment LMP2A222-230 plus three transmembrane domains. Each TD located from the C terminus of LMP2A222-230 is serially numbered. M, methionine. (C) LMP2A222-230-CTL recognition of target cells expressing truncated EBV-LMP2A fragments in the absence of immunoproteasomes. The 293T cells were cotransfected with expression vectors encoding HLA-A*2402 and one truncated EBV-LMP2A and cultured with LMP2A222-230-CTL (1 x 103 cells/well) for 20 h. Numbers of amino acids and transmembrane domains (TDs) following LMP2A222-230 in the fragments are shown; e.g., +5aa indicates fragment LMP2A222-230 plus five C- terminal amino acids. Results of one representative experiment out of two are shown. Each bar represents the average number of spots in duplicate.
|
Substitution of amino acid immediately flanking the C terminus of LMP2A222-230, increasing the proteasome cleavage strength, results in efficient generation of LMP2A222-230 in target cells.
Finally, we investigated whether the amino acid cleavage strength at a specific position affects the processing of the LMP2A222-230 epitope. To determine the cleavage strength of each amino acid in EBV-LMP2A, the program PAProC was used (http://www.paproc.de/). We focused on the cleavage strength, which is critical for epitope generation, of amino acids in the position immediately flanking the C termini of CTL epitopes (14, 34). First, we constructed a plasmid containing a mutant full-length LMP2A gene in which alanine replaced leucine at position 231; this was predicted to increase the cleavage strength after leucine at position 230, i.e., the C terminus of LMP2A222-230 (Fig. 5A). It was thought that this change would facilitate LMP2A222-230 generation by proteasomes. Target 293T cells were cotransfected with vectors encoding HLA-A*2402, ip-LMP7, PA28
, and the mutant EBV-LMP2A, and LMP2A222-230-CTL recognition was evaluated using the ELISPOT assay. A remarkable increase was evident for cells expressing ip-LMP7 and PA28
(Fig. 5B), suggesting the processing of LMP2A222-230 to be accelerated by the amino acid substitution at the specific position in the EBV-LMP2A antigen.
![]() View larger version (19K): [in a new window] |
FIG. 5. Comparison of generation of LMP2A222-230 from native and mutant EBV-LMP2A with alanine substituted for leucine at position 231 (referred as to L231A-EBV-LMP2A). (A) Partial amino acid sequences of EBV-LMP2A and L231A-EBV-LMP2A. The position numbers, single code letters for amino acids and predicted cleavage strengths are shown. Predictions by the program PAProC are scored as follows: , no cleavage behind this position; +, ++, +++, cleavage behind this position, with a hint of the strength indicated by the number of +'s. (B) Generation of LMP2A222-230 from EBV-LMP2A and L231A-EBV-LMP2A, analyzed by ELISPOT assay. 293T cells were cotransfected with plasmids encoding HLA A*2402, ip-LMP7, PA28 , and full-length EBV-LMP2A or L231A-EBV-LMP2A and cultured with LMP2A222-230-CTL for 20 h. Results of one representative experiment out of two are shown. Each bar represents the average number of spots in duplicate. For Ip-LMP7 and PA28 lanes, "+" indicates the presence of the immunoproteasome or subunit.
|
|
|
|---|
induces cells to express the proteasome subunits ip-LMP2, MECL-1, and ip-LMP7, leading to the formation of immunoproteasomes and the proteasome activator subunits PA28
and PA28ß, comprising the activator complex. Early experiments with IFN-
-treated cells demonstrated the generation of a number of epitopes to be affected by immunoproteasomes and PA28 (15, 32, 44). Immunoproteasomes have various cleavage site preferences as well as cleavage rates for the generation of some epitopes, while PA28 up-regulates epitope liberation via conformational changes within the proteasome 20S complex. Following the discovery that the influenza virus matrix-derived epitope required ip-LMP7 expression for its generation (3), the involvement of immunoproteasomes and PA28 subunits with different CTL epitopes received much attention. The results of the studies that investigated the effect of at least two immunoproteasome-associated molecules in the generation of CTL epitopes are summarized in Table 1 (1, 8, 10, 19, 23, 36, 38, 40, 41). The combination patterns of the five immunoproteasome-associated subunits fall into three categories. (i) PA28 alone, (ii) ip-LMP7 alone, and (iii) both ip-LMP2 and ip-LMP7 exerted the epitope generation. It has been hypothesized that immunoproteasomes and PA28 cooperate in antigen processing, but direct experimental evidence has hitherto been lacking. In this study, we found that the LMP2A222-230 epitope has two unique features. First, coexpression of ip-LMP7 and one PA28 subunit is necessary for its generation. Second, ip-LMP2 has additional effects on epitope liberation. These data suggest that the processing of an IFN-
-inducible epitope is controlled differentially by multiple immunoproteasome-associated subunits. To our best knowledge, this is the first documentation of molecular evidence of such cooperation. |
View this table: [in a new window] |
TABLE 1. Effects of immunoproteasomes and PA28 subunits by species on epitope generationa
|
, which induce the cleavages properties on the epitope generation.
In this study, we developed a retrovirus vector producing shRNA to confirm the effects of ip-LMP2, ip-LMP7, and PA28
in the generation of LMP2A222-230. Generally, the use of chemically synthesized small interfering RNA or expression plasmids for shRNA is a more feasible way to test the involvement of target molecules but we believe that the retrovirus system has advantages in our case, because the effects of RNA interference in the target cells proved stable. After an epitope binds to MHC molecules and is presented on the cell surface, the complex exists for some time. Since there is a wide range in the life spans of the MHC-epitope complex, it is difficult to infer the sufficient duration to maintain inhibition of immunoproteasome-associated subunits to examine their effects in peptide liberation. In our retrovirus system, LCLs were cultured in medium containing puromycin for 14 days after retrovirus vector infection, and we assessed LMP2A222-230 presentation on the surface. This procedure should exclude false-positive results that are observed with the ELISPOT assay.
DRiPs are thought to be important sources of CTL epitopes (29, 35, 49), as in the case of EBNA1, for example, for which epitopes are not readily generated from stable mature EBNA1 because of the glycine-alanine repeat domain within the protein (43, 46). EBV-LMP2A has 12 hydrophobic integral membrane sequences, and this hydrophobic-rich structure may inhibit epitope liberation (20). To address the question of whether the incomplete EBV-LMP2A might be superior to the mature complete EBV-LMP2A for epitope generation, we treated target cells with puromycin, which generates short-lived premature termination products from newly synthesized proteins (6, 13, 47). Interestingly, LMP2A222-230 production was accelerated in puromycin-treated 293T cells expressing ip-LMP7 or PA28
, in contrast to the limited yield without puromycin treatment, even when the subunits were coexpressed. The data suggest that puromycin treatment is not sufficient to generate LMP2A222-230 epitopes via constitutive proteasomes, but rather affects epitope generation by enhancing the effect of ip-LMP7 and PA28
. Next, we expressed a panel of shorter EBV-LMP2A fragments encompassing LMP2A222-230 in target cells and compared their recognition to that of LMP2A222-230-CTL. Each fragment started from the N terminus of LMP2A222-230, as shown in Fig. 4B. This strategy should focus on the cleavage efficiency of the C- terminal side, which is performed exclusively by proteasomes (14, 34). We found that shorter EBV-LMP2A fragments were processed more efficiently. Therefore, the length of the source antigen may be a critical factor. Addition of two consecutive hydrophobic transmembrane domains substantially abrogated the epitope presentation. The obstacles presented by the intrinsic structure of EBV-LMP2A may be overcome by the effects of ip-LMP7 and PA28
in the generation of the LMP2A222-230 epitope.
The cleavage efficiency at each amino acid varies widely in antigen proteins (25, 27, 44), and this may explain why one epitope is generated efficiently by proteasomes while another is not, even when processed from the same protein. Previous work showed that even a single amino acid substitution of asparagine for the aspartic acid immediately flanking the C terminus of the Moloney murine leukemia virus epitope SSWDFITV resulted in its abrogation (2). The program PAProC predicts that the cleavage strength of the C- terminal leucine in EBV-LMP2A is weak (17, 26), and substitution of an amino acid to increase the cleavage strength (from "+" to "++", as shown in Fig. 5A) resulted in remarkable up-regulation of LMP2A222-230 liberation in cells expressing ip-LMP7 and PA28
.
EBV-LMP2A is thought to be an important antigen in EBV-related malignancies and is targeted by CTLs that recognize multiple epitopes located throughout the membrane-spanning molecules (20, 30, 31). Interestingly, EBV-LMP2A epitopes can be divided into two groups: (i) hydrophobic examples located in the transmembrane domain and processed in a TAP-independent manner and (ii) intertransmembrane hydrophilic epitopes, which are TAP-dependent (20). In addition, the generation of one hydrophobic epitope, LMP2A356-364, requires ip-LMP7 and ip-LMP2 (19). Moreover, we here demonstrated that the processing of LMP2A222-230 requires immunoproteasome subunits ip-LMP7 and PA28
and is enhanced by immunoproteasome subunit ip-LMP2. These two epitopes belong to the former group, although the effects of immunoproteasome and PA28 subunits on other epitopes remain to be investigated. Potentially, EBV-LMP2A is a good model for determining the mechanisms by which immunoproteasomes and PA28 affect CTL epitope generation.
In conclusion, the present investigation provided evidence for differential roles of ip-LMP2, ip-LMP7, and PA28
in the generation of the LMP2A222-230 epitope, which was most efficiently generated from incomplete EBV-LMP2A fragments and a mutated LMP2A gene with improved cleavage characteristics in cells expressing ip-LMP7 and PA28
. Although the precise function of each of the three subunits could not be clarified, we showed the generation of LMP2A222-230 to be controlled by multiple factors. Further investigations on the differential effects of immunoproteasome-associated subunits could provide important information for understanding the presentation of viral and tumor antigens for CTL recognition.
This work was supported in part by Grants-in-Aid for Scientific Research (C) (no. 17590428) and the Encouragement of Young Scientists (B) (no. 16790281) from the Japan Society for the Promotion of Science, Scientific Research on Priority Areas (no. 17016090) from the Ministry of Education, Culture, Science, Sports, and Technology of Japan and the Third Team Comprehensive Control Research for Cancer (no. 30) from the Ministry of Health, Labor, and Welfare of Japan.
|
|
|---|
(IFN-
)-inducible subunits. J. Exp. Med. 187:97-104.
in antigen presentation. Nature 381:166-168.
exposes a cryptic cytotoxic T lymphocyte epitope in HIV-1 reverse transcriptase. J. Immunol. 162:7075-7079.
differentially regulates susceptibility of lung cancer cells to telomerase-specific cytotoxic T lymphocytes. Int. J. Cancer. 110:403-412.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»