This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Samuilova, O.
Right arrow Articles by Hyypiä, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Samuilova, O.
Right arrow Articles by Hyypiä, T.

 Previous Article  |  Next Article 

Journal of Virology, January 2006, p. 1053-1058, Vol. 80, No. 2
0022-538X/06/$08.00+0     doi:10.1128/JVI.80.2.1053-1058.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

ATP Hydrolysis and AMP Kinase Activities of Nonstructural Protein 2C of Human Parechovirus 1

Olga Samuilova,1* Camilla Krogerus,1 Igor Fabrichniy,2 and Timo Hyypiä1,3*

Department of Virology, Haartman Institute, University of Helsinki, FIN-00014 Helsinki, Finland,1 Institute of Biotechnology, University of Helsinki, FIN-00014 Helsinki, Finland,2 Department of Virology, University of Turku, FIN-20520 Turku, Finland3

Received 26 July 2005/ Accepted 19 October 2005


arrow
ABSTRACT
 
The highly conserved picornavirus 2C proteins, thought to be involved in genome replication, contain three motifs found in NTPases/helicases of superfamily III. We report that human parechovirus 1 2C displays Mg2+-dependent ATP diphosphohydrolase activity in vitro, whereas other nucleoside triphosphates are not substrates for the hydrolysis. We also found that the 2C protein has an enzymatic activity that converts AMP to a corresponding diphosphate using ADP or ATP as a phosphate donor. In addition, we observed that ATP hydrolysis results in 2C autophosphorylation. These findings indicate that the parechovirus 2C protein has enzymatic activities, which may contribute to several functions in the viral replication cycle.


arrow
TEXT
 
Human parechovirus 1 (HPEV1) is a human pathogen associated with gastrointestinal and respiratory symptoms and occasionally with infections of the central nervous system (32). HPEV1 belongs to the Parechovirus genus of the family Picornaviridae, which are small nonenveloped viruses with a positive-strand RNA genome, approximately 7.5 kb in length (14). After entry into the host cell, viral RNA is translated into a polyprotein, which is subsequently processed by virus-specific proteolytic activities to produce polypeptides found in the virion and nonstructural proteins involved in virus replication (32). In addition to being directly involved in viral RNA replication, the picornavirus nonstructural proteins also take part in the modification of intracellular membranes and induction of membranous replication complexes during the infection (3, 4, 6, 8, 21). We have recently reported that HPEV1 2C is a membrane-bound protein present in the viral replication complex, but its distribution in the infected cells differs considerably from its enterovirus counterpart (21). The exact biochemical mechanisms by which the HPEV1 2C protein engages in virus replication are currently unknown. Here, we have performed biochemical characterization of HPEV1 2C to better understand its functions.

Analysis of HPEV1 2C ATP diphosphohydrolase activity. It has been demonstrated that 2C proteins of picornaviruses display an extensive conservation in amino acid sequences and exhibit homology to the NTPase/helicase superfamily III (9, 10). In this study, the HPEV1 2C protein, expressed as a glutathione S-transferase (GST) fusion polypeptide, was purified under native conditions as described previously (21) (Fig. 1A) and assayed for NTPase activity. Hydrolysis of [{gamma}-33P]ATP by GST-2C was investigated by thin-layer chromatographic separation (TLC) (16) of the resulting products on polyethyleneimine-cellulose F sheets (Merck) along with known nonradioactive standards. As shown in Fig. 1B, incubation of increasing concentrations of GST-2C with 1 µCi [{gamma}-33P]ATP (1,000 to 3,000 Ci/mmol; Amersham) at 37°C in a buffer containing 20 mM HEPES-KOH (pH 7.4), 5 mM Mg2+, and 1 mM dithiothreitol (DTT) in the presence of 40 µM unlabeled ATP led to an increase in the released radiolabeled inorganic phosphate (Pi). The GST protein alone used in the reaction as a control and the buffer without a protein did not exhibit significant activity (Fig. 1B). To confirm that the observed ATP hydrolysis was mediated by 2C, we thought to construct a mutant that lacked this activity. Mutational changes of the conserved Lys within the first NTPase/helicase motif of other viruses have been shown to severely impair protein hydrolytic activity (2, 24, 28, 29). Therefore, a GST-2CK146A mutant was made using the 2CpGEX4T-1 construct (21) as a template for specific PCR-based mutagenesis using Phusion DNA polymerase (Finnzymes) and oligonucleotide primers GCATCTTTCTTGACCCACACC and TCCTTGTCCTGGCTCACCTTA as described previously (31). GST-2CK146A was expressed in Escherichia coli cells and purified as described for the wild type. Subsequent functional analysis of the GST-2CK146A mutant showed a loss of ATP hydrolytic activity (see Fig. 3A, lane 5).


Figure 1
View larger version (22K):
[in this window]
[in a new window]
 
FIG. 1. ATP hydrolysis activity of the HPEV1 2C protein. (A) SDS-PAGE analysis of the purified GST-2C, GST-2CK146A, and GST proteins. The proteins were separated on 12% SDS-PAGE. The gel was stained with Coomassie brilliant blue. The positions of molecular weight markers (in thousands) are shown on the right of the panel. (B) Polyethyleneimine-TLC analysis of products of the reaction catalyzed by GST-2C. The reaction was carried out in the absence or in the presence of increasing concentrations of GST-2C. The proteins were incubated with [{gamma}-33P]ATP in the presence of 40 µM unlabeled ATP in the reaction buffer (20 mM HEPES-KOH [pH 7.4], 5 mM Mg2+, and 1 mM DTT) at 37°C for 1 h, and the reactions were stopped by addition of EDTA up to a final concentration of 50 mM. The products were separated by TLC, and the chromatogram was developed in 0.15 M formic acid and 0.15 M LiCl, dried, and subjected to PhosphorImager analysis. The amount of hydrolyzed Pi is shown on the bottom. (Nonradioactive nucleotides were used as standards. The spots were visualized under UV light and marked on the cellulose.) (C) Determination of ATP cleavage sites during ATP hydrolysis. The proteins were incubated with [{alpha}-32P]ATP in the buffer as described above. (D) ADPase activity of the GST-2C protein. The proteins were incubated with nonradiolabeled ADP, and the reaction products were separated as described above and visualized under UV light. (ADP and AMP were used as standards.) (E to H) ATP hydrolysis activity of the 2C protein. GST-2C was incubated with radiolabeled ATP in the reaction buffer containing 4 µM cold ATP at 37°C for 30 min. The reaction products were analyzed as described for panel B. (E) Divalent cation specificity. The reactions were performed in the presence of various concentrations of MgCl2 ({blacksquare}) or MnCl2 ({blacktriangleup}). (F) Effect of pH on ATP hydrolysis activity of the 2C protein. (G) Effect of temperature on ATP hydrolysis activity of the 2C protein. GST-2C was incubated in the reaction mixture at different temperatures. (H) Effect of NaCl on ATP hydrolysis activity of the 2C protein.


Figure 3
View larger version (24K):
[in this window]
[in a new window]
 
FIG. 3. Phosphoryltransfer and autophosphorylation activities of the GST-2C protein. (A) Effects of ATP/ADP/AMP on radiolabeled ATP hydrolysis by the GST-2C protein. The proteins (0.7 µM) were incubated with [{gamma}-33P]ATP (1 µCi) in the absence (lanes 1 and 5) or in the presence (lanes 2 to 4 and 6 to 8) of 200 µM unlabeled competitors at 37°C for 1 h. The products were analyzed as described in the legend to Fig. 1B. (B) AMP kinase activity of GST-2C. The proteins were incubated with 32P (1 µCi) in the absence or in the presence of 200 µM unlabeled ATP/ADP/AMP. The products were analyzed as described in the legend to Fig. 1B. (C) Autophosphorylation of GST-2C. GST-2C (0.5 µg) was incubated with [{gamma}-33P]ATP. After the reaction was stopped, half of the probe was subsequently treated with {lambda}-protein phosphatase for 30 min, while the other half was left untreated. The probes were analyzed by SDS-PAGE and autoradiography. (D) Autophosphorylation of GST-2C. GST-2C (lanes 1 to 4) and GST-2CK146A (lane 5) were incubated with radiolabeled ATP in the presence of increasing concentrations of unlabeled ATP (2 µM [lanes 1 and 5], 10 µM [lane 2], 25 µM [lane 3], and 50 µM [lane 4]). The products were then analyzed by SDS-PAGE and autoradiography.

To characterize the position of the enzymatic cleavage site in ATP, experiments were performed with [{alpha}-32P]ATP (3,000 Ci/mmol; Amersham). In the sample containing GST-2C, ATP was hydrolyzed to ADP and AMP by hydrolysis of the ß-{gamma} and {alpha} phosphodiester bonds (Fig. 1C), suggesting that ADP as well as ATP are substrates for the protein hydrolytic activity. To confirm that GST-2C is able to hydrolyze ADP to AMP, the experiments were performed with ADP as a substrate. As can be seen in Fig. 1D, ADP was hydrolyzed to AMP in the reactions containing GST-2C, whereas the mutant GST-2CK146A protein possessed no such activity (Fig. 1D). Therefore, we concluded that GST-2C has ATP diphosphohydrolase activity that can hydrolyze ß-{gamma} and {alpha}-ß bonds of ATP. In contrast, poliovirus and echovirus 9 2C proteins have been found to cleave only {gamma}-phosphate of ATP (18, 28, 30). Although the energy released during NTP hydrolysis has been proposed to be associated with viral helicase functions required for duplex unwinding (18, 30), direct evidence of helicase activity of the picornavirus 2C proteins is still lacking. ATP hydrolysis by 2C may also be important for generating energy that is used for conformational changes in proteins, in transport, sorting, or packaging of viral RNA, as well as in viral replication and the formation of the viral replication complex.

To analyze ATP hydrolysis activity of the HPEV1 2C protein in more detail, we first established optimal reaction conditions for the enzyme reaction. Addition of EDTA to the reaction completely abolished the ATP hydrolysis of the GST-2C protein, indicating that the activity, as that of many other NTPases, is dependent on divalent cations (15). The optimal Mg2+ concentration for the reaction was in the range of 2.5 to 5 mM (Fig. 1E). Mn2+ could substitute for Mg2+, although less Pi was released. While Mg2+ and Mn2+ stimulated 2C-catalyzed ATP hydrolysis, Ca2+ and Zn2+ were not efficient cofactors for the activity (data not shown). We found that the pH optimum for ATP hydrolysis by 2C was 7 to 8, and maximum hydrolysis was achieved at 37°C (Fig. 1F and G). Our results concerning NaCl dependence of the reaction indicated that monovalent cations at concentrations up to 150 mM stimulate the enzymatic activity, whereas higher concentrations inhibit ATP hydrolysis (Fig. 1H). Therefore, appropriate concentrations of Mg2+ (5 mM) and NaCl (50 mM) were added to subsequent assays.

To further characterize the enzyme activity, we performed a time course analysis of ATP hydrolysis by GST-2C. The reactions were carried out with 0.1 µM GST-2C in the presence of variable amounts of unlabeled ATP and a constant amount of [{alpha}-32P]ATP (Fig. 2A). Deceleration of ADP accumulation followed by acceleration of AMP accumulation during the reaction course demonstrates that 2C does not processively hydrolyze ATP to AMP but rather uses both ATP and ADP as substrates. Consistent with that, the Km and kcat values for ATP and ADP were determined to be 3.4 ± 1.6 µM and 2.04 ± 0.9 min–1 and 0.65 ± 0.20 µM and 0.32 ± 0.1 min–1, respectively. Our data indicate that HPEV1 2C protein has about a 200-fold-higher affinity to ATP than poliovirus 2C (Km value of 700 µM) (28). The turnover number for ATP hydrolysis by HPEV1 2C was similar to that reported for other viral NTPases (5, 26, 33) and G proteins (1, 22, 25); kinetic data published elsewhere also showed significant similarities between catalytic powers of HPEV1 2C and other viral NTPases (11, 12, 17, 27, 34, 35).


Figure 2
View larger version (20K):
[in this window]
[in a new window]
 
FIG. 2. (A) Kinetic analysis of ATP hydrolysis by GST-2C. GST-2C was incubated in the reaction buffer (20 mM HEPES-KOH [pH 7.4], 5 mM Mg2+, 50 mM NaCl, and 1 mM DTT) containing radiolabeled and unlabeled ATP (filled circles correspond to 0.5 µM, open circles correspond to 1 µM, filled triangles correspond to 2 µM, and open triangles correspond to 5 µM unlabeled ATP) at 37°C. At each time interval, aliquots were withdrawn from the reaction mixture and quenched immediately with formic acid. ADP and AMP formed during the reaction are plotted as a function of time. The measured concentrations of products, accumulated during the reaction as a function of time, are given by equations 1 and 2, where [EATP] and [EADP] are concentrations of the enzyme complexes with corresponding substrate and kcatATP and kcatADP are catalytic constants of the hydrolysis reaction for ATP and ADP, respectively.


Formula 1(1)


Formula 2(2)

Concentrations of the enzyme complexes with ATP and ADP are described by the following equations:


Formula 3(3)


Formula 4(4)

where KmATP and KmADP are enzyme Michaelis constants for ATP and ADP, respectively. The ATP concentration is described by equation 5, where [ATP]t is a total concentration of ATP added to the reaction mixture


Formula 5(5)

Nonlinear least-square fitting of the data was performed using SCIENTIST version 2.01 (Micromath), which allows the use of systems of implicit equations. (The fits for the AMP data are not as good. This may be explained by the presence of contaminating ADP in labeled ATP substrate.) (B) ATP-binding activity of GST-2C. GST-2C was incubated with [{alpha}-32P]ATP in the reaction buffer as described in Table 1. Autoradiography of SDS-PAGE shows the effects of an excess of unlabeled NTPs on ATP binding. (C) Effect of RNA on ATP hydrolysis activity by GST-2C. The reactions containing GST-2C (lanes 1 and 3) were incubated with [{alpha}-32P]ATP in the absence (lane 1) or in the presence (lane 3) of 1,000 ng of poly(U). One reaction does not contain GST-2C (lane 2). The products were analyzed as described in the legend to Fig. 1B.

In order to investigate the substrate specificity of the GST-2C protein, competition experiments were performed. The substrate specificity was addressed by adding GST-2C to the reaction mixtures containing 1 µM cold ATP, [{gamma}-33P]ATP, and a 40-fold excess of each of the four unlabeled NTPs. The results, summarized in Table 1, showed that the hydrolysis of labeled ATP was competed only by the presence of unlabeled ATP, and the presence of CTP, GTP, or UTP did not affect the release of labeled Pi. Since among all the NTPs tested, ATP was the most efficient competitor, it was interesting to examine whether dATP could be also used by 2C as a substrate for the hydrolysis, but the excess of dATP had no effect on radiolabeled ATP hydrolysis (Table 1). In regard to the question of substrate specificity, we also investigated the effect of excess of four unlabeled nucleoside triphosphates (NTPs) on HPEV1 2C ATP-binding activity. In this experiment, GST-2C was incubated in the reaction buffer containing 1 µCi [{alpha}-32P]ATP and 1 µM cold ATP for 15 min in the presence or absence of a 40-fold excess of unlabeled competitors. The probes were cross-linked by UV light (254 nm, 0.8 J/cm2) using Stratalinker (Stratagene) and subsequently analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and autoradiography. The radioactivity associated with the GST-2C complexes was quantified by phosphorimaging (Fuji) and compared with the control sample containing no competitors. As expected, 2C was able to bind ATP efficiently (Fig. 2B), and addition of an excess of unlabeled ATP resulted in a significant reduction of binding of radiolabeled ATP to 2C. Other NTPs did not reduce protein binding when the same proportional ratio was used. It has been previously reported that poliovirus 2C has affinity to GTP but to a much lesser extent than to ATP (28, 30). Interestingly, echovirus 9 2C could use ATP, GTP, and CTP as substrates for hydrolysis, although higher preference was detected for ATP (18).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Effect of unlabeled NTPs on hydrolysis of [{gamma}-33P]ATP by HPEV1 2Ca

In general, hydrolytic activity of NTPases is stimulated by the presence of single-stranded nucleic acids (15). Therefore, we next sought to determine whether RNA could stimulate HPEV1 2C ATP hydrolysis. We found that the addition of poly(U) or poly(A) (Pharmacia) or specific 5' untranslated region or 3' untranslated region HPEV1 RNA (31) at different concentrations to the reaction mixture inhibited the protein activity 1.3- to 1.5-fold compared to the activity observed in the absence of RNA (Fig. 2C, lane 3). The ATPase activity of poliovirus 2C has also been shown to be sensitive to RNA (28). In the presence of several kinds of RNAs, an inhibitory effect on the poliovirus 2C ATPase activity of up to 90% has been reported (28). Moreover, poly(U) has also been described to inhibit the NTPase activity of calicivirus 2C-like proteins (23, 29). The inhibition of 2C ATP hydrolysis in the presence of RNA suggests that this activity may need to be down-regulated during some steps of viral replication. However, the underlying mechanisms of the phenomenon are not clear. It has been shown that in the HPEV1-infected cells, 2C colocalizes with viral RNA (21), and this interaction may regulate ATP hydrolytic activity of 2C at certain steps of HPEV1 replication. Previously, we also reported that in HPEV1-infected cells the majority of 2C is found on endoplasmic reticulum-derived membranes, which seem not to be directly involved in viral replication (21). Therefore, it could be speculated that HPEV1 2C ATP diphosphohydrolase might also be active in these structures and serve as a crucial source of energy for different steps during the HPEV1 life cycle.

HPEV1 2C exhibits phosphoryltransfer activity and autophosphorylation. To further investigate the ATP hydrolysis activity of GST-2C, assays were performed with [{gamma}-33P]ATP and 200 µM unlabeled ATP, ADP, or AMP (Fig. 3A). Surprisingly, in the reaction containing [{gamma}-33P]ATP and AMP as an unlabeled competitor, formation of radiolabeled ADP was observed (Fig. 3A, lane 4). About 60% of the substrate ATP was converted into radiolabeled ADP, suggesting that GST-2C can utilize Pi, released during the hydrolysis of ATP, and AMP as acceptor molecules to generate ADP. In the presence of ADP/ATP as unlabeled competitors, formation of a small amount of radiolabeled ADP could also be seen. It should be noted that in the reactions performed with [{gamma}-33P]ATP in the absence of unlabeled ATP/ADP/AMP, radiolabeled ADP was also generated. The amount of radiolabeled ADP produced varied depending on the protein concentration and incubation time (data not shown). In a control experiment, the reaction was carried out in the presence of the GST-2CK146A protein. In contrast, no activity was observed when the mutant was substituted for the GST-2C protein in the assay (Fig. 3A, lanes 5 to 8).

In subsequent experiments, we analyzed the AMP kinase activity of GST-2C in the presence of 1 µCi 32P (40 mCi/ml; Amersham) and 200 µM unlabeled AMP/ADP/ATP (Fig. 3B). Formation of radiolabeled ADP was observed in the probes containing unlabeled ADP or ATP, whereas no [32P]ADP formation could be seen in the reaction containing AMP. This could be explained by the activity of the protein being energy dependent, therefore requiring ATP/ADP hydrolysis. In parallel, we used the GST-2CK146A protein, and as expected, the mutant protein possessed no activity (Fig. 3B).

To determine whether 2C has an associated kinase activity that can cause autophosphorylation, the protein was incubated in a buffer containing [{gamma}-33P]ATP in the presence of Mg2+. Subsequently, half of the probe was either left untreated or treated with {lambda}-protein phosphatase (New England Biolabs). When the probes were analyzed by SDS-PAGE, autoradiography revealed that 2C became radiolabeled (Fig. 3C), suggesting that the protein is autophosphorylated during ATP hydrolysis. Subsequent treatment of the probe with {lambda}-protein phosphatase significantly decreased the extent of phosphorylation (Fig. 3C). The autophosphorylation reaction was also monitored as a function of ATP concentration (Fig. 3D). The GST-2C protein was incubated with radiolabeled ATP in the presence of increasing amounts of unlabeled ATP and then analyzed by SDS-PAGE. Autoradiography revealed that 2C autophosphorylation was gradually decreased in the presence of increasing concentrations of unlabeled ATP. GST-2CK146A was used as a control protein, and autoradiography showed that the mutant was not autophosphorylated during the reaction (Fig. 3D, lane 5).

In this communication, we report on enzymatic activities of the HPEV1 2C protein, ATP diphosphohydrolase, AMP kinase and autophosphorylation, which have not been reported previously. However, the molecular details of 2C autophosphorylation remain to be resolved, and potentially it may involve a cascade of events initiated by the ATP hydrolysis activity of the protein causing its autophosphorylation.

The specific role of the HPEV1 2C AMP kinase activity in virus replication is still unclear, although one may speculate that it represents an adenosine diphosphate-generating system and allows utilization of ADP for different processes, e.g., replication during the host cell stationary phase when NTP levels may be low. Most interestingly, it has been demonstrated that encephalomyocarditis virus exhibits marked preference for nucleoside diphosphates over NTPs as substrates for viral RNA synthesis (19, 20). Encephalomyocarditis virus could utilize nucleoside diphosphate and nucleoside monophosphate for viral RNA synthesis, and nucleoside diphosphate and nucleoside monophosphate kinases appear to be specifically associated with viral replication complexes (19, 20). Several lines of evidence suggest that these nucleotide kinases together with the viral RNA polymerase are able to accomplish kinetic coupling between viral replication and synthesis of NTP (20). Alternatively, this viral protein activity may be involved in modulation of cellular reactions, and 2C may indirectly affect processes by changing the delicately balanced intracellular nucleotide levels. The data presented here and the finding that the 2C protein of HPEV1, unlike the corresponding protein in enteroviruses, is not exclusively located to the replication complex (21; C. Krogerus, O. Samuilova, T. Pöyry, E. Jokitalo, and T. Hyypiä, unpublished data) suggest that the 2C protein may have distinct, unique functions in the viral life cycle.


arrow
ACKNOWLEDGMENTS
 
This work was supported by the grants from the Academy of Finland and the Sigrid Juselius Foundation.

We gratefully acknowledge A. A. Baykov for valuable discussions and help with calculation of the kinetic parameters. V. D. Samouilov, K. Ivanov, K. Saksela, and G. Belogurov are acknowledged for their valuable comments on the manuscript. T. Kesti is acknowledged for technical help with Fig. 1D.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address for Olga Samuilova: Haartman Institute, Department of Virology, P.O. Box 21, FIN-00014 University of Helsinki, Helsinki, Finland. Phone: 358-9-191 26 481. Fax: 358-9-191 26 491. E-mail: olga.samuildva{at}helsinki.fi. Mailing address for Timo Hyypiä: Department of Virology, University of Turku, Kiinamyllynkatu 13, FIN-20520 Turku, Finland. Phone: 358-2-333 7460. Fax: 358-2-251 3303. E-mail: timo.hyypia@utu.fi. Back


arrow
REFERENCES
 
    1
  1. Arshavsky, V. Y., C. L. Dumke, Y. Zhu, N. O. Artemyev, N. P. Skiba, H. E. Hamm, and M. D. Bownds. 1994. Regulation of transducin GTPase activity in bovine rod outer segments. J. Biol. Chem. 269:19882-19887.[Abstract/Free Full Text]
  2. 2
  3. Benarroch, D., B. Selisko, G. A. Locatelli, G. Maga, J. L. Romette, and B. Canard. 2004. The RNA helicase, nucleotide 5'-triphosphatase, and RNA 5'-triphosphatase activities of Dengue virus protein NS3 are Mg2+-dependent and require a functional Walker B motif in the helicase catalytic core. Virology 328:208-218.[CrossRef][Medline]
  4. 3
  5. Bienz, K., D. Egger, M. Troxler, and L. Pasamontes. 1990. Structural organization of poliovirus RNA replication is mediated by viral proteins of the P2 genomic region. J. Virol. 64:1156-1163.[Abstract/Free Full Text]
  6. 4
  7. Bienz, K., D. Egger, and T. Pfister. 1994. Characteristics of the poliovirus replication complex. Arch. Virol. Suppl. 9:147-157.[Medline]
  8. 5
  9. Bisaillon, M., J. Bergeron, and G. Lemay. 1997. Characterization of the nucleoside triphosphate phosphohydrolase and helicase activities of the reovirus {lambda}1 protein. J. Biol. Chem. 272:18298-18303.[Abstract/Free Full Text]
  10. 6
  11. Cho, M. W., N. Teterina, D. Egger, K. Bienz, and E. Ehrenfeld. 1994. Membrane rearrangement and vesicle induction by recombinant poliovirus 2C and 2BC in human cells. Virology 202:129-145.[CrossRef][Medline]
  12. 7
  13. Reference deleted.
  14. 8
  15. Egger, D., L. Pasamontes, R. Bolten, V. Boyko, and K. Bienz. 1996. Reversible dissociation of the poliovirus replication complex: functions and interactions of its components in viral RNA synthesis. J. Virol. 70:8675-8683.[Abstract]
  16. 9
  17. Gorbalenya, A. E., and E. V. Koonin. 1989. Viral proteins containing the purine NTP-binding sequence pattern. Nucleic Acids Res. 17:8413-8440.[Abstract/Free Full Text]
  18. 10
  19. Gorbalenya, A. E., E. V. Koonin, and Y. I. Wolf. 1990. A new superfamily of putative NTP-binding domains encoded by genomes of small DNA and RNA viruses. FEBS Lett. 262:145-148.[CrossRef][Medline]
  20. 11
  21. Gross, C. H., and S. Shuman. 1996. The QRxGRxGRxxxG motif of the vaccinia virus DExH box RNA helicase NPH-II is required for ATP hydrolysis and RNA unwinding but not for RNA binding. J. Virol. 70:1706-1713.[Abstract]
  22. 12
  23. Gwack, Y., H. Yoo, I. Song, J. Choe, and J. H. Han. 1999. RNA-stimulated ATPase and RNA helicase activities and RNA binding domain of hepatitis G virus nonstructural protein 3. J. Virol. 73:2909-2915.[Abstract/Free Full Text]
  24. 13
  25. Reference deleted.
  26. 14
  27. Hyypiä, T., C. Horsnell, M. Maaronen, M. Khan, N. Kalkkinen, P. Auvinen, L. Kinnunen, and G. Stanway. 1992. A distinct picornavirus group identified by sequence analysis. Proc. Natl. Acad. Sci. USA 15:8847-8851.
  28. 15
  29. Kadare, G., and A. L. Haenni. 1997. Virus-encoded RNA helicases. J. Virol. 71:2583-2590.[Medline]
  30. 16
  31. Kalinina, N. O., O. N. Fedorkin, O. V. Samuilova, E. Maiss, T. Korpela, S. Y. Morozov, and J. G. Atabekov. 1996. Expression and biochemical analyses of the recombinant potato virus X 25K movement protein. FEBS Lett. 397:75-78.[CrossRef][Medline]
  32. 17
  33. Kim, J., J. S. Parker, K. E. Murray, and M. L. Nibert. 2004. Nucleoside and RNA triphosphatase activities of orthoreovirus transcriptase cofactor mu2. J. Biol. Chem. 279:4394-4403.[Abstract/Free Full Text]
  34. 18
  35. Klein, M., H. J. Eggers, and B. Nelsen-Salz. 1999. Echovirus 9 strain barty non-structural protein 2C has NTPase activity. Virus Res. 65:155-160.[CrossRef][Medline]
  36. 19
  37. Koonin, E. V., and V. I. Agol. 1983. Encephalomyocarditis virus replication complexes that prefer nucleoside diphosphates as substrates for viral RNA synthesis. Virology 129:309-318.[CrossRef][Medline]
  38. 20
  39. Koonin, E. V., and V. I. Agol. 1984. Encephalomyocarditis virus replication complexes preferentially utilizing nucleoside diphosphates as substrates for viral RNA synthesis. Nucleotide kinases specifically associated with the complex channel RNA precursor. Eur. J. Biochem. 144:249-254.[Medline]
  40. 21
  41. Krogerus, C., D. Egger, O. Samuilova, T. Hyypiä, and K. Bienz. 2003. Replication complex of human parechovirus 1. J. Virol. 77:8512-8523.[Abstract/Free Full Text]
  42. 22
  43. Linder, M. E., D. A. Ewald, R. J. Miller, and A. G. Gilman. 1990. Purification and characterization of Go alpha and three types of Gi alpha after expression in Escherichia coli. J. Biol. Chem. 265:8243-8251.[Abstract/Free Full Text]
  44. 23
  45. Marin, M. S., R. Casais, J. M. Alonso, and F. Parra. 2000. ATP binding and ATPase activities associated with recombinant rabbit hemorrhagic disease virus 2C-like polypeptide. J. Virol. 74:10846-10851.[Abstract/Free Full Text]
  46. 24
  47. Matusan, A. E., M. J. Pryor, A. D. Davidson, and P. J. Wright. 2001. Mutagenesis of the Dengue virus type 2 NS3 protein within and outside helicase motifs: effects on enzyme activity and virus replication. J. Virol. 75:9633-9643.[Abstract/Free Full Text]
  48. 25
  49. Mildvan, A. S. 1997. Mechanisms of signaling and related enzymes. Proteins 29:401-416.[CrossRef][Medline]
  50. 26
  51. Morgenstern, K. A., J. A. Landro, K. Hsiao, C. Lin, Y. Gu, M. S. S. Su, and J. A. Thomson. 1997. Polynucleotide modulation of the protease, nucleoside triphosphatase, and helicase activities of a hepatitis C virus NS3-NS4A complex isolated from transfected COS cells. J. Virol. 71:3767-3775.[Abstract]
  52. 27
  53. Myette, J. R., and E. G. Niles. 1996. Characterization of the vaccinia virus RNA 5'-triphosphatase and nucleotide triphosphate phosphohydrolase activities. Demonstration that both activities are carried out at the same active site. J. Biol. Chem. 271:11945-11952.[Abstract/Free Full Text]
  54. 28
  55. Pfister, T., and E. Wimmer. 1999. Characterization of the nucleoside triphosphatase activity of poliovirus protein 2C reveals a mechanism by which guanidine inhibits poliovirus replication. J. Biol. Chem. 274:6992-7001.[Abstract/Free Full Text]
  56. 29
  57. Pfister, T., and E. Wimmer. 2001. Polypeptide p41 of a Norwalk-like virus is a nucleic acid-independent nucleoside triphosphatase. J. Virol. 75:1611-1619.[Abstract/Free Full Text]
  58. 30
  59. Rodriguez, P. L., and L. Carrasco. 1993. Poliovirus protein 2C has ATPase and GTPase activities. J. Biol. Chem. 268:8105-8110.[Abstract/Free Full Text]
  60. 31
  61. Samuilova, O., C. Krogerus, T. Pöyry, and T. Hyypiä. 2004. Specific interaction between human parechovirus nonstructural 2A protein and viral RNA. J. Biol. Chem. 279:37822-37831.[Abstract/Free Full Text]
  62. 32
  63. Stanway, G., and T. Hyypiä. 1999. Parechoviruses. J. Virol. 73:5249-5254.[Free Full Text]
  64. 33
  65. Suzich, J. A., J. K. Tamura, F. Palmer-Hill, P. Warrener, A. Grakoui, C. M. Rice, S. M. Feinstone, and M. S. Collett. 1993. Hepatitis C virus NS3 protein polynucleotide-stimulated nucleoside triphosphatase and comparison with the related pestivirus and flavivirus enzymes. J. Virol. 67:6152-6158.[Abstract/Free Full Text]
  66. 34
  67. Wardell, A. D., W. Errington, G. Ciaramella, J. Merson, and M. J. McGarvey. 1999. Characterization and mutational analysis of the helicase and NTPase activities of hepatitis C virus full-length NS3 protein. J. Gen. Virol. 80:701-709.[Abstract]
  68. 35
  69. Yon, C., T. Teramoto, N. Mueller, J. Phelan, V. K. Ganesh, K. H. Murthy, and R. Padmanabhan. 2005. Modulation of the nucleoside triphosphatase/RNA helicase and 5'-RNA triphosphatase activities of dengue virus type 2 nonstructural protein 3 (NS3) by interaction with NS5, the RNA-dependent RNA polymerase. J. Biol. Chem. 280:27412-27419.[Abstract/Free Full Text]


Journal of Virology, January 2006, p. 1053-1058, Vol. 80, No. 2
0022-538X/06/$08.00+0     doi:10.1128/JVI.80.2.1053-1058.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Cordey, S., Gerlach, D., Junier, T., Zdobnov, E. M., Kaiser, L., Tapparel, C. (2008). The cis-acting replication elements define human enterovirus and rhinovirus species. RNA 14: 1568-1578 [Abstract] [Full Text]  
  • De Palma, A. M., Heggermont, W., Lanke, K., Coutard, B., Bergmann, M., Monforte, A.-M., Canard, B., De Clercq, E., Chimirri, A., Purstinger, G., Rohayem, J., van Kuppeveld, F., Neyts, J. (2008). The Thiazolobenzimidazole TBZE-029 Inhibits Enterovirus Replication by Targeting a Short Region Immediately Downstream from Motif C in the Nonstructural Protein 2C. J. Virol. 82: 4720-4730 [Abstract] [Full Text]  
  • Krogerus, C., Samuilova, O., Poyry, T., Jokitalo, E., Hyypia, T. (2007). Intracellular localization and effects of individually expressed human parechovirus 1 non-structural proteins. J. Gen. Virol. 88: 831-841 [Abstract] [Full Text]  
  • Al-Sunaidi, M., Williams, C. H., Hughes, P. J., Schnurr, D. P., Stanway, G. (2007). Analysis of a New Human Parechovirus Allows the Definition of Parechovirus Types and the Identification of RNA Structural Domains. J. Virol. 81: 1013-1021 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Samuilova, O.
Right arrow Articles by Hyypiä, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Samuilova, O.
Right arrow Articles by Hyypiä, T.