Previous Article | Next Article 
Journal of Virology, January 2006, p. 571-577, Vol. 80, No. 2
0022-538X/06/$08.00+0 doi:10.1128/JVI.80.2.571-577.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Sequence Homology Required by Human Immunodeficiency Virus Type 1 To Escape from Short Interfering RNAs
Rosario Sabariegos,
Mireia Giménez-Barcons,
Natalia Tàpia,
Bonaventura Clotet, and
Miguel Angel Martínez*
Fundació irsiCaixa, Laboratori de Retrovirologia, Hospital Universitari Germans Trias i Pujol, Ctra del Canyet s/n, 08916 Badalona, Spain
Received 22 July 2005/
Accepted 11 October 2005
 |
ABSTRACT
|
|---|
Short interfering RNAs (siRNAs) targeting viral or cellular genes can efficiently inhibit human immunodeficiency virus type 1 (HIV-1) replication. Nevertheless, the emergence of mutations in the gene being targeted could lead to the rapid escape from the siRNA. Here, we simulate viral escape by systematically introducing single-nucleotide substitutions in all 19 HIV-1 residues targeted by an effective siRNA. We found that all mutant viruses that were tested replicated better in the presence of the siRNA than in the presence of the wild-type virus. The antiviral activity of the siRNA was completely abolished by single substitutions in 10 (positions 4 to 11, 14, and 15) out of 16 positions tested (substitution at 3 of the 19 positions explored rendered nonviable viruses). With the exception of the substitution observed at position 12, substitutions at either the 5' end or the 3' end (positions 1 to 3, 16, and 18) were better tolerated by the RNA interference machinery and only in part affected siRNA inhibition. Our results show that optimal HIV-1 gene silencing by siRNA requires a complete homology within most of the target sequence and that substitutions at only a few positions at the 5' and 3' ends are partially tolerated.
 |
INTRODUCTION
|
|---|
The introduction of long double-stranded RNAs (dsRNAs), either artificially or by RNA virus infection, can induce the specific degradation of homologous mRNA species, a process termed RNA interference (RNAi) (16). Although this process was first discovered in invertebrates (Caenorhabditis elegans), RNAi is highly conserved among higher eukaryotes. During RNAi, longer dsRNAs are cleaved by the enzyme Dicer to yield
22-nucleotide dsRNAs bearing 2-nucleotide 3' overhangs termed short interfering RNAs (siRNAs) (3, 21, 47). siRNAs are then incorporated into the
500-kDa RNA-induced silencing complex (RISC) (21, 22, 47). One strand of the siRNA is used as a primer to target the RISC to homologous mRNAs, which are cleaved and degraded. The relevance of RNAi as a cellular defense mechanism against intruders was demonstrated by the discovery of plant and insect viruses that encode proteins which disable RNAi function (26, 30). Although the role of RNAi in the protection against vertebrate viruses is controversial, recent work has shown evidence that human immunodeficiency virus type 1 (HIV-1) has evolved in its Tat protein a suppressor of RNAi (2).
In mammalian cells, the introduction of siRNAs 21 nucleotides in length can be used to inhibit the expression of a target gene in a sequence-specific manner (14). siRNAs have become the method of choice for mammalian cell genetics as well as for potential sequence-specific therapeutic approaches (11, 13, 43). We and others have reported the general use of siRNAs to specifically inhibit HIV-1 replication by targeting viral or cellular genes (4, 7, 9, 24, 28, 29, 33, 34, 36). These studies have shown that RNAi may provide an important new therapeutic approach for treating HIV-1 infection. However, a major problem of all antiretroviral therapies is the emergence of resistant variants (25, 44). Indeed, it has recently been shown that HIV-1 promptly escapes effective siRNAs (4, 9, 45). However, the rules governing target recognition are still controversial and poorly defined. Although a critical feature of RNAi is sequence specificity, the degree of homology between the siRNA and the target sequence is unclear. Work with poliovirus and HIV-1 has found that virus variants resistant to siRNAs can be selected carrying single point mutations in the center of the target sequence (4, 17, 18, 29). Similarly, in Drosophila melanogaster, mismatches in the center of the siRNA duplex prevented target RNA cleavage (15). In contrast, work with hepatitis C virus replicons suggested that a single point mutation was not sufficient to confer resistance to siRNA (46), even when the mismatch was found at central positions. Similarly, it has also been reported that siRNAs generally tolerated mutations in the 5' end and in the central region and that the 3' end exhibited low tolerance (1, 6). While the majority of these studies have employed mutated siRNAs, little is known about the effects of mismatches in the target sequence. There is accumulating evidence that mismatches introduced in the siRNA molecule have measurable effects on RNAi activity and may determine the efficacy of siRNAs (12, 18, 41). Importantly, work with HIV-1 has also shown that tolerance to target sequence mismatches may depend on the sequence of the siRNA tested (29).
Since the specificity of siRNAs is a critical consideration for the application of RNAi as a valid alternative for HIV-1 intervention, we decided to simulate viral escape by systematically introducing single-nucleotide substitutions in all 19 residues of the HIV-1 reverse transcriptase (RT) sequence targeted by an effective siRNA. Our study provides evidence that optimal HIV-1 gene silencing by siRNA requires a complete homology within the central region of the target sequence and that substitutions at only a few positions at the 5' and 3' ends are partially tolerated. These findings emphasize the limitation of targeting single sequences in the viral genome as a therapeutic approach for RNA viruses.
 |
MATERIALS AND METHODS
|
|---|
Mutagenesis and recombinant mutated viruses.
Single HIV-1 mutants were constructed by site-directed mutagenesis using the overlap extension protocol (40) as previously described (32, 37). In separate amplifications, two fragments of the HXB2 RT coding region were amplified. For the amplification of the 5' fragment, the RT19 oligonucleotide (sense) (5'-GGACATAAAGCTATAGGTACAG-3'; HXB2 positions 2454 to 2475) was used together with an antisense oligonucleotide containing the desired mutation (5'-TTCTCCATTTAGTACTGT-3'; HXB2 positions 2748 to 2766). For the amplification of the 3' fragment, the RT20 oligonucleotide (antisense) (5'-CTGCCAGTTCTAGCTCTGCTTC-3'; HXB2 positions 3462 to 3441) was employed together with a sense oligonucleotide containing the desired mutation (5'-GACAGTACTAAATGGAGAA-3'; HXB2 positions 2748 to 2766). The PCR mixture contained 20 pmol of each primer, 200 µM deoxynucleoside triphosphates, 2.5 mM MgCl2, PCR buffer (10 mM Tris-HCl [pH 8.3]), 50 mM KCl), and 0.5 U Taq polymerase (Promega) in a total reaction volume of 50 µl. Cycling parameters were 1 cycle of denaturation at 95°C for 2 min, followed by 35 cycles of 30 s at 95°C, 30 s at 55°C, and 45 s at 72°C, and a final extension step at 72°C for 7 min. The 5' and 3' PCR fragments were mixed with oligonucleotides RT19 (sense) and RT20 (antisense), and a second PCR was performed according to the above-described conditions.
Recombinant individual mutated viruses were prepared as previously described (35). Briefly, the reconstructed PCR containing the full-length HXB2 RT coding region was then cotransfected with an RT-deleted HXB2 clone (pHXB2D2-261RT) into MT4 cells (5). When the HIV-1 p24 antigen concentration in the cultures surpassed 500 ng/ml, the supernatants were harvested. Progeny virus was propagated and titrated in MT4 cells. The RT coding region of the progeny virus was determined by automatic DNA sequencing to assess the presence of the desired mutation.
Synthetic siRNA transfection and HIV-1 infections.
Human astroglioma U87-CD4 cells (1.5 x 105 cells) (10) (NIH AIDS Research and Reference Reagent Program) were transfected with 2 pmol (or the corresponding siRNA concentration) of the appropriate siRNA using 2 ml of Lipofectamine 2000 reagent (Invitrogen) as recommended by the manufacturer. siRNAs were chemically synthesized by QIAGEN and were treated as previously described (34). siRNAs targeting RT and Nef corresponded to coding regions 199 to 227 of HXB2 RT (GACAGTACTAAATGGAGAATT; siRT199; HXB2 positions 2748 to 2766) and regions 118 to 136 of HXB2 Nef (CAUGGAGCAAUCACAAGUATT; siNef118; HXB2 positions 8914 to 8932), respectively. Twenty-four hours after transfection, U87-CD4 cells were infected with 200 50% tissue culture infectious doses (TCID50) of wild-type HXB2 or the different recombinant, individual, mutated HXB2 viruses. Ninety-six hours after infection, p24 antigen in the culture supernatant was measured using a commercial p24-antigen enzyme-linked immunosorbent assay (Innogenetics). To calculate the inhibitory effect of siRNA, the level of p24 antigen of the control (mock-transfected) samples was normalized to 100%, and levels in test samples were calculated as percentages of the control level.
Quantification of HIV-1 proviral DNA.
HIV-1 proviral DNA quantification was performed by endpoint limiting dilution, as described previously (23). Briefly, triplicate fivefold serial dilutions of U87-CD4 cells that were the genomic DNA equivalents of 30,000, 6,000, 1,200, 240, and 48 cells were amplified by a nested PCR capable of amplifying a single proviral molecule. The HIV-1 DNA copy number was quantified with oligonucleotides NI-2 5' and NI-2 3' for the first PCR. The cycling profile was 55°C (30 s), 72°C (30 s), and 95°C (30 s) for 35 cycles, with a final extension step at 72°C for 7 min. The second PCR was carried out with oligonucleotides NI-3 5' and NI-3 3'; the cycle profile was as described above. Oligonucleotide sequences can be found in reference 23. The HIV-1 DNA copy number was estimated using a Poisson probability distribution implemented by the statistical computer program QUALITY (39).
 |
RESULTS
|
|---|
siRT199 showed a significantly impaired silencing ability on the majority of single-nucleotide-mismatched mutant viruses.
To study the effect of mismatches between siRNA and its target HIV-1 RNA on RNAi silencing activity, we used a functionally validated siRNA, termed siRT199, targeting the RT coding region (positions 199 to 227) of the HIV-1 HXB2 strain. The antiviral potency of siRT199 was assessed by transfection with different amounts of siRT199 in U87-CD4 cells and subsequent infection with the wild-type HIV-1 HXB2 strain. As shown in Fig. 1, 2 pmol of siRT199 suppressed viral replication at day 4 by more than 80% compared to that of the control. This result demonstrated that 2 pmol of siRT199 elicited an effective silencing activity. As a control for this study, we also assessed the antiviral activity of another effective siRNA directed against a different viral target sequence, Nef, termed siNef118, that targets nucleotides 118 to 136 of the Nef coding region of the HIV-1 HXB2 strain. Similarly, 2 pmol of siNef118 inhibited 70% of the HIV-1 replication at day 4 (Fig. 1). To examine whether siRT199 and siNef118 were able to direct the specific degradation of the genomic viral RNA of HIV-1, we quantified the level of HIV-1 proviral DNA production in cells transfected with siRT199 or siNef11s and infected with HIV-1. As expected, we were able to readily detect at day 4 after infection proviral DNA in cells mock transfected with siRNAs and infected with HIV-1 (3,360 ± 2,370 copies per 106 cells). In contrast, the level of proviral DNA production was markedly reduced in cells transfected with siRT199 (5 ± 4 copies per 106 cells) or siNef11s (98 ± 81 copies per 106 cells). These results indicate that these siRNAs are able to interrupt early events in the HIV-1 replication cycle by directing the specific degradation of genomic HIV-1 RNA.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 1. Inhibition of wild-type HIV-1 by siRNA siRT199 or siNef118. (A) U87-CD4 cells were mock transfected or transfected with different concentrations (pmol) of the appropriate siRNA, siRT199 or siNef118. After 24 h posttransfection, cells were infected with 200 TCID50 of wild-type HIV-1 HXB2. At 96 h postinfection, the supernatant of infected cells was assayed for p24 antigen using an enzyme-linked immunosorbent assay. (B) U87-CD4 cells were mock transfected or transfected with 2 pmol of siRT199 or siNef118. After 24 h posttransfection, cells were infected with 200 TCID50 of wild-type HIV-1 HXB2. At days 1, 2, 3, 4, 5, and 6 after infection, virus replication was monitored by determining the p24 antigen level in the culture supernatant. Values represent the means ± standard deviations (SDs) from at least three independent experiments.
|
|

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 2. Systematic analysis of how single-nucleotide mismatches between siRT199 and its target sequence affect HIV-1 replication silencing. U87-CD4 cells were mock transfected or transfected with siRT199. After 24 h posttransfection, cells were infected with 200 TCID50 of wild-type HXB2 or the different recombinant individual mutated viruses. At 96 h postinfection, the supernatant of infected cells was assayed for p24 antigen using an enzyme-linked immunosorbent assay. p24 levels (upper panel) and percentages of p24 antigen levels relative to that of the respective control (lower panel) are shown. To calculate the inhibitory effect of siRT199, p24 antigen of the control (mock-transfected) samples was normalized to 100%, and levels in test samples were calculated as percentages of the control level. Values represent the means ± SDs from at least three independent experiments. wt, wild type; mut, mutant.
|
|
To study the sequence homology required to escape siRT199 inhibition, we constructed 19 mutant viruses carrying single-nucleotide mutations at each position of its 19-nucleotide target sequence. The mutant viruses were named according to the position of their mutation, starting from the 5' end of the sense strand. In order to simplify the analysis, guanosines were mutated to adenosines, adenosines to guanosines, cytosines to uracils, and uracils to cytosines. All substitutions with the exception of those at positions 13, 16, 17, and 19 rendered viable viruses. All possible alternative substitutions were assayed at the four above-mentioned nonviable positions, but only the replacement of the adenosine at position 16 (mutant 16) by a cytosine rendered a viable virus. All mutant viruses that were tested replicated better in the presence of siRT199 than in the presence of the wild-type virus (Fig. 2), suggesting that any single mutation of the target sequence that forms a mismatch with its cognate siRNA can significantly reduce the silencing efficiency. In fact, only a minority of single-nucleotide mismatches between the target sequence and siRT199 could elicit an effective silencing activity, indicating that the viral inhibition observed is largely specific and not due to possible off-target effects. As shown in Fig. 2, the inhibition of mutant virus replication can vary dramatically according to the position of the mismatch along the target sequence. Substitutions at positions 4 to 11, 14, and 15 completely abolished siRT199 inhibition. Importantly, these viral mutants remained fully susceptible to siRNA inhibition by siNef118, which targeted the Nef HIV-1 coding region (Fig. 3). Consequently, these mutations were specific for escape from siRT199 and did not produce a general resistance to RNAi. Likewise, the similar p24 antigen titers obtained with some of these viral mutants (see mutant 9 in Fig. 4A) also suggested that the virus replication capacity was not responsible for their different susceptibilities to siRT199 inhibition. Mismatches in the 5' end or 3' end (mutants 1 to 3, 16, and 18) were better tolerated (53%, 65%, 54%, 60%, and 65% of viral replication inhibition, respectively), showing that these positions may not be critically involved in the interaction with the siRNA. Nevertheless, the inhibition observed with these four virus mutants never reached that obtained with the wild-type virus, suggesting that even substitutions in the 3' end or 5' end may help the virus escape the inhibition by siRT199. Intriguingly, substitution at position 12 (substitution at position 13 rendered nonviable viruses) seemed not to strongly affect (71% of viral replication inhibition) recognition by siRT199. Overall, with the exception of mutant 12, no differences were observed when substitutions in the 5' half of the target sequence were compared with those in the 3' half.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 3. Inhibition of the wild type, mutant 8, mutant 9, mutant 10, and mutant 12 by siNef118. U87-CD4 cells were mock transfected or transfected with siNef118. After 24 h posttransfection, cells were infected with 200 TCID50 of wild-type HXB2 or the different recombinant individual mutated viruses. At 96 h postinfection, the supernatant of infected cells was assayed for p24 antigen using an enzyme-linked immunosorbent assay. p24 antigen values (upper panel) and percentages of p24 antigen levels relative to that of the respective control (lower panel) are shown. Values represent the means ± SDs from at least three independent experiments. wt, wild type; m, mutant.
|
|

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 4. Inhibition of wild-type, mutant 9, and mutant 12 HIV-1 by the following siRNA: (A) siRT199, siRT199m9, or siRT199m12 or (B) siNef118, siNef118m9, or siNef118m12. U87-CD4 cells were mock transfected or transfected with the appropriate siRNA, siRT199 or siNef118. After 24 h posttransfection, cells were infected with 200 TCID50 of virus. At 96 h postinfection, the supernatant of infected cells was assayed for p24 antigen using an enzyme-linked immunosorbent assay. p24 antigen values and percentages of p24 antigen levels relative to that of the respective control are shown. Values represent the means ± SDs from at least three independent experiments. wt, wild type; m and mut, mutant.
|
|
Mutated siRT199 did not inhibit wild-type HIV-1.
To determine whether the observed effect of mismatches in the target sequence could be reproduced by introducing the mutations in siRT199, we tested two mutated siRT199s with substitutions at positions 9 and 12 (siRT199m9 and siRT199m12, respectively) (Fig. 4). siRT199m9 and siRT199m12 inhibited their cognate viral mutants, mutant 9 and mutant 12, respectively, to an extent similar to that observed with the wild-type virus and siRT199. This result indicated that the perfect homology between the siRNA and the cognate target sequence is required for effective silencing. As expected, siRT199m9 did not exert any inhibitory effect on wild-type HIV-1 (Fig. 4A). In contrast, siRT199m12 impaired wild-type HIV-1 replication by 20%, consistent with the tolerability shown by virus mutant 12 against the wild-type siRT199. Overall, these results parallel those obtained with the wild-type siRT199 and mutant viruses, although the inhibition achieved with the wild-type siRT199 and virus mutant 12 was higher than that observed with the mutant siRT199m12 and the wild-type virus, confirming that certain differences may exist depending on whether the mutation is present in the target sequence or in the siRNA.
Finally, we assayed in our control, siNef1118, the effect of substitutions at position 9 or 12. Two mutant siNef118s were generated, siNef118m9 and siNef118m12, and tested against the wild-type virus. Again, siNef118m9 did not exert any inhibitory effect on wild-type HIV-1, and siNef118m12, similarly to siRT199m12, slightly inhibited (29%) wild-type HIV-1 replication (Fig. 4B). Thus, no differences were observed when the siRT199 and siNef118 single mutants were compared, confirming the differences in tolerability of positions 9 and 12.
 |
DISCUSSION
|
|---|
The management of HIV-infected patients has become increasingly complex. The emergence of drug resistance and the growing recognition of the long-term toxicity of antiretroviral agents justify a continued effort to develop new antiviral strategies. Therapeutic options against HIV continue to expand with the development of new drugs and new strategies. RNAi provides a robust method for specifically inhibiting the expression of targeted cellular or viral genes, and it shows promise as a novel and broadly applicable approach to antiviral therapy. However, clinical application of RNAi faces several challenges, specifically the potential for viral escape (4, 8, 9, 17, 18). In this study, we investigated the silencing effects of an effective siRNA, siRT199, at all 19 single-nucleotide-mismatched HIV-1 RNA target sites. Several mutational analyses have been performed to explore the specificities of different siRNAs (1, 6, 15, 38); however, these studies employed diverse siRNAs with nucleotide substitutions rather than mutated target sequences. Since substitutions in the siRNA molecule can modify the ability to enter the RISC and/or the ability to recognize the target sequence, the mutational analyses could be compromised by the specificity of the siRNA-processing machinery (20, 31, 41). In fact, we have found that the degree of viral inhibition conferred by the mismatch at position 12 differed according to whether it was present in the target sequence of the RT coding sequence (71% of viral replication inhibition) (Fig. 2) or in the siRT199 molecule (20% of viral replication inhibition) (Fig. 4A). The fact that the silencing activity may vary depending on whether the mismatch is present in the target sequence or in the siRNA could account for the discrepancies observed in silencing efficiencies in different studies (1, 4, 6, 12, 14, 17, 18, 20, 31, 46).
In this study, we have found that any single-nucleotide mismatch between the siRNA and the target sequence is capable of reducing the silencing effect; in particular, the center or either side of the center of the target sequence, with the exception of position 12, was very effective in allowing the virus to escape siRNA inhibition. In addition, positions at the 3' end and 5' end of the target sequence did not seem to strongly affect recognition by siRNA. Consistent with our results, Du et al. (12) have also found that target sequences containing mismatches at position 12 were well tolerated by the silencing machinery. In contrast, a recent study has shown that HIV-1 silencing is affected by a mismatch at residue 12 in a gag siRNA target sequence (29). These discrepancies highlight the possible relevance of a specific target sequence in siRNA recognition and escape from RNAi. For instance, it is well known that not all siRNAs are equally efficacious and that it is sometimes extremely difficult to predict whether a particular siRNA is likely to work (19). Similarly, rules for escaping siRNA inhibition may vary with the target sequence. Indeed, depending on the targeted sequence, HIV-1 can escape siRNA inhibition by point mutations (4) or deletions (9) in the target region but also by evolving an alternative structure in its RNA genome (45). Furthermore, one or even two point mutations within the target sequence may not be sufficient to render a defined siRNA ineffective against hepatitis C virus replicons (46). Although our findings may need to be confirmed in a more physiologically relevant setting and the spectrum of HIV-1 mutants studied here is limited by the viability of the resulting viruses, as 3 out of 19 positions could not be investigated, our results provide insights into the rules governing siRNA target recognition by showing that there is a small region of high tolerability for mismatches at the 3' and 5' ends of the target sequence and a region of fairly low tolerability. Interestingly, position 12 (and maybe position 13) appeared to better tolerate mismatches than its neighboring positions, indicating that this position might be important for siRNA target recognition.
In agreement with previous studies performed with HIV-1 or other RNA viruses, we show here how easily HIV-1 can escape siRNA inhibition by a single substitution in the target sequence. To counteract this limitation, coexpression of multiple siRNAs that target conserved RNA sequences could reduce the emergence of single-siRNA-resistant viruses with an effect comparable to that achieved by three to four anti-HIV drug combinations commonly known as highly active antiretroviral treatment. Recently, siRNAs 25 to 30 nucleotides in length have been found to be 100-fold more potent than corresponding conventional 21-mer siRNAs (27, 42). The enhanced potency of the longer duplexes is attributed to the fact that they are substrates of the Dicer endonuclease, directly linking the production of siRNAs to incorporation in the RISC. It may be of interest to test whether a significant increase in the potency of siRNAs weakens the ability of HIV-1 to escape RNAi inhibition.
 |
ACKNOWLEDGMENTS
|
|---|
Rosario Sabariegos was supported by a fellowship from Fundación BCN-SIDA 2002. This work was supported by grant BCM2003-02148 (MEC) and grants from the Spanish Fondo de Investigación Sanitaria (Red Tematica Cooperativa de Investigacion en Sida [RIS]), from la marató de TV3, and from Fundación para la Investigación y la prevención del SIDA en España (FIPSE 36293/02).
 |
FOOTNOTES
|
|---|
* Corresponding author. Mailing address: Fundació irsiCaixa, Laboratori de Retrovirologia, Hospital Universitari Germans Trias i Pujol, Ctra del Canyet s/n, 08916 Badalona, Spain. Phone: 34-934656374. Fax: 34-934653968. E-mail: mmartinez{at}irsicaixa.es. 
 |
REFERENCES
|
|---|
- Amarzguioui, M., T. Holen, E. Babaie, and H. Prydz. 2003. Tolerance for mutations and chemical modifications in a siRNA. Nucleic Acids Res. 31:589-595.[Abstract/Free Full Text]
- Bennasser, Y., S. Y. Le, M. Benkirane, and K. T. Jeang. 2005. Evidence that HIV-1 encodes an siRNA and a suppressor of RNA silencing. Immunity 22:607-619.[CrossRef][Medline]
- Bernstein, E., A. A. Caudy, S. M. Hammond, and G. J. Hannon. 2001. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409:363-366.[CrossRef][Medline]
- Boden, D., O. Pusch, F. Lee, L. Tucker, and B. Ramratnam. 2003. Human immunodeficiency virus type 1 escape from RNA interference. J. Virol. 77:11531-11535.[Abstract/Free Full Text]
- Boucher, C. A. B., W. Keulen, T. van Bommel, M. Nijhuis, D. de Jong, M. D. de Jong, P. Schipper, and N. K. T. Back. 1996. Human immunodeficiency virus type 1 drug susceptibility determination by using recombinant viruses generated from patient sera tested in a cell-killing assay. Antimicrob. Agents Chemother. 40:2404-2409.[Abstract]
- Chiu, Y. L., and T. M. Rana. 2003. siRNA function in RNAi: a chemical modification analysis. RNA 9:1034-1048.[Abstract/Free Full Text]
- Coburn, G. A., and B. R. Cullen. 2002. Potent and specific inhibition of human immunodeficiency virus type 1 replication by RNA interference. J. Virol. 76:9225-9231.[Abstract/Free Full Text]
- Coffin, J. M. 1986. Genetic variation in AIDS viruses. Cell 46:1-4.[Medline]
- Das, A. T., T. R. Brummelkamp, E. M. Westerhout, M. Vink, M. Madiredjo, R. Bernards, and B. Berkhout. 2004. Human immunodeficiency virus type 1 escapes from RNA interference-mediated inhibition. J. Virol. 78:2601-2605.[Abstract/Free Full Text]
- Deng, H., R. Liu, W. Ellmeier, S. Choe, D. Unutmaz, M. Burkhart, P. Di Marzio, S. Marmon, R. E. Sutton, C. M. Hill, C. B. Davis, S. C. Peiper, T. J. Schall, D. R. Littman, and N. R. Landau. 1996. Identification of a major co-receptor for primary isolates of HIV-1. Nature 381:661-666.[CrossRef][Medline]
- Dorsett, Y., and T. Tuschl. 2004. siRNAs: applications in functional genomics and potential as therapeutics. Nat. Rev. Drug Discov. 3:318-329.[CrossRef][Medline]
- Du, Q., H. Thonberg, J. Wang, C. Wahlestedt, and Z. Liang. 2005. A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. Nucleic Acids Res. 33:1671-1677.[Abstract/Free Full Text]
- Dykxhoorn, D. M., and J. Lieberman. 2005. The silent revolution: RNA interference as basic biology, research tool, and therapeutic. Annu. Rev. Med. 56:401-423.[CrossRef][Medline]
- Elbashir, S. M., J. Harborth, W. Lendeckel, A. Yalcin, K. Weber, and T. Tuschl. 2001. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411:494-498.[CrossRef][Medline]
- Elbashir, S. M., J. Martinez, A. Patkaniowska, W. Lendeckel, and T. Tuschl. 2001. Functional anatomy of siRNAs for mediating efficient RNAi in Drosophila melanogaster embryo lysate. EMBO J. 20:6877-6888.[CrossRef][Medline]
- Fire, A., S. Xu, M. K. Montgomery, S. A. Kostas, S. E. Driver, and C. C. Mello. 1998. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391:806-811.[CrossRef][Medline]
- Gitlin, L., S. Karelsky, and R. Andino. 2002. Short interfering RNA confers intracellular antiviral immunity in human cells. Nature 418:430-434.[CrossRef][Medline]
- Gitlin, L., J. K. Stone, and R. Andino. 2005. Poliovirus escape from RNA interference: short interfering RNA-target recognition and implications for therapeutic approaches. J. Virol. 79:1027-1035.[Abstract/Free Full Text]
- Gong, D., and J. E. Ferrell, Jr. 2004. Picking a winner: new mechanistic insights into the design of effective siRNAs. Trends Biotechnol. 22:451-454.[CrossRef][Medline]
- Haley, B., and P. D. Zamore. 2004. Kinetic analysis of the RNAi enzyme complex. Nat. Struct. Mol. Biol. 11:599-606.[CrossRef][Medline]
- Hammond, S. M., E. Bernstein, D. Beach, and G. J. Hannon. 2000. An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature 404:293-296.[CrossRef][Medline]
- Hammond, S. M., S. Boettcher, A. A. Caudy, R. Kobayashi, and G. J. Hannon. 2001. Argonaute2, a link between genetic and biochemical analyses of RNAi. Science 293:1146-1150.[Abstract/Free Full Text]
- Ibanez, A., T. Puig, J. Elias, B. Clotet, L. Ruiz, and M. A. Martinez. 1999. Quantification of integrated and total HIV-1 DNA after long-term highly active antiretroviral therapy in HIV-1-infected patients. AIDS 13:1045-1049.[CrossRef][Medline]
- Jacque, J. M., K. Triques, and M. Stevenson. 2002. Modulation of HIV-1 replication by RNA interference. Nature 418:435-438.[CrossRef][Medline]
- Johnson, V. A., F. Brun-Vezinet, B. Clotet, B. Conway, R. T. D'Aquila, L. M. Demeter, D. R. Kuritzkes, D. Pillay, J. M. Schapiro, A. Telenti, and D. D. Richman. 2004. Update of the drug resistance mutations in HIV-1: 2004. Top. HIV Med. 12:119-124.[Medline]
- Kasschau, K. D., and J. C. Carrington. 1998. A counterdefensive strategy of plant viruses: suppression of posttranscriptional gene silencing. Cell 95:461-470.[CrossRef][Medline]
- Kim, D. H., M. A. Behlke, S. D. Rose, M. S. Chang, S. Choi, and J. J. Rossi. 2005. Synthetic dsRNA Dicer substrates enhance RNAi potency and efficacy. Nat. Biotechnol. 23:222-226.[CrossRef][Medline]
- Lee, N. S., T. Dohjima, G. Bauer, H. Li, M. J. Li, A. Ehsani, P. Salvaterra, and J. Rossi. 2002. Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells. Nat. Biotechnol. 20:500-505.[Medline]
- Lee, S. K., D. M. Dykxhoorn, P. Kumar, S. Ranjbar, E. Song, L. E. Maliszewski, V. Francois-Bongarcon, A. Goldfeld, M. N. Swamy, J. Lieberman, and P. Shankar. 2005. Lentiviral delivery of short hairpin RNAs protects CD4 T cells from multiple clades and primary isolates of HIV. Blood 106:818-826.[Abstract/Free Full Text]
- Li, H., W. X. Li, and S. W. Ding. 2002. Induction and suppression of RNA silencing by an animal virus. Science 296:1319-1321.[Abstract/Free Full Text]
- Martinez, J., and T. Tuschl. 2004. RISC is a 5' phosphomonoester-producing RNA endonuclease. Genes Dev. 18:975-980.[Abstract/Free Full Text]
- Martinez, M. A., and B. Clotet. 2003. Genetic screen for monitoring hepatitis C virus NS3 serine protease activity. Antimicrob. Agents Chemother. 47:1760-1765.[Abstract/Free Full Text]
- Martinez, M. A., B. Clotet, and J. A. Este. 2002. RNA interference of HIV replication. Trends Immunol. 23:559-561.[CrossRef][Medline]
- Martinez, M. A., A. Gutierrez, M. Armand-Ugon, J. Blanco, M. Parera, J. Gomez, B. Clotet, and J. A. Este. 2002. Suppression of chemokine receptor expression by RNA interference allows for inhibition of HIV-1 replication. AIDS 16:2385-2390.[CrossRef][Medline]
- Mas, A., M. Parera, C. Briones, V. Soriano, M. A. Martinez, E. Domingo, and L. Menendez-Arias. 2000. Role of a dipeptide insertion between codons 69 and 70 of HIV-1 reverse transcriptase in the mechanism of AZT resistance. EMBO J. 19:5752-5761.[CrossRef][Medline]
- Novina, C. D., M. F. Murray, D. M. Dykxhoorn, P. J. Beresford, J. Riess, S. K. Lee, R. G. Collman, J. Lieberman, P. Shankar, and P. A. Sharp. 2002. siRNA-directed inhibition of HIV-1 infection. Nat. Med. 8:681-686.[CrossRef][Medline]
- Parera, M., B. Clotet, and M. A. Martinez. 2004. Genetic screen for monitoring severe acute respiratory syndrome coronavirus 3C-like protease. J. Virol. 78:14057-14061.[Abstract/Free Full Text]
- Pusch, O., D. Boden, R. Silbermann, F. Lee, L. Tucker, and B. Ramratnam. 2003. Nucleotide sequence homology requirements of HIV-1-specific short hairpin RNA. Nucleic Acids Res. 31:6444-6449.[Abstract/Free Full Text]
- Rodrigo, A. G., P. C. Goracke, K. Rowhanian, and J. I. Mullins. 1997. Quantitation of target molecules from polymerase chain reaction-based limiting dilution assays. AIDS Res. Hum. Retrovir. 13:737-742.[Medline]
- Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, New York, N.Y.
- Schwarz, D. S., G. Hutvagner, T. Du, Z. Xu, N. Aronin, and P. D. Zamore. 2003. Asymmetry in the assembly of the RNAi enzyme complex. Cell 115:199-208.[CrossRef][Medline]
- Siolas, D., C. Lerner, J. Burchard, W. Ge, P. S. Linsley, P. J. Paddison, G. J. Hannon, and M. A. Cleary. 2005. Synthetic shRNAs as potent RNAi triggers. Nat. Biotechnol. 23:227-231.[CrossRef][Medline]
- Stevenson, M. 2004. Therapeutic potential of RNA interference. N. Engl. J. Med. 351:1772-1777.[Free Full Text]
- Vandamme, A. M., A. Sonnerborg, M. Ait-Khaled, J. Albert, B. Asjo, L. Bacheler, D. Banhegyi, C. Boucher, F. Brun-Vezinet, R. Camacho, P. Clevenbergh, N. Clumeck, N. Dedes, A. De Luca, H. W. Doerr, J. L. Faudon, G. Gatti, J. Gerstoft, W. W. Hall, A. Hatzakis, N. Hellmann, A. Horban, J. D. Lundgren, D. Kempf, M. Miller, V. Miller, T. W. Myers, C. Nielsen, M. Opravil, L. Palmisano, C. F. Perno, A. Phillips, D. Pillay, T. Pumarola, L. Ruiz, M. Salminen, J. Schapiro, B. Schmidt, J. C. Schmit, R. Schuurman, E. Shulse, V. Soriano, S. Staszewski, S. Vella, M. Youle, R. Ziermann, and L. Perrin. 2004. Updated European recommendations for the clinical use of HIV drug resistance testing. Antivir. Ther. 9:829-848.[Medline]
- Westerhout, E. M., M. Ooms, M. Vink, A. T. Das, and B. Berkhout. 2005. HIV-1 can escape from RNA interference by evolving an alternative structure in its RNA genome. Nucleic Acids Res. 33:796-804.[Abstract/Free Full Text]
- Wilson, J. A., and C. D. Richardson. 2005. Hepatitis C virus replicons escape RNA interference induced by a short interfering RNA directed against the NS5b coding region. J. Virol. 79:7050-7058.[Abstract/Free Full Text]
- Zamore, P. D., T. Tuschl, P. A. Sharp, and D. P. Bartel. 2000. RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 101:25-33.[CrossRef][Medline]
Journal of Virology, January 2006, p. 571-577, Vol. 80, No. 2
0022-538X/06/$08.00+0 doi:10.1128/JVI.80.2.571-577.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
von Eije, K. J., Brake, O. t., Berkhout, B.
(2008). Human Immunodeficiency Virus Type 1 Escape Is Restricted When Conserved Genome Sequences Are Targeted by RNA Interference. J. Virol.
82: 2895-2903
[Abstract]
[Full Text]
-
Gimenez-Barcons, M., Clotet, B., Martinez, M. A.
(2007). Endoribonuclease-Prepared Short Interfering RNAs Induce Effective and Specific Inhibition of Human Immunodeficiency Virus Type 1 Replication. J. Virol.
81: 10680-10686
[Abstract]
[Full Text]
-
Kanda, T., Steele, R., Ray, R., Ray, R. B.
(2007). Small Interfering RNA Targeted to Hepatitis C Virus 5' Nontranslated Region Exerts Potent Antiviral Effect. J. Virol.
81: 669-676
[Abstract]
[Full Text]