This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wodrich, H.
Right arrow Articles by Gerace, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wodrich, H.
Right arrow Articles by Gerace, L.

 Previous Article  |  Next Article 

Journal of Virology, October 2006, p. 9608-9618, Vol. 80, No. 19
0022-538X/06/$08.00+0     doi:10.1128/JVI.00850-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Adenovirus Core Protein pVII Is Translocated into the Nucleus by Multiple Import Receptor Pathways{dagger}

Harald Wodrich,1,3*,{ddagger} Aurelia Cassany,1,{ddagger} Maximiliano A. D'Angelo,1,§ Tinglu Guan,1 Glen Nemerow,2 and Larry Gerace1

Department of Cell Biology, Scripps Research Institute, La Jolla, California,1 Department of Immunology, Scripps Research Institute, La Jolla, California,2 Institut de Génétique Moléculaire de Montpellier, UMR 5535 CNRS, IFR 122, Montpellier, France3

Received 25 April 2006/ Accepted 6 July 2006


arrow
ABSTRACT
 
Adenoviruses are nonenveloped viruses with an ~36-kb double-stranded DNA genome that replicate in the nucleus. Protein VII, an abundant structural component of the adenovirus core that is strongly associated with adenovirus DNA, is imported into the nucleus contemporaneously with the adenovirus genome shortly after virus infection and may promote DNA import. In this study, we evaluated whether protein VII uses specific receptor-mediated mechanisms for import into the nucleus. We found that it contains potent nuclear localization signal (NLS) activity by transfection of cultured cells with protein VII fusion constructs and by microinjection of cells with recombinant protein VII fusions. We identified three NLS-containing regions in protein VII by deletion mapping and determined important NLS residues by site-specific mutagenesis. We found that recombinant protein VII and its NLS-containing domains strongly and specifically bind to importin {alpha}, importin ß, importin 7, and transportin, which are among the most abundant cellular nuclear import receptors. Moreover, these receptors can mediate the nuclear import of protein VII fusions in vitro in permeabilized cells. Considered together, these data support the hypothesis that protein VII is a major NLS-containing adaptor for receptor-mediated import of adenovirus DNA and that multiple import pathways are utilized to promote efficient nuclear entry of the viral genome.


arrow
INTRODUCTION
 
Adenoviruses (Ads) are nonenveloped, double-stranded DNA viruses with a diameter of ~90 nm. They contain an outer capsid shell with icosahedral symmetry composed of 12 vertices and 20 facets surrounding the viral core with the genomic DNA. Extending from each of the 12 vertices of the capsid is the spike-like fiber protein, which is anchored to the vertices by the penton protein. Ad infection of cells is initiated by attachment of the fiber to the Coxsackie adenovirus receptors of cells, followed by association of the penton with {alpha}V integrins. This secondary penton interaction is required for fiber release and viral uptake into clathrin-coated pits of the early endosomal pathway (10, 43, 51; reviewed in references 9 and 34). In the early endosome, a poorly understood mechanism involving a drop in pH induces conformational changes in the capsid, which appears to release proteins of the vertex region, including protein VI and penton (17). An amphipathic helix at the N terminus of protein VI is thought to mediate disruption of the endosomal membrane and aid in the release of the remaining partially uncoated capsid into the cytoplasm (52). The nucleocapsid then moves toward the nucleus in a microtubule- and dynein-dependent mechanism (26) and docks at the nuclear pore complex (NPC), the proteinaceous channel that mediates transport across the nuclear envelope. Finally, the viral genome is imported into the nucleus prior to initiation of viral replication (16, 44).

In contrast to the Ad capsid, the core does not display a well-ordered symmetry or the coaxial coiling of DNA previously observed with most bacteriophages (12, 23). The adenoviral genome is an ~36-kb linear double-stranded DNA with the terminal protein covalently attached to each 5' end (42). Inside the core, the DNA is condensed by association with three cationic polypeptides termed proteins V, VII, and µ (5, 7, 50). Protein V may form a layer around the core connecting it to the capsid via interactions with protein VI and with core protein VII and/or the DNA (7, 33). Protein VII is the most abundant core protein. It is present at ~800 copies per virion and is tightly associated with the DNA in a sequence-independent manner, apparently packaging the genome in nucleosome-like structures (5, 48, 49). Protein µ is a 19-amino-acid cationic peptide that has high DNA-condensing properties (2, 27). Both protein VII and µ are derived from precursor proteins, which are processed by the adenoviral protease upon virus assembly. During nuclear import of the viral genome at the NPC, protein VII and µ have been reported to remain associated with the DNA, whereas protein V may dissociate from the DNA prior to, or immediately following, the DNA translocation (6). The nucleocapsid appears to dock at the NPC by direct interaction of hexon with NPC proteins (nucleoporins) (47). Subsequent capsid disintegration and import of the viral genome is believed to require cellular factors, including nuclear import receptors and the heat shock protein hsc70 (44), and histone H1 (15, 44, 47).

The NPC contains an aqueous channel that connects the nucleus and cytoplasm. Molecules smaller than ~20 to 40 kDa are able to passively diffuse through the NPC. By contrast, most proteins and protein-nucleic acid complexes are transported through the NPC by saturable, energy-dependent pathways, usually involving receptors of the importin ß/karyopherin ß superfamily (13, 38; reviewed in reference 32). Import receptors interact with nuclear localization signals (NLSs) on cargoes in the cytosol, and the receptor-cargo complexes transit the NPC by interactions of the receptors with nucleoporins containing Phe-Gly (FG) di-amino acid repeat motifs. The directionality of transport is specified by the small GTPase Ran, which is concentrated in its GTP-bound form in the nucleus. The binding of Ran-GTP to import receptors triggers the dissociation of cargoes, thereby terminating the import reaction.

Classical NLSs (cNLSs) are short amino acid segments enriched in basic amino acid residues, which can be either a single stretch of basic residues (monopartite) or two basic amino acid clusters separated by ~10 other residues (bipartite) (reviewed in reference 32). Classical NLSs bind to the major import receptor importin ß via the adaptor importin {alpha}. Many nonclassical NLSs also have been described, typically comprising longer segments that are enriched in basic amino acid stretches. Nonclassical NLSs usually bind directly to importin ß or other importins without the use of adaptors (8).

Nuclear import of viral genomes commonly appears to be driven by NLS-containing proteins bound to the nucleic acids (9, 15). The strong DNA binding of protein VII and the timing of its nuclear import after infection make it a good candidate for facilitating the nuclear import of the adenovirus genome (5, 16, 30, 47). Recent studies by Lee et al. (30) have shown that green fluorescent protein (GFP) fusions containing protein VII or fragments thereof accumulate in the nucleus in transfected cells. These karyophilic properties could be a consequence of passive diffusion through NPCs coupled with intranuclear binding and/or of receptor-dependent translocation through NPCs. Here, we show that protein VII is transported into the nucleus by specific receptor-mediated mechanisms. We found that protein VII contains multiple separate regions that can specify nuclear import, and we determined that these bind to several of the most abundant import receptors in cells. We also show that the recombinant receptors can reconstitute the nuclear import of protein pVII (see Results) in vitro in digitonin-permeabilized cells. Receptor-mediated import of protein VII is likely to be important for the nuclear accumulation of this protein during late stages of virus replication. Based on our findings and close coupling between protein VII and adenovirus DNA import, we speculate that protein VII is the predominant adaptor that connects the viral genome to the cellular import machinery. The ability of protein VII to access multiple major import pathways could provide functional redundancy that increases the efficiency of adenovirus genome import.


arrow
MATERIALS AND METHODS
 
DNA cloning and sequencing. All sequences for the expression vectors of protein pVII and fragments thereof were amplified from the pAdEasy vector (19) using the GC-rich PCR amplification kit (Roche) and fully sequenced using sequencing conditions optimized for GC-rich templates. For the analysis of nuclear transport signals, the full coding sequence of protein pVII was amplified with the 5' primer (CCGGTACCGCATGTCCATCCTTATATCGCCC), introducing a KpnI site (underlined), and the 3' primer (CCGGATCCTAGTTGCGCGGGGGGCGGGTGC), introducing a BamHI site (underlined) and a stop codon. The PCR product was cloned as a KpnI-BamHI fragment downstream of the GFP-chicken muscle pyruvate kinase (PK) open reading frame (ORF) in the vector pEGFP-PK (45). Subsequent constructs, depicted in Fig. 1A, were cloned via the same KpnI-BamHI strategy using each combination of three additional 5' primers (CCGGTACCGCGACGCGGCCATTCAGACCGTGG, CCGGTACCGCACTGCCGCCCAACGCGCGGCGG, and CCGGTACCGCAGGCGACGAGCGGCCGCCGCAGC) and 3' primers (CCGGATCCTACATAGCACTAATGGCCGCGGCTGCTGC, CCGGATCCTAGCCGGGTCGGCGGCGGTGGCG, and CCGGATCCTACACTGTGGACACTGGTGGCGG). The primers were designed to amplify regions of the protein VII ORF that were predicted to form discrete, uninterrupted regions of secondary structure (Fig. 1A). Introduction of point mutations into different regions of the protein VII ORF was performed using in vitro mutagenesis according to the manufacturer's instructions (Stratagene), with the exception of mutations in D3, which were introduced by PCR and subsequent cloning. The introduced mutations are depicted in Fig. 2A, and cloning details will be provided upon request. The expression of proteins in transfected cells was confirmed by immunofluorescence microscopy and Western blotting.


Figure 1
View larger version (21K):
[in this window]
[in a new window]
  		FIG. 1. Nuclear transport activities of different fragments of protein pVII fused to GFP-PK. (A) Schematic representation of the fragments from protein pVII that were fused to GFP-PK and analyzed by transfection. Each fragment is identified by the amino acid numbering of the human Ad type 5 wild-type protein pVII sequence (left). The subcellular localization of each fragment is indicated (right), where "nuc." stands for predominantly nuclear localization and "cyt." for predominantly cytoplasmic localization. Nuclear-localized fragments are represented in dark gray, and cytoplasmically localized fragments are depicted in light gray. (B) Examples of Cos-7 cells following transfection with vectors expressing GFP-PK fused to full-length pVII (amino acids 1 to 198) (a), to the N-terminal part of protein pVII (amino acids 1 to 81) (b), or to the C-terminal part of protein pVII (amino acids 82 to 198) (c).


Figure 2
View larger version (19K):
[in this window]
[in a new window]
  		FIG. 2. Mutational analysis of protein pVII domains encoding putative nuclear localization signals. (A) The wild-type (wt) amino acid sequences of the three domains of protein pVII with karyophilic properties are given in capital letters (wt-VII-D1 to -D3). Putative NLSs are boxed. The sequence of each mutated domain (mut-VII-D1 to -D3) is given in lowercase letters. (B) Fluorescence micrographs of transfected cells expressing GFP-PK fused to each of the three protein pVII NLS domain fragments containing the wt sequences (a to c) or the mutant (mut) sequences (d to f) as indicated.

Glutathione S-transferase (GST) expression vectors were based on pGEX-KG (18). The protein VII ORF and fragments thereof were amplified and cloned in frame to the C terminus of GST. For GST-pVII, the region encoding amino acids 1 to 198 was amplified. For the individual domains harboring NLS function, the regions encoding amino acids 82 to 114 (GST-VII-D1), amino acids 115 to 169 (GST-VII-D2), and amino acids 155 to 198 (GST-VII-D3) were amplified. All GST constructs were verified by sequencing.

Cell culture and transfection. Cos-7 cells, NRK cells, and U2OS cells were maintained in complete Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. For transfection assays, 2 x 105 cells were seeded into each well of six-well dishes the day prior to transfection. The medium was replaced by serum-reduced Opti-MEM (Gibco) 1 h prior to transfection. Four micrograms of DNA was suspended in 1 ml of Opti-MEM, and 5 µl of Targetfect F2 reagent (Targetsys) was added. The solution was mixed and incubated for 10 min at room temperature (RT) before being added to a well of the six-well plates. Three hours after transfection, the medium was replaced with fresh Dulbecco's medium. Subcellular localization was analyzed 24 h after transfection by detecting the GFP signal in a fluorescence microscope (see below).

In vitro nuclear import assays. The transport substrate fluorescein isothiocyanate (FITC)-labeled bovine serum albumin (BSA)-NLS (simian virus 40 large T antigen NLS) was prepared as described previously by Melchior et al. (35). Histone H1 (Upstate) was labeled with FITC (Molecular Probes) using the same procedure. Two milligrams of histone H1 was diluted in 1 ml of coupling buffer (130 mM NaHCO3, pH 7) and mixed with FITC dissolved in dimethylformamide. Following a 1-h reaction at room temperature, the free FITC was removed by gel filtration on a PD-10 column (Amersham Biosciences) equilibrated in phosphate-buffered saline (PBS). The in vitro import reactions were performed using NRK cells. Cells were plated on 10-well slides (ICN Biomedicals) the day before the experiment to yield ~80% confluence at the time of the transport assay. Immediately prior to the assay, the cells were washed with transport buffer (TPB) (20 mM HEPES, pH 7.4, 110 mM potassium acetate, 2 mM magnesium acetate, 2 mM dithiothreitol, 1 mM EGTA, and 1 µg/ml of aprotinin, leupeptin, and pepstatin) (1) and permeabilized by incubation with 0.005% digitonin (Calbiochem) in transport buffer for 5 min at room temperature. The digitonin was washed away by three rinses in TPB. The cells were preincubated either with TPB alone (to deplete endogenous transport factors) or with 0.8 mg/ml wheat germ agglutinin (WGA) in TPB (to block the NPC) for 15 min at 30°C in a humidified chamber or on ice. The cells were rinsed again with transport buffer, and 50 µl of import reaction mixture was added to each well. The slides were then incubated for 30 min in a humidified chamber at 30°C or 0°C. The import reaction mixture contained either cytosol (prepared as described previously [25]) or recombinant import factors (1 µM NTF2 and 2 µM Ran for all cargoes, except for 3 µM Ran with FITC-labeled histone H1 and import receptors), together with the import cargo, an ATP-regenerating system (1 mM ATP, 1 mg/ml creatine phosphate, 15 U/ml creatine phosphate kinase), and 0.1 mM GTP. The concentration of cytosol and receptors used was optimized for each cargo (see the figure legends). Following the import reaction, the cells were fixed and processed for cargo detection as described below.

Immunofluorescence microscopy and microinjection assays. For detection of GST fusion proteins, Cos-7 or U2OS cells that had been grown on coverslips were rinsed with PBS, fixed for 10 min in PBS containing 4% paraformaldehyde, and preblocked and permeabilized for 10 min with 0.1% Triton X-100 in PBS containing 10% fetal calf serum. Detection of the GST tag was performed by incubation of the cells for 1 h at RT with a purified goat anti-GST antibody (Amersham) at a dilution of 1:100 in PBS containing 10% fetal calf serum, followed by a second incubation for 1 h at RT with FITC-labeled mouse anti-goat antibody (Jackson Immunoresearch) used at a dilution of 1:50 in the same solution. For the detection of GFP fluorescence or Cy3-labeled protein preparations, transfected or microinjected cells were fixed in 4% paraformaldehyde in PBS for 10 min at RT. For the detection of GST cargoes following in vitro import assays, the cells were rinsed five times with TPB and fixed with 3.7% formaldehyde in PBS for 10 min at RT or 20 min on ice for the 0°C control reactions. The fixed cells were treated with 0.2% Triton in PBS for 10 min at RT, and detection of GST-cargo substrate was achieved by incubation of the cells for 1 h at RT with purified goat anti-GST antibody diluted 1:100 in PBS with 0.3% gelatin, followed by a second incubation for 45 min at RT with FITC-labeled mouse anti-goat antibody (Pierce) diluted 1:100 in PBS with 0.3% gelatin. Nuclei were stained with Topro-3 (Molecular Probes) diluted 1:500 in PBS with 0.3% gelatin for 20 min at RT. The slides were mounted using SlowFade (Molecular Probes). The cells were examined using a Bio-Rad 1024 laser scanning confocal microscope, and images were collected with Bio-Rad Lasersharp 2000 software. Each experiment was repeated at least three times.

For microinjection experiments, purified Cy3-labeled GST-pVII or unlabeled GST-VII-D1, GST-VII-D2, and GST-VII-D3 were injected into the cytoplasm of subconfluent U2OS cells at concentrations between 0.1 and 0.25 mg/ml in TPB, together with Cy5-labeled immunoglobulin G or Texas red-labeled BSA as an injection marker. After injection, the cells were incubated for 30 min at 37°C and were fixed and labeled for immunofluorescence (as described above) or directly analyzed. Each microinjection experiment included an average of 10 to 15 cells and was repeated at least two times.

Cytosol and recombinant-protein isolation. Cytosol was isolated by digitonin lysis of HeLa cells as previously described by Kehlenbach et al. (25), dialyzed into transport buffer, snap frozen at a concentration of 10 mg/ml, and stored at –80°C. For pull-down assays, the cytosol was pretreated with Benzonase to eliminate nucleic acids. GST fusion proteins were expressed in the Escherichia coli strain BL21. Cells were grown to an optical density at 600 nm (OD600) of 0.6 at 37°C and induced with 100 µM isopropyl-ß-D-thiogalactopyranoside (IPTG). Induction was continued for 3 h at 37°C, followed by cell disruption through sonication in the presence of 10 mg/ml RNase and protease inhibitors. Purification was performed using glutathione-Sepharose according to the manufacturer's protocol (Amersham Biosciences). GST-proteins were dialyzed against transport buffer containing 10% glycerol, aliquoted, snap frozen in liquid N2, and stored at –80°C. For obtaining GST-pVII for in vitro import reactions, the expression and purification protocol was modified as follows. GST-pVII was expressed in the E. coli strain BL21(DE3) Codon Plus RP (Stratagene). Bacteria were grown at 37°C to an OD600 of 0.6, and induction was carried out for 24 h at 30°C by the addition of 100 µM IPTG. Cells were collected in lysis buffer (50 mM Tris, pH 8, 150 mM NaCl, 2 mM MgCl2, 1 mM CaCl2, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, and 1 µg/ml [each]of aprotinin, leupeptin, and pepstatin) and disrupted by three alternating freeze-thaw cycles. The lysate was cleared by centrifugation in a Beckman Ti45 rotor (100,000 x g for 30 min at 4°C), and nucleic acids were removed by the addition of 10 U of micrococcal nuclease for 30 min at 37°C. The enzyme was inactivated by the addition of 50 mM EDTA. GST-protein pVII was purified by incubation of the supernatant with glutathione beads (Amersham Biosciences) for 2 h at 4°C. The beads were washed several times with lysis buffer and in descending order with high-salt buffer (PBS containing 3 M NaCl); PBS containing 0.5 M NaCl and 0.1 M sodium acetate buffer, pH 4.5; PBS with 0.5% Triton X-100; and finally with 50 mM Tris-HCl, pH 8. The proteins were eluted from the beads in elution buffer (50 mM Tris-HCl, pH 8, 50 mM reduced glutathione) containing phenylmethylsulfonyl fluoride, aprotinin, leupeptin, and pepstatin. Eluted proteins were dialyzed against transport buffer and stored as described above.

For Cy3 labeling, the buffer of the GST-protein was exchanged for 100 mM sodium carbonate buffer, pH 8.3, using a PD-10 column, and the labeling reaction was performed according to the manufacturer's protocol (Amersham Biosciences). Expression and purification of the recombinant transport factors importin {alpha}, importin ß, transportin, NTF2, Ran and RanQ69L, and GST-M9 were done as described by Lyman et al. (31) and in references therein. Recombinant importin 7 with an N-terminal His tag (kindly provided by D. Gorlich, Heidelberg, Germany) was expressed in the E. coli strain M15. The bacteria were grown to an OD600 of 0.6, induced with 1 mM IPTG for 5 h at 20°C, and purified using Ni affinity chromatography according to the manufacturer's protocol (QIAGEN). All purified proteins were dialyzed against transport buffer containing 10% glycerol, snap frozen in liquid nitrogen, and stored at –80°C.

GST pull-down assays and Western blotting. For GST pull-down assays, 20 µl glutathione beads was loaded to saturation with GST or GST fusion proteins in transport buffer containing 0.1% BSA. The loaded beads were incubated for 2 h at 4°C with 500 µl of Benzonase-treated cytosol diluted to 2 mg/ml in transport buffer or 5 µg of recombinant transport receptor in transport buffer, all in the presence of protease inhibitors. Following the initial incubation, the beads were collected and washed with TPB, and the sample was further divided in half and 200 µl of 5 µM RanQ69L preloaded with GTP (24) or control reaction mixtures omitting RanQ69L were added for a further incubation of 15 min at RT. The beads were collected by centrifugation and washed with TPB. Bound material was analyzed by Western blotting with antibodies to specific import receptors.

Materials from pull-down assays were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on 12.5% gels, followed by immunoblot detection of proteins transferred to nitrocellulose membranes. The following primary antibodies for the detection of transport receptors were used: affinity-purified rabbit anti-importin {alpha} at a dilution of 1:1,000, affinity-purified rabbit anti-importin ß at a dilution of 1:2,000, monoclonal mouse anti-transportin antibodies (Transduction Laboratories) at a dilution of 1:100, and a rabbit polyclonal anti-importin 7 antibody at a dilution of 1:500 (kindly provided by D. Gorlich). All primary antibodies were detected with horseradish peroxidase-conjugated secondary antibodies directed against rabbit or mouse (Pierce) at a dilution of 1:5,000. Detection of the signal was performed using an enhanced-chemiluminescence detection system.


arrow
RESULTS
 
Adenoviral protein VII mediates efficient nuclear localization. By analogy with other viruses, nuclear transport of the adenoviral genome is likely to be due to an interaction of the genomic DNA with cellular import receptors (9, 15). The abundance and strong DNA association of adenovirus protein VII suggest that it could serve as an adaptor to connect the adenovirus genome to the nuclear import machinery. To gain insight into this possibility, we investigated whether protein VII contains NLSs that specify receptor-mediated import.

An expression vector was generated in which the unprocessed precursor of protein VII (termed protein pVII) was fused to the C terminus of a GFP-PK fusion protein. GFP-PK (>90 kDa) is a fluorescent reporter that exceeds the passive-diffusion limit for the NPC and is restricted to the cytoplasm when expressed in cultured cells. However, it becomes localized to the nucleus when NLSs are fused to it (45). We transfected a series of plasmids encoding various regions of the GFP-PK-pVII molecule (Fig. 1A) into Cos-7 cells and analyzed the subcellular localization of the fusion protein 24 h later by detection of the GFP signal. The fusion protein containing the full pVII molecule was entirely nuclear (Fig. 1B, image a), consistent with the presence of one or more NLSs.

Protein pVII is predicted to contain two helix-loop-helix domains flanked by extended beta-sheets at both termini, as determined by the secondary-structure prediction software GOR IV (reference 11 and data not shown). Based on this prediction, subfragments of protein pVII that could potentially form uninterrupted secondary-structure segments were generated and fused in frame to the C terminus of GFP-PK. The constructs were transfected into Cos-7 cells, and their subcellular localization was analyzed 24 h later.

Initially, segments were deleted from the C terminus of protein pVII to generate constructs containing amino acids 1 to 169, 1 to 114, and 1 to 81 (Fig. 1A). Whereas the fusion protein containing full-length pVII was localized to the nucleus, a construct containing amino acids 1 to 81 of pVII fused to GFP-PK showed a predominantly cytoplasmic localization (Fig. 1B, image b), suggesting that amino acids 1 to 81 do not contribute significantly to nuclear localization. In contrast, constructs that extended the C terminus to amino acid 114 or 169 resulted in nuclear localization of the fusion proteins, similar to that obtained with the full-length protein (Fig. 1B and data not shown). This suggests that C-terminal segments are involved in the nuclear localization of pVII.

We then examined constructs with deletions from the N terminus and N/C termini of pVII. A construct encoding amino acids 82 to 198 was localized entirely to the nucleus (Fig. 1B, image c), indicating that the C-terminal half of pVII is sufficient for nuclear translocation. The segment encoding amino acids 82 to 198 of protein pVII was subdivided into various fragments, and each construct was tested for nuclear localization following transient transfection into Cos-7 cells. As summarized in Fig. 1A, all fragments except amino acids 155 to 169 led to nuclear accumulation of the GFP-PK fusion protein. In the case of GFP-PK-VII-155-169, the GFP signal was almost exclusively cytoplasmic, similar to the signal obtained with the control vector pGFP-PK (data not shown). In summary, this analysis identified three individual fragments of protein pVII, amino acids 82 to 114, 115 to 155, and 169 to 198, with karyophilic properties.

Protein VII contains three separable NLSs. We searched the protein pVII fragments with NLS activity for the presence of sequences that resembled classical NLSs. As illustrated in Fig. 2A, we identified a motif, 99KRRRRR104, that resembled a monopartite classical NLS in the fragment of pVII comprising residues 82 to 114, which we termed "VII-D1" (for "domain" 1) (32). Nonetheless, the classical NLS-like sequence in VII-D1 is flanked by a substantial number of additional basic amino acid residues. In fragment VII-115-169, which was termed "VII-D2," we identified two overlapping potential bipartite NLSs in the segment 127RARR130-X10-141RR142-X10-153RSRRR157, both involving the central RR flanked on each side by 10 residues, followed by additional short amino acid stretches enriched in basic residues (32). Similar to VII-D1, VII-D2 contains additional basic amino acids besides those within these classical motifs. In fragment VII-155-198, which was termed "VII-D3," a stretch rich in basic residues and prolines (188RVPVRTRPPRN198) and which does not strictly resemble classical NLSs was identified.

To test whether these sequences serve as NLSs, we introduced point mutations that replaced basic amino acid residues with uncharged residues in the GFP-PK expression vectors containing the three domains (summarized in Fig. 2A). To this end, we replaced three lysines in VII-D1 with alanines (italic and underlined) (mutant sequence, 99KARARA104), generating GFP-PK-mutVII-D1, and in VII-D2, we replaced four lysines with alanines (mutant sequence, 127RAAR130-X10-141AR142-X10-153RSRAA157), generating plasmid GFP-PK-mutVII-D2. To generate plasmid GFP-PK-mutVII-D3, we changed arginines in the C-terminal sequence to serines or threonines (instead of alanines) to preserve the predicted beta-strand structure (mutant sequence, 188RVTVSTSPPSN198).

All three mutated constructs and the wild-type control vectors were transfected into Cos-7 cells, and subcellular localization of the fusion proteins was determined by monitoring the GFP signal. As shown in Fig. 2B, all of the control vectors gave strong nuclear localization (Fig. 2B, a to c). In sharp contrast, fusion proteins expressed from each of the constructs expressing a mutated NLS domain failed to accumulate in the nucleus and displayed a predominantly cytoplasmic localization (Fig. 2B, d to f). This provides evidence that the three potential NLS sequences that we identified in pVII indeed contribute to NLS function. However, when we introduced all of the separate mutations into full-length protein pVII and expressed the protein by transfection, we still observed significant nuclear accumulation of the mutant fusion construct, although partial cytoplasmic staining also was observed (see Fig. S1 in the supplemental material). This partial nuclear localization was lost when we deleted amino acids 174 to 198 of the mutated fusion protein (see Fig. S1 in the supplemental material). This suggests that some NLS functionality is lost when pVII is separated into the three individual "domains."

Cultured cell microinjection studies with recombinant GST fusion proteins were carried out as an independent method of examining the NLS activity in pVII. Since the cells were imaged shortly after microinjection (in contrast to the 24-h time points used in transfected cells), this approach also provided a measure of the kinetic efficiency of the NLSs. GST by itself does not enter the nucleus after it is injected into the cytoplasm, since it forms a dimer that is too large to passively diffuse into the nucleus and does not contain NLS activity. We expressed and purified recombinant GST fusion proteins containing full-length protein pVII, as well as domains VII-D1, VII-D2, and VII-D3 (termed GST-pVII, GST-VII-D1, GST-VII-D2, and GST-VII-D3) (Fig. 3). Each of these proteins, or unfused GST, was injected into the cytoplasm of cultured Cos-7 cells, together with a fluorescent marker protein. Examples of microinjected cells are shown in Fig. 3. A strong nuclear localization was obtained for full-length GST-protein pVII and GST-VII-D1, -D2, and D3 (Fig. 3, a to d), whereas the unfused GST control (data not shown) and the injection marker (Fig. 3, e to h) remained cytoplasmic. These experiments clearly validated the NLS function of pVII and its individual domains that we identified in the transfection assays and emphasized that they are each capable of acting independently of one another.


Figure 3
View larger version (50K):
[in this window]
[in a new window]
  		FIG. 3. Subcellular localization of recombinant GST fusions containing protein pVII and pVII domains following microinjection into Cos-7 cells. Purified recombinant GST fusion proteins containing full-length protein pVII, as well as domains VII-D1, VII-D2, and VII-D3 (termed GST-pVII, GST-VII-D1, GST-VII-D2, and GST-VII-D3), were injected into the cytoplasm of cultured Cos-7 cells, together with a fluorescent marker protein. Subcellular localization was determined following 30 min of incubation at 37°C by direct fluorescence analysis of Cy3-labeled GST-pVII (a) or by indirect immunofluorescence with an anti-GST antibody (b to d). The injection control markers for the experiments are shown in panels e to h.

Protein VII forms a Ran-sensitive complex with import receptors. Next, experiments were carried out to identify cellular import receptors that bind to the pVII-NLSs revealed in the functional studies. Initially, we performed pull-down assays using cytosolic extracts as sources of transport receptors. The receptors bound to immobilized pVII were analyzed by Western blotting, using antibodies against importin {alpha}, importin ß, importin 7, and transportin. As a specificity control, we examined the sensitivity of binding to RanQ69L (a Ran mutant deficient in GTP hydrolysis) loaded with GTP, which dissociates cargoes from importin ß-related import receptors. As shown in Fig. 4, none of the receptors bound to unfused GST, despite their abundant presence in the cytosol (Fig. 4, lanes 1 and 2, and data not shown). In contrast, we found that importin {alpha} bound to GST-protein pVII and that most of it remained bound in the presence of RanQ69L-GTP, consistent with previous studies showing that Ran does not bind to importin {alpha} (32). Importin ß and importin 7 also bound to GST-pVII, but in contrast to importin {alpha}, the binding was strongly Ran-GTP sensitive (Fig. 4, lanes 3 and 4). This Ran sensitivity is consistent with previous work and indicates that the pVII binding in our experiment was specific (32). Transportin binding could not be detected in this experiment under these conditions, in contrast to our results with recombinant receptors (see below).


Figure 4
View larger version (68K):
[in this window]
[in a new window]
  		FIG. 4. Cytosolic transport receptors bind to protein pVII. GST fusion proteins were expressed and purified from bacteria and coupled to glutathione beads. Bead-bound unfused GST (lanes 1 and 2) and GST-protein pVII (lanes 3 and 4) were incubated with purified cytosol from HeLa cells. Half of the bound material was further incubated with RanQ69L (lanes 2 and 4) or buffer alone (lanes 1 and 3), and the total bound material was separated by SDS-PAGE and analyzed by Western blotting with antibodies against importin {alpha} (row 1 [from top]), importin ß (row 2), importin 7 (row 3), and transportin (row 4). The antibodies used for detection of transport receptors are indicated on the right.

To investigate whether the interactions between protein pVII and the import receptors were direct, we performed pull-down assays using column-immobilized GST-protein pVII, together with purified recombinant import receptors, including importin {alpha}, importin ß, importin 7, and transportin. As controls, we analyzed receptor binding to a GST fusion protein containing a cNLS, which directs importin {alpha}/ß-dependent import, and a GST fusion containing the M9 domain of hnRNP A1 (M9-NLS), which directs transportin-mediated import (4, 39). GST beads were loaded to saturation with GST fusion proteins. Following incubation with recombinant import receptors, half of the beads were further incubated with RanQ69L-GTP and the other half with buffer only. The bound material was then analyzed by Western blotting. As shown in Fig. 5, the control cNLS preferentially bound importins {alpha} and ß and the M9-NLS selectively bound transportin. The binding of importin ß and transportin was Ran sensitive (Fig. 5, compare lanes 3 and 4, top two rows, and lanes 5 and 6, bottom row), indicating that it is specific, considering the allosteric change induced in karyopherins by Ran-GTP binding (29). In contrast to the control NLS fusions, GST-protein pVII bound significant amounts of all of the transport receptors tested, including transportin (Fig. 5, lanes 1 and 2). GST-pVII directly bound importin 7 (row 6) and importin ß (row 3) by themselves, although the binding was increased for the importin {alpha}/ß heterodimer (rows 1 and 2) and the importin 7/ß heterodimer (rows 4 and 5). The binding of the receptors was sensitive to RanQ69L-GTP in most cases. In the sample containing importins {alpha}/ß, the decreased binding of importin {alpha} to GST-pVII in the presence of Ran-GTP, compared to the control GST-cNLS, may reflect a weaker affinity of the pVII NLS(s). In this case, when the autoinhibitory importin-ß-binding (IBB) domain of importin {alpha} is released from importin ß by Ran, the free IBB domain in turn may displace pVII from importin {alpha} (28). When we analyzed GST fusion proteins containing the individual domains of pVII, i.e., GST-VII-D1, GST-VII-D2, and GST-VII-D3, we also detected Ran-sensitive binding of multiple transport receptors to each domain. D1 and D3 showed the promiscuous receptor binding patterns seen for pVII, whereas D2 showed preferential binding to the importin {alpha}/ß and importin 7/ß heterodimers (see Fig. S2, top, in the supplemental material). Thus, none of the individual NLS segments of protein VII appear to have a strong preference for any single receptor, although D1 and D3 have the broadest receptor binding. The apparently greater binding of transportin to GST-D1 as opposed to the other GST constructs could be the result of a more accessible D1 NLS(s) when it is presented as a separate domain or to the greater intactness of the purified GST-D1 (compared to GST-D2 and full-length GST-pVII). Unfortunately, despite the folding prediction underlying the design of segments D1 to D3, the actual folding cannot be verified. Finally, we examined whether importin ß and transportin competed for the same binding sites on GST-pVII (see Fig. S2, bottom panel, in the supplemental material). We found that a fivefold molar excess of importin ß completely blocked transportin binding and that a fivefold excess of transportin partially blocked importin ß binding. This suggests that the two receptors bind to the same or overlapping sites on full-length pVII, although importin ß may bind to this NLS(s) with higher affinity. Thus, the choice of receptor utilization in the nuclear import of pVII in vivo might be dictated by receptor abundance, as well as by its affinity for pVII.


Figure 5
View larger version (29K):
[in this window]
[in a new window]
  		FIG. 5. Multiple recombinant import receptors bind to GST-protein pVII. Bacterially expressed and purified GST-pVII (lanes 1 and 2), GST-cNLS (lanes 3 and 4), and GST-M9-NLS (lanes 5 and 6) were bound to glutathione beads and incubated with recombinant transport factors as indicated on the left: importin {alpha}/ß (rows 1 and 2 [from top]), importin ß alone (row 3), importin ß and importin 7 (rows 4 and 5), importin 7 alone (row 6), and transportin (row 7). Half of the bound material was further incubated with RanQ69L (lanes 2, 4, and 6) or buffer alone (lanes 1, 3, and 5). The bound proteins were separated by SDS-PAGE and detected by Western blotting using antibodies against specific transport receptors, as indicated to the right of each row.

Protein VII accesses multiple karyopherin-dependent nuclear transport pathways. To investigate if the binding of protein VII to multiple transport receptors observed in the GST pull-down assays is functionally significant, we employed in vitro nuclear import assays involving digitonin-permeabilized NRK cells. The recombinant protein GST-pVII preparation used in these experiments contained a relatively minor amount of full-length GST-pVII protein. The major component of the preparation was a degraded fragment of GST-pVII containing domain D1 but lacking the pVII C terminus, inferred from molecular weight estimation from SDS-PAGE (data not shown). Since the import receptor binding specificity of domain D1 is essentially identical to that of full-length pVII (see Fig. S2, top panel, in the supplemental material), it is likely that the import properties of the GST-pVII fragment are similar to those of GST-pVII.

First, we analyzed nuclear import in permeabilized cells supplemented with cytosol as a source of receptors and other shuttling transport factors. In the presence of cytosol, both GST-pVII and BSA-NLS, a control cargo containing a classical importin {alpha}/ß-dependent NLS, accumulated in the nucleus (Fig. 6). Neither cargo was imported into the nucleus in the absence of cytosol. Nuclear accumulation of both cargoes was inhibited by the addition of WGA, a lectin that inhibits receptor-mediated protein nuclear import by interaction with nucleoporins containing FG repeat motifs (26). The nuclear import of BSA-NLS and GST-pVII also was temperature dependent, and thus, no accumulation of fluorescent cargo in the nucleus was detected at 0°C. These data are consistent with the nuclear import of GST-pVII in vivo by receptor-mediated mechanisms involving the NPC.


Figure 6
View larger version (79K):
[in this window]
[in a new window]
  		FIG. 6. Nuclear import of GST-pVII in digitonin-permeabilized NRK cells is dependent on cytosol. (Top rows) Nuclear import with 2 µM FITC-labeled BSA-NLS. Shown are samples incubated without cytosol (– Cyt), in the presence of 4 µg/µl cytosol (+ Cyt), or with 4 µg/µl cytosol and WGA (+ Cyt +WGA) or incubated with 4 µg/µl cytosol on ice instead of at 30°C (+ Cyt [0°C]). (Bottom rows) Nuclear import with 350 nM GST-pVII as above, except the concentration of cytosol used was 5 µg/µl. GST-pVII was detected with an anti-GST antibody. DNA staining with Topro-3 is shown for each condition. Note that the DNA staining was imaged with different exposure times and therefore shows different intensities.

To identify the transport receptors involved in the nuclear import of pVII in vivo, we analyzed import in the permeabilized cells reconstituted with recombinant transport factors (Fig. 7), consisting of Ran, the Ran import receptor NTF2, and the receptors used previously for the GST pull-down assays (Fig. 5). The import activity of each receptor was validated using positive-control cargoes that are substrates for each receptor pathway (see Fig. S3 in the supplemental material). Nuclear accumulation of GST-pVII was not observed in the presence of an energy-regenerating system with Ran and NTF2 alone (Fig. 7, left), whereas nuclear accumulation of GST-pVII was seen only after the addition of receptors to reactions containing energy, Ran, and NTF2 (Fig. 7, middle). Significant nuclear accumulation of GST-pVII was obtained with each of the following receptors: a mixture of importin {alpha} and importin ß, importin ß alone, importin 7 alone, a mixture of importin 7 and importin ß, and transportin alone. The nuclear accumulation of GST-pVII in the presence of the different receptors was inhibited by WGA (Fig. 7, right), indicating that it is mediated by NPCs, similar to import seen in reactions containing cytosol. These data are in agreement with the in vitro binding experiments showing that recombinant pVII interacts specifically with importin {alpha}/ß, importin ß, importin 7, importin 7/ß, and transportin, and they suggest that these receptors can support protein VII import in vivo.


Figure 7
View larger version (85K):
[in this window]
[in a new window]
  		FIG. 7. Nuclear import of GST-pVII is mediated by multiple transport receptors in digitonin-permeabilized NRK cells. The nuclear import assay was performed with reaction mixtures reconstituted with recombinant transport factors and 350 nM GST-pVII. Shown are samples incubated without recombinant receptor (– Receptor), in the presence of the recombinant receptor indicated (+ Receptor), or in the presence of receptor and WGA (+Receptor +WGA). The receptors are indicated to the left of each row. Detection of GST-pVII was done by indirect immunofluorescence assay using an antibody against GST. The following receptor concentrations were used: importin {alpha}/ß, 1 µM importin {alpha} and 2 µM importin ß; importin ß, 2 µM; importin 7, 2 µM; importin 7/ß, 2 µM importin ß and 2 µM importin 7; transportin, 50 nM.


arrow
DISCUSSION
 
Many viruses make use of the cell nucleus to replicate their genomes and to produce progeny virions. Viruses have evolved a number of different strategies to transport their genomes across the nuclear envelope after infection. In the case of small viruses (e.g., hepatitis B virus), this occurs by nuclear import of largely intact nucleocapsids, which are sufficiently small to cross the NPC by receptor-mediated mechanisms (40). In contrast, the genomes of larger viruses, like adenovirus or herpesvirus, can be imported only after the viral nucleocapsid docks and undergoes further disassembly at the NPC to release the genome (9, 15, 46). In both situations, NLSs bearing adaptor proteins can be predicted to act as bridging factors between the viral nucleic acid and the karyopherin-requiring cellular transport machinery (9, 15). These adaptors may derive from the virus (e.g., the capsid protein of hepatitis B virus) or the host cell (e.g., histones involved in packaging parvovirus DNA).

In this study, we have characterized the ability of the adenoviral core protein pVII, which has a well-recognized role in DNA packaging, to serve as a transport adaptor. Our analysis has identified three independent regions in the C-terminal half of protein pVII with NLS activity: amino acids 82 to 114 (VII-D1), amino acids 115 to 169 (VII-D2), and the C terminus itself, comprising amino acids 155 to 198 (VII-D3). Our analysis extends previous observations by Lee et al. (30), who found that multiple regions of pVII cause nuclear localization of GFP in transfected cells. Although they found karyophilic activity in the N-terminal half of pVII, we did not observe NLS function within this region. This discrepancy probably is due to differences in the experimental approaches used. Lee et al. analyzed GFP-pVII fusion proteins, which do not exceed the ~40-kDa diffusion limit of the NPC and therefore can accumulate in the nucleus by passive diffusion through the NPC combined with binding to intranuclear structures. In contrast, our fusion partner (GFP-PK; >90 kDa) exceeds the NPC diffusion limit and therefore requires receptor-mediated mechanisms for nuclear accumulation (45).

To characterize the receptor pathways for mediated import of protein pVII, we carried out in vitro assays to analyze whether pVII directly binds importins and to determine whether it is imported into the nuclei of permeabilized cells in an importin-dependent manner. We found specific binding of recombinant GST fusions containing either full-length pVII or of each individual NLS region of protein pVII to multiple importins, including the importin {alpha}/ß heterodimer, importin ß alone, importin 7 alone, the importin ß/7 heterodimer, and transportin.

The constructs containing VII-D1 and VII-D2 contain sequences resembling classical monopartite and bipartite NLSs that are recognized by importin {alpha}/ß, although these classical motifs are embedded in larger basic-amino-acid-rich sequences. Since mutational substitution of basic residues in the classical motifs abolishes the NLS activities of these regions in vivo, and since we found that that these protein VII fragments access multiple import receptors besides importin {alpha}/ß, it seems likely that the "classical" motifs are essential parts of larger "polybasic" NLSs recognized by the receptors other than importin {alpha}. In this respect, the binding of the protein VII NLSs to importins may be analogous to the binding of the long polybasic NLS in parathyroid hormone-related protein to importin ß, which involves interactions of many basic residues with the receptor (8). Competition assays indicated that binding of importin ß and transportin to pVII was mediated by the same or overlapping NLS regions and suggested that the abundances, as well as the affinities, of the individual receptors for these regions would be important determinants of transport in vivo. We also showed that the nuclear import of protein pVII could be reconstituted in digitonin-permeabilized cells by using either cytosol or the receptors that bound to pVII in vitro. The apparent promiscuity of protein pVII in exploiting several nuclear import pathways has been observed for several other transport cargoes (3, 14, 21, 37). Some of these cargoes are highly basic and are capable of nucleic acid binding and, like pVII, appear to use the same NLS region for more than one import receptor (21, 37). In fact highly basic proteins with nucleic acid binding capabilities (e.g., ribosomal proteins, transcription factors, and histones) constitute a significant proportion of the cellular protein pool. These proteins often contain larger basic regions, with dispersed basic residues involved in nucleic acid binding that do not match the consensus sequence of classical NLS. Shielding of these exposed basic patches by several different importins has been suggested to play a major role in keeping these proteins soluble and/or driving their nuclear import (22). Thus, the ability of pVII to use several import receptors could reflect a similar adaptation that could not only aid in the nuclear transport of the viral genome, but also help to keep it soluble once the capsid has disintegrated. In addition to having a predicted role in adenovirus DNA import following virus infection (see below), the NLS activity of protein VII is likely to be important for the nuclear accumulation of pVII during the late stages of viral replication. Our binding studies suggest that pVII will rapidly associate with karyopherins after synthesis in the cytoplasm, which could also act to chaperone the highly basic protein (22), as well as to specify nuclear import.

PVII may not be imported as a monomer but may assemble into a larger homo-oligomer, as found in adenovirus chromatin (36), prior to its nuclear import. The fact that full-length pVII is still partially active in nuclear transport even when it contains the combination of mutations that abolish NLS function in the three individual regions (see Fig. S1 in the supplemental material) could suggest that NLS function can be reconstituted by the remaining unmutated basic residues present in either a pVII monomer or oligomer. Many small cellular proteins (e.g., histones) (38) use receptor-mediated pathways for their import, presumably in part because mediated import is far more rapid than diffusion (41).

Trotman and coworkers have proposed that in the case of human serotype 2 adenovirus, uncoating of the nucleocapsid at the NPC is mediated by the interaction of histone H1 with an acidic loop on the major capsid protein hexon (47). They showed that injection of antibodies against the import receptors importin ß and importin 7 blocked nuclear import of the viral genome and proposed that importin ß and importin 7 are involved in capsid disassembly by binding to capsid-bound histone. However, this mechanism may be restricted to adenovirus serotypes that have an acidic loop in hexon. Alternatively, and not mutually exclusively, it is possible that uncoating of all serotypes of adenovirus at the NPC involves molecular chaperones, such as hsc70, which has been implicated in adenovirus type 5 DNA import in permeabilized cells (44). In either case, once the viral nucleoprotein complex is freed from the disintegrating capsid, adenovirus DNA-bound proteins could access an abundant local pool of cellular import receptors to drive the nuclear transport of the genomic DNA. We believe that protein VII is likely to be the major adaptor for linking adenovirus DNA to the import machinery because of its abundance and tight DNA binding and its ability to access multiple import receptors, as shown in this study. The ability of protein VII to bind multiple import receptors thus could reflect an optimized mechanism to access the transport machinery, similar to what is observed for the import of highly basic cellular proteins, such as ribosomal proteins or core histones (20, 21, 37). Although protein VII is likely to play a major role in the import of the adenovirus genome, this process could also involve other proteins, including the terminal protein that is linked to each 5' end of the linear DNA, which is known to contain an NLS (53). It appears unlikely that the two copies of the terminal protein are enough to drive nuclear transport, but a contribution to initiation or directionality of the import reaction cannot be ruled out. Also, the core-associated protein V has been proposed to participate in adenovirus DNA import (33). However, protein V appears to be more weakly bound to the viral DNA than protein VII and may dissociate from the DNA early during the infection process, prior to DNA import (33).

In conclusion, our data support a model in which the tightly adenovirus DNA-bound protein VII serves as a bridging factor to mediate receptor-driven nuclear import of the adenovirus genome. Future studies, including an analysis of reconstituted DNA-protein VII complexes, will be necessary to determine whether protein VII is sufficient for import of associated DNA and whether import of the DNA-protein complexes can be achieved by multiple receptor pathways, as observed for protein VII alone.


arrow
ACKNOWLEDGMENTS
 
This work was supported by NIH grants AI55729 to L.G. and HL54352 to G.N. H.W. was supported by a fellowship from the Deutsche Forschungsgemeinschaft (WO 805/1-1) and is presently an INSERM scientist. A.C. was supported by a grant from the FRM SPE20041102385.

We thank D. Gorlich and M. P. Sherman for sharing reagents with us. We are grateful for the support that H.W. has received from Eric Kremer at the IGMM.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Institut de Génétique Moléculaire de Montpellier, UMR 5535 CNRS, 1919 Route de Mende, 34293 Montpellier Cedex 05, France. Phone: 33 4 67 61 36 74. Fax: 33 4 67 04 02 31. E-mail: harald.wodrich{at}igmm.cnrs.fr. Back

{dagger} Supplemental material for this article may be found at http://jvi.asm.org. Back

{ddagger} H.W. and A.C. contributed equally to this work. Back

§ Present address: Molecular and Cell Biology Laboratory, Salk Institute for Biological Studies, La Jolla, Calif. Back


arrow
REFERENCES
 
    1
  1. Adam, S. A., R. Sterne-Marr, and L. Gerace. 1992. Nuclear protein import using digitonin-permeabilized cells. Methods Enzymol. 219:97-110.[CrossRef][Medline]
    2. 2
  2. Anderson, C. W., M. E. Young, and S. J. Flint. 1989. Characterization of the adenovirus 2 virion protein, mu. Virology 172:506-512.[CrossRef][Medline]
    3. 3
  3. Arnold, M., A. Nath, D. Wohlwend, and R. H. Kehlenbach. 2006. Transportin is a major nuclear import receptor for c-Fos: a novel mode of cargo interaction. J. Biol. Chem. 281:5492-5499.[Abstract/Free Full Text]
    4. 4
  4. Bonifaci, N., J. Moroianu, A. Radu, and G. Blobel. 1997. Karyopherin ß2 mediates nuclear import of a mRNA binding protein. Proc. Natl. Acad. Sci. USA 94:5055-5060.[Abstract/Free Full Text]
    5. 5
  5. Brown, D. T., M. Westphal, B. T. Burlingham, U. Winterhoff, and W. Doerfler. 1975. Structure and composition of the adenovirus type 2 core. J. Virol. 16:366-387.[Abstract/Free Full Text]
    6. 6
  6. Chatterjee, P. K., M. E. Vayda, and S. J. Flint. 1986. Identification of proteins and protein domains that contact DNA within adenovirus nucleoprotein cores by ultraviolet light crosslinking of oligonucleotides 32P-labelled in vivo. J. Mol. Biol. 188:23-37.[CrossRef][Medline]
    7. 7
  7. Chatterjee, P. K., M. E. Vayda, and S. J. Flint. 1985. Interactions among the three adenovirus core proteins. J. Virol. 55:379-386.[Abstract/Free Full Text]
    8. 8
  8. Cingolani, G., J. Bednenko, M. T. Gillespie, and L. Gerace. 2002. Molecular basis for the recognition of a nonclassical nuclear localization signal by importin beta. Mol. Cell 10:1345-1353.[CrossRef][Medline]
    9. 9
  9. Cullen, B. R. 2001. Journey to the center of the cell. Cell 105:697-700.[CrossRef][Medline]
    10. 10
  10. Cusack, S. 2005. Adenovirus complex structures. Curr. Opin. Struct. Biol. 15:237-243.[CrossRef][Medline]
    11. 11
  11. Di Francesco, V., J. Garnier, and P. J. Munson. 1996. Improving protein secondary structure prediction with aligned homologous sequences. Protein Sci. 5:106-113.[Medline]
    12. 12
  12. Fabry, C. M., M. Rosa-Calatrava, J. F. Conway, C. Zubieta, S. Cusack, R. W. Ruigrok, and G. Schoehn. 2005. A quasi-atomic model of human adenovirus type 5 capsid. EMBO J. 24:1645-1654.[CrossRef][Medline]
    13. 13
  13. Fahrenkrog, B., J. Koser, and U. Aebi. 2004. The nuclear pore complex: a jack of all trades? Trends Biochem. Sci. 29:175-182.[CrossRef][Medline]
    14. 14
  14. Freedman, N. D., and K. R. Yamamoto. 2004. Importin 7 and importin alpha/importin beta are nuclear import receptors for the glucocorticoid receptor. Mol. Biol. Cell 15:2276-2286.[Abstract/Free Full Text]
    15. 15
  15. Greber, U. F., and A. Fassati. 2003. Nuclear import of viral DNA genomes. Traffic 4:136-143.[Medline]
    16. 16
  16. Greber, U. F., M. Suomalainen, R. P. Stidwill, K. Boucke, M. W. Ebersold, and A. Helenius. 1997. The role of the nuclear pore complex in adenovirus DNA entry. EMBO J. 16:5998-6007.[CrossRef][Medline]
    17. 17
  17. Greber, U. F., M. Willetts, P. Webster, and A. Helenius. 1993. Stepwise dismantling of adenovirus 2 during entry into cells. Cell 75:477-486.[CrossRef][Medline]
    18. 18
  18. Guan, K. L., and J. E. Dixon. 1991. Eukaryotic proteins expressed in Escherichia coli: an improved thrombin cleavage and purification procedure of fusion proteins with glutathione S-transferase. Anal. Biochem. 192:262-267.[CrossRef][Medline]
    19. 19
  19. He, T. C., S. Zhou, L. T. da Costa, J. Yu, K. W. Kinzler, and B. Vogelstein. 1998. A simplified system for generating recombinant adenoviruses. Proc. Natl. Acad. Sci. USA 95:2509-2514.[Abstract/Free Full Text]
    20. 20
  20. Jakel, S., W. Albig, U. Kutay, F. R. Bischoff, K. Schwamborn, D. Doenecke, and D. Gorlich. 1999. The importin beta/importin 7 heterodimer is a functional nuclear import receptor for histone H1. EMBO J. 18:2411-2423.[CrossRef][Medline]
    21. 21
  21. Jakel, S., and D. Gorlich. 1998. Importin beta, transportin, RanBP5 and RanBP7 mediate nuclear import of ribosomal proteins in mammalian cells. EMBO J. 17:4491-4502.[CrossRef][Medline]
    22. 22
  22. Jakel, S., J. M. Mingot, P. Schwarzmaier, E. Hartmann, and D. Gorlich. 2002. Importins fulfil a dual function as nuclear import receptors and cytoplasmic chaperones for exposed basic domains. EMBO J. 21:377-386.[CrossRef][Medline]
    23. 23
  23. Jiang, W., J. Chang, J. Jakana, P. Weigele, J. King, and W. Chiu. 2006. Structure of {varepsilon}15 bacteriophage reveals genome organization and DNA packaging/injection apparatus. Nature 439:612-616.[CrossRef][Medline]
    24. 24
  24. Kehlenbach, R. H., R. Assheuer, A. Kehlenbach, J. Becker, and L. Gerace. 2001. Stimulation of nuclear export and inhibition of nuclear import by a Ran mutant deficient in binding to Ran-binding protein 1. J. Biol. Chem. 276:14524-14531.[Abstract/Free Full Text]
    25. 25
  25. Kehlenbach, R. H., A. Dickmanns, and L. Gerace. 1998. Nucleocytoplasmic shuttling factors including Ran and CRM1 mediate nuclear export of NFAT in vitro. J. Cell Biol. 141:863-874.[Abstract/Free Full Text]
    26. 26
  26. Kelkar, S. A., K. K. Pfister, R. G. Crystal, and P. L. Leopold. 2004. Cytoplasmic dynein mediates adenovirus binding to microtubules. J. Virol. 78:10122-10132.[Abstract/Free Full Text]
    27. 27
  27. Keller, M., T. Tagawa, M. Preuss, and A. D. Miller. 2002. Biophysical characterization of the DNA binding and condensing properties of adenoviral core peptide mu. Biochemistry 41:652-659.[CrossRef][Medline]
    28. 28
  28. Kobe, B. 1999. Autoinhibition by an internal nuclear localization signal revealed by the crystal structure of mammalian importin alpha. Nat. Struct. Biol. 6:388-397.[CrossRef][Medline]
    29. 29
  29. Lee, S. J., Y. Matsuura, S. M. Liu, and M. Stewart. 2005. Structural basis for nuclear import complex dissociation by RanGTP. Nature 435:693-696.[CrossRef][Medline]
    30. 30
  30. Lee, T. W., G. E. Blair, and D. A. Matthews. 2003. Adenovirus core protein VII contains distinct sequences that mediate targeting to the nucleus and nucleolus, and colocalization with human chromosomes. J. Gen. Virol. 84:3423-3428.[Abstract/Free Full Text]
    31. 31
  31. Lyman, S. K., T. Guan, J. Bednenko, H. Wodrich, and L. Gerace. 2002. Influence of cargo size on Ran and energy requirements for nuclear protein import. J. Cell Biol. 159:55-67.[Abstract/Free Full Text]
    32. 32
  32. Macara, I. G. 2001. Transport into and out of the nucleus. Microbiol. Mol. Biol. Rev. 65:570-594.[Abstract/Free Full Text]
    33. 33
  33. Matthews, D. A., and W. C. Russell. 1998. Adenovirus core protein V is delivered by the invading virus to the nucleus of the infected cell and later in infection is associated with nucleoli. J. Gen. Virol. 79:1671-1675.[Abstract]
    34. 34
  34. Meier, O., and U. F. Greber. 2004. Adenovirus endocytosis. J. Gene Med. 6(Suppl. 1):S152-S163.[CrossRef][Medline]
    35. 35
  35. Melchior, F., B. Paschal, J. Evans, and L. Gerace. 1993. Inhibition of nuclear protein import by nonhydrolyzable analogues of GTP and identification of the small GTPase Ran/TC4 as an essential transport factor. J. Cell Biol. 123:1649-1659.[Abstract/Free Full Text]
    36. 36
  36. Mirza, M. A., and J. Weber. 1982. Structure of adenovirus chromatin. Biochim. Biophys. Acta 696:76-86.[Medline]
    37. 37
  37. Mosammaparast, N., K. R. Jackson, Y. Guo, C. J. Brame, J. Shabanowitz, D. F. Hunt, and L. F. Pemberton. 2001. Nuclear import of histone H2A and H2B is mediated by a network of karyopherins. J. Cell Biol. 153:251-262.[Abstract/Free Full Text]
    38. 38
  38. Mosammaparast, N., and L. F. Pemberton. 2004. Karyopherins: from nuclear-transport mediators to nuclear-function regulators. Trends Cell Biol. 14:547-556.[CrossRef][Medline]
    39. 39
  39. Pollard, V. W., W. M. Michael, S. Nakielny, M. C. Siomi, F. Wang, and G. Dreyfuss. 1996. A novel receptor-mediated nuclear protein import pathway. Cell 86:985-994.[CrossRef][Medline]
    40. 40
  40. Rabe, B., A. Vlachou, N. Pante, A. Helenius, and M. Kann. 2003. Nuclear import of hepatitis B virus capsids and release of the viral genome. Proc. Natl. Acad. Sci. USA 100:9849-9854.[Abstract/Free Full Text]
    41. 41
  41. Ribbeck, K., and D. Gorlich. 2002. The permeability barrier of nuclear pore complexes appears to operate via hydrophobic exclusion. EMBO J. 21:2664-2671.[CrossRef][Medline]
    42. 42
  42. Robinson, A. J., J. W. Bodnar, D. H. Coombs, and G. D. Pearson. 1979. Replicating adenovirus 2 DNA molecules contain terminal protein. Virology 96:143-158.[CrossRef][Medline]
    43. 43
  43. Saban, S. D., R. R. Nepomuceno, L. D. Gritton, G. R. Nemerow, and P. L. Stewart. 2005. CryoEM structure at 9Å resolution of an adenovirus vector targeted to hematopoietic cells. J. Mol. Biol. 349:526-537.[CrossRef][Medline]
    44. 44
  44. Saphire, A. C., T. Guan, E. C. Schirmer, G. R. Nemerow, and L. Gerace. 2000. Nuclear import of adenovirus DNA in vitro involves the nuclear protein import pathway and hsc70. J. Biol. Chem. 275:4298-4304.[Abstract/Free Full Text]
    45. 45
  45. Sherman, M. P., C. M. de Noronha, M. I. Heusch, S. Greene, and W. C. Greene. 2001. Nucleocytoplasmic shuttling by human immunodeficiency virus type 1 Vpr. J. Virol. 75:1522-1532.[Abstract/Free Full Text]
    46. 46
  46. Smith, A. E., and A. Helenius. 2004. How viruses enter animal cells. Science 304:237-242.[Abstract/Free Full Text]
    47. 47
  47. Trotman, L. C., N. Mosberger, M. Fornerod, R. P. Stidwill, and U. F. Greber. 2001. Import of adenovirus DNA involves the nuclear pore complex receptor CAN/Nup214 and histone H1. Nat. Cell Biol. 3:1092-1100.[CrossRef][Medline]
    48. 48
  48. van Oostrum, J., and R. M. Burnett. 1985. Molecular composition of the adenovirus type 2 virion. J. Virol. 56:439-448.[Abstract/Free Full Text]
    49. 49
  49. Vayda, M. E., and S. J. Flint. 1987. Isolation and characterization of adenovirus core nucleoprotein subunits. J. Virol. 61:3335-3339.[Abstract/Free Full Text]
    50. 50
  50. Vayda, M. E., A. E. Rogers, and S. J. Flint. 1983. The structure of nucleoprotein cores released from adenovirions. Nucleic Acids Res. 11:441-460.[Abstract/Free Full Text]
    51. 51
  51. Wickham, T. J., P. Mathias, D. A. Cheresh, and G. R. Nemerow. 1993. Integrins alpha v beta 3 and alpha v beta 5 promote adenovirus internalization but not virus attachment. Cell 73:309-319.[CrossRef][Medline]
    52. 52
  52. Wiethoff, C. M., H. Wodrich, L. Gerace, and G. R. Nemerow. 2005. Adenovirus protein VI mediates membrane disruption following capsid disassembly. J. Virol. 79:1992-2000.[Abstract/Free Full Text]
    53. 53
  53. Zhao, L. J., and R. Padmanabhan. 1988. Nuclear transport of adenovirus DNA polymerase is facilitated by interaction with preterminal protein. Cell 55:1005-1015.[CrossRef][Medline]

Journal of Virology, October 2006, p. 9608-9618, Vol. 80, No. 19
0022-538X/06/$08.00+0     doi:10.1128/JVI.00850-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Russell, W. C. (2009). Adenoviruses: update on structure and function. J. Gen. Virol. 90: 1-20 [Abstract] [Full Text]  
  • Smith, J. G., Cassany, A., Gerace, L., Ralston, R., Nemerow, G. R. (2008). Neutralizing Antibody Blocks Adenovirus Infection by Arresting Microtubule-Dependent Cytoplasmic Transport. J. Virol. 82: 6492-6500 [Abstract] [Full Text]  
  • Stewart, C. L., Roux, K. J., Burke, B. (2007). Blurring the Boundary: The Nuclear Envelope Extends Its Reach. Science 318: 1408-1412 [Abstract] [Full Text]  
  • Saijou, E., Itoh, T., Kim, K.-W., Iemura, S.-i., Natsume, T., Miyajima, A. (2007). Nucleocytoplasmic Shuttling of the Zinc Finger Protein EZI Is Mediated by Importin-7-dependent Nuclear Import and CRM1-independent Export Mechanisms. J. Biol. Chem. 282: 32327-32337 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wodrich, H.
Right arrow Articles by Gerace, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wodrich, H.
Right arrow Articles by Gerace, L.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»